The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP023853	Escherichia coli strain 2/0 chromosome, complete genome	5174317	132558	161093	5174317	bacteriocin,transposase	Erysipelothrix_phage(20.0%)	31	NA	NA
AZH63405.1|132558_132843_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AZH63406.1|133010_133250_+	hypothetical protein	NA	NA	NA	NA	NA
AZH63407.1|133250_133541_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AZH63408.1|133707_133896_+	HNH endonuclease	NA	NA	NA	NA	NA
AZH63409.1|133949_134240_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AZH63410.1|134407_134647_+	hypothetical protein	NA	NA	NA	NA	NA
AZH63411.1|134647_134938_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AZH63412.1|135393_136158_+	pyruvate dehydrogenase complex repressor	NA	NA	NA	NA	NA
AZH63413.1|136154_136337_-	hypothetical protein	NA	NA	NA	NA	NA
AZH63414.1|136318_138982_+	pyruvate dehydrogenase E1 component	NA	NA	NA	NA	NA
AZH63415.1|138996_140889_+	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
AZH63416.1|141096_142521_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
AZH63417.1|142591_144355_-	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
AZH63418.1|144612_144729_+	aconitate hydratase	NA	NA	NA	NA	NA
AZH63419.1|144709_147307_+	aconitate hydratase B	NA	NA	NA	NA	NA
AZH63420.1|147481_147844_+	UPF0231 family protein	NA	NA	NA	NA	NA
AZH63421.1|147881_148676_-	S-adenosylmethionine decarboxylase proenzyme	NA	NA	NA	NA	NA
AZH63422.1|148691_149558_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
AZH63423.1|149663_150011_-	hypothetical protein	NA	NA	NA	NA	NA
AZH63424.1|150176_151727_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	3.5e-18
AZH63425.1|151773_154164_-	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
AZH63426.1|154369_154906_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
AZH63427.1|154946_155609_-	carbonate dehydratase	NA	NA	NA	NA	NA
AZH63428.1|155717_156644_+	multidrug ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
AZH63429.1|156640_157411_+	inner membrane transport permease YadH	NA	NA	NA	NA	NA
AZH63430.1|157515_157956_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AZH63431.1|158019_159249_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AZH63432.1|159252_159633_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
AZH63433.1|159582_159786_+	hypothetical protein	NA	NA	NA	NA	NA
AZH63434.1|159906_160827_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	48.8	4.9e-60
AZH63435.1|160895_161093_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
CP023853	Escherichia coli strain 2/0 chromosome, complete genome	5174317	856446	892114	5174317	transposase	Stx2-converting_phage(35.71%)	31	NA	NA
AZH64070.1|856446_857946_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
AZH64071.1|858101_858950_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AZH64072.1|859034_859232_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
AZH64073.1|859249_859738_-	hypothetical protein	NA	NA	NA	NA	NA
AZH64074.1|859734_860112_-	toxin	NA	NA	NA	NA	NA
AZH64075.1|860646_860868_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
AZH68108.1|860936_861383_-	hypothetical protein	NA	NA	NA	NA	NA
AZH64076.1|861427_861913_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.2	2.9e-11
AZH64077.1|862003_862822_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	1.0e-45
AZH64078.1|862911_863145_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AZH64079.1|863150_863828_-	hypothetical protein	NA	NA	NA	NA	NA
AZH64080.1|863975_864656_-	transcriptional regulator	NA	NA	NA	NA	NA
AZH64081.1|864858_865743_-	GTPase	NA	NA	NA	NA	NA
AZH64082.1|865848_866811_+	hypothetical protein	NA	NA	NA	NA	NA
AZH64083.1|867052_867157_-	copper resistance protein	NA	NA	NA	NA	NA
AZH64084.1|867118_867796_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AZH64085.1|867795_868143_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
AZH64086.1|868162_869734_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
AZH64087.1|871058_871238_+	hypothetical protein	NA	NA	NA	NA	NA
AZH64088.1|872355_873096_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AZH64089.1|873869_875918_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	33.5	1.1e-11
AZH64090.1|877892_879065_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.5	4.1e-229
AZH64091.1|880317_880527_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	92.0	2.3e-05
AZH64092.1|880689_880947_-	biofilm development YmgB/AriR family protein	NA	NA	NA	NA	NA
AZH68109.1|881286_881421_-	hypothetical protein	NA	NA	NA	NA	NA
AZH64093.1|882784_883399_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AZH64094.1|883403_886997_+	two-component system sensor histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	2.3e-36
AZH64095.1|887156_888695_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.2	1.6e-297
AZH64096.1|888744_889092_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	2.4e-60
AZH64097.1|889425_890581_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.8e-67
AZH64098.1|890841_892114_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 3
CP023853	Escherichia coli strain 2/0 chromosome, complete genome	5174317	987435	1098153	5174317	protease,tRNA,plate,integrase,head,holin,capsid,terminase,tail,portal	Enterobacteria_phage(43.16%)	133	1082825:1082840	1102146:1102161
AZH64191.1|987435_987756_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
AZH64192.1|987786_990063_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
AZH64193.1|990747_990966_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AZH64194.1|991250_991955_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AZH64195.1|991996_993718_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
AZH64196.1|993718_995485_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
AZH64197.1|995607_996573_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
AZH64198.1|997116_997611_+	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AZH64199.1|997745_1001852_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
AZH64200.1|1002010_1002622_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AZH64201.1|1002632_1003976_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
AZH64202.1|1004066_1005359_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AZH64203.1|1005664_1005805_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
AZH64204.1|1005996_1006257_-	hypothetical protein	NA	NA	NA	NA	NA
AZH64205.1|1006297_1007407_-	late control protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
AZH64206.1|1007564_1008749_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	8.4e-222
AZH64207.1|1008748_1009261_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
AZH64208.1|1009316_1009691_+|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	9.9e-36
AZH64209.1|1009618_1009855_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	94.1	4.3e-21
AZH64210.1|1009841_1012649_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.1	0.0e+00
AZH64211.1|1012655_1013150_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	2.1e-86
AZH64212.1|1013178_1013778_-	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
AZH64213.1|1013996_1014554_+|tail	phage tail protein	tail	A0A0A7NPY7	Enterobacteria_phage	88.5	5.0e-84
AZH64214.1|1014556_1015090_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	4.2e-96
AZH64215.1|1015118_1015646_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.7	2.6e-90
AZH64216.1|1015647_1017870_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	65.0	2.9e-183
AZH64217.1|1017872_1018403_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	3.6e-92
AZH64218.1|1018395_1019292_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.3e-154
AZH64219.1|1019295_1019646_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	3.5e-59
AZH64220.1|1019642_1020224_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	3.3e-102
AZH64221.1|1020220_1020856_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
AZH64222.1|1020848_1021316_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	3.5e-83
AZH64223.1|1021339_1023217_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	H6WZJ9	Escherichia_phage	80.2	2.7e-299
AZH64224.1|1023355_1023751_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	93.3	1.0e-59
AZH64225.1|1023747_1024140_-	peptidase M15	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	1.9e-69
AZH64226.1|1024136_1024460_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
AZH64227.1|1024462_1024663_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
AZH64228.1|1024662_1025157_-|capsid	capsid assembly protein	capsid	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
AZH64229.1|1025258_1026059_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	6.9e-127
AZH64230.1|1026104_1027157_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	1.4e-188
AZH64231.1|1027180_1028017_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
AZH64232.1|1028171_1029923_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
AZH64233.1|1029922_1030969_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
AZH64234.1|1030983_1031508_-	hypothetical protein	NA	NA	NA	NA	NA
AZH64235.1|1032231_1032729_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
AZH64236.1|1032768_1033611_+	hypothetical protein	NA	NA	NA	NA	NA
AZH64237.1|1033694_1034009_-	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.3	4.1e-19
AZH64238.1|1034013_1034973_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	4.2e-179
AZH68113.1|1035049_1037734_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	98.4	0.0e+00
AZH64239.1|1037878_1038244_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
AZH64240.1|1038316_1038547_-	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	97.4	9.1e-32
AZH64241.1|1038603_1038819_+	hypothetical protein	NA	NA	NA	NA	NA
AZH64242.1|1038869_1039169_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	2.4e-40
AZH64243.1|1039165_1039432_-	MarR family transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
AZH64244.1|1039428_1039632_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
AZH64245.1|1039655_1040066_-	hypothetical protein	NA	NA	NA	NA	NA
AZH64246.1|1040269_1040512_-	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
AZH64247.1|1040523_1040802_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
AZH64248.1|1040812_1041163_-	DUF4761 domain-containing protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	8.1e-56
AZH64249.1|1041300_1041492_+	hypothetical protein	NA	NA	NA	NA	NA
AZH64250.1|1041498_1041921_-	hypothetical protein	NA	NA	NA	NA	NA
AZH64251.1|1041925_1042447_-	transcriptional regulator	NA	NA	NA	NA	NA
AZH64252.1|1042551_1042893_+	XRE family transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	51.2	4.7e-16
AZH64253.1|1042962_1043955_+|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.2	1.3e-103
AZH64254.1|1044254_1046699_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
AZH64255.1|1046709_1047327_+	dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
AZH64256.1|1047328_1048192_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AZH64257.1|1048227_1048854_-	hydrolase	NA	NA	NA	NA	NA
AZH64258.1|1049167_1050316_+	MFS transporter	NA	NA	NA	NA	NA
AZH64259.1|1050412_1051153_-	pyruvate formate lyase-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
AZH64260.1|1051344_1053627_-	formate acetyltransferase 1	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
AZH64261.1|1053681_1054539_-	formate transporter FocA	NA	NA	NA	NA	NA
AZH64262.1|1054944_1056705_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
AZH64263.1|1056834_1057527_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AZH64264.1|1057725_1058814_+	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
AZH64265.1|1058884_1060168_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AZH64266.1|1060423_1060996_-	DNA invertase	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
AZH64267.1|1061055_1061496_+|tail	phage tail protein	tail	K7PH60	Enterobacterial_phage	55.6	7.1e-41
AZH64268.1|1061506_1061968_+|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	50.0	3.9e-34
AZH64269.1|1061974_1062589_-|tail	phage tail protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
AZH64270.1|1062588_1063920_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	44.4	4.8e-40
AZH64271.1|1063922_1064501_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
AZH64272.1|1064493_1065597_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
AZH64273.1|1065587_1065935_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
AZH64274.1|1065989_1066586_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
AZH64275.1|1066582_1067737_-	phage protein D	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
AZH64276.1|1067724_1067940_-	hypothetical protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
AZH64277.1|1067936_1068821_-	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.9	6.8e-51
AZH64278.1|1068820_1071772_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
AZH64279.1|1071847_1072006_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AZH64280.1|1071929_1072265_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AZH64281.1|1072362_1072644_-	hypothetical protein	NA	NA	NA	NA	NA
AZH64282.1|1072646_1073168_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
AZH64283.1|1073167_1074595_-|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
AZH64284.1|1074584_1074839_-	hypothetical protein	NA	NA	NA	NA	NA
AZH64285.1|1074835_1075300_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AZH64286.1|1075299_1075746_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AZH64287.1|1075747_1076086_-	DUF2190 domain-containing protein	NA	NA	NA	NA	NA
AZH64288.1|1076095_1077049_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
AZH64289.1|1077063_1078179_-	peptidase	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
AZH64290.1|1078393_1078852_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
AZH64291.1|1078854_1079676_-|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
AZH64292.1|1079656_1081153_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
AZH64293.1|1081152_1082748_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	6.5e-185
AZH64294.1|1082744_1083290_-	DUF3486 domain-containing protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
1082825:1082840	attL	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
AZH64295.1|1083289_1083601_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AZH64296.1|1083600_1083927_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
AZH64297.1|1083923_1084574_-	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
AZH64298.1|1084557_1085298_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
AZH64299.1|1085300_1085651_-	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
AZH64300.1|1085781_1086510_+	hypothetical protein	NA	NA	NA	NA	NA
AZH64301.1|1086485_1086890_-	hypothetical protein	NA	NA	NA	NA	NA
AZH64302.1|1086888_1087104_+	hypothetical protein	NA	NA	NA	NA	NA
AZH64303.1|1087294_1088059_+	restriction endonuclease subunit M	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
AZH64304.1|1088175_1088532_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZH64305.1|1088625_1088814_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
AZH64306.1|1088866_1089175_+	IclR family transcriptional regulator	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
AZH64307.1|1089185_1090106_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	55.9	1.7e-73
AZH64308.1|1090105_1090423_+	hypothetical protein	NA	NA	NA	NA	NA
AZH64309.1|1090438_1092208_+|integrase	integrase	integrase	A4JWN2	Burkholderia_virus	69.4	1.5e-227
AZH64310.1|1092218_1093385_+	hypothetical protein	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
AZH64311.1|1093387_1093657_+	hypothetical protein	NA	NA	NA	NA	NA
AZH64312.1|1093684_1094215_+	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
AZH64313.1|1094225_1094447_-	hypothetical protein	NA	NA	NA	NA	NA
AZH64314.1|1094503_1094776_+	hypothetical protein	NA	NA	NA	NA	NA
AZH64315.1|1094785_1095082_+	hypothetical protein	NA	NA	NA	NA	NA
AZH64316.1|1095096_1095312_+	hypothetical protein	NA	NA	NA	NA	NA
AZH64317.1|1095308_1095992_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
AZH64318.1|1095988_1096219_+	hypothetical protein	NA	NA	NA	NA	NA
AZH64319.1|1096208_1096415_+	hypothetical protein	NA	NA	NA	NA	NA
AZH64320.1|1096416_1096866_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
AZH64321.1|1096837_1097227_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
AZH64322.1|1097370_1098153_+|protease	metalloprotease	protease	NA	NA	NA	NA
1102146:1102161	attR	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
>prophage 4
CP023853	Escherichia coli strain 2/0 chromosome, complete genome	5174317	1308553	1359735	5174317	transposase,tRNA,integrase,head,holin,capsid,terminase,tail,portal	Enterobacteria_phage(53.7%)	67	1301189:1301204	1364597:1364612
1301189:1301204	attL	TAGCTTTGGAAAACAG	NA	NA	NA	NA
AZH64520.1|1308553_1309660_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AZH64521.1|1309713_1310175_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AZH64522.1|1310184_1310838_-	23S rRNA pseudouridine synthase E	NA	NA	NA	NA	NA
AZH64523.1|1311009_1312260_+	isocitrate dehydrogenase (NADP(+))	NA	Q77Z09	Phage_21	100.0	3.8e-23
AZH64524.1|1312373_1313516_-|integrase	integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
AZH64525.1|1313505_1313742_-	excisionase	NA	NA	NA	NA	NA
AZH64526.1|1313881_1314121_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
AZH64527.1|1314104_1314431_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
AZH64528.1|1314430_1314652_-	conjugal transfer protein TraR	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
AZH64529.1|1314750_1315032_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
AZH64530.1|1315042_1315234_-	hypothetical protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
AZH64531.1|1315206_1315389_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
AZH64532.1|1315385_1316066_-	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
AZH64533.1|1316062_1316848_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AZH64534.1|1316853_1317150_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
AZH64535.1|1317225_1317432_-	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
AZH64536.1|1318027_1318783_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
AZH64537.1|1318821_1319052_+	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
AZH64538.1|1319121_1319661_+	regulator	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
AZH64539.1|1319657_1320677_+	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	64.1	8.8e-111
AZH64540.1|1320673_1321375_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.0	1.5e-125
AZH64541.1|1321624_1325890_+	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AZH64542.1|1325926_1326970_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZH64543.1|1327319_1327421_+	hypothetical protein	NA	NA	NA	NA	NA
AZH64544.1|1327417_1327873_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
AZH64545.1|1327872_1328043_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
AZH64546.1|1328035_1328326_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
AZH64547.1|1328322_1328685_+	hypothetical protein	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
AZH64548.1|1328681_1328822_+	hypothetical protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
AZH64549.1|1328818_1329508_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
AZH64550.1|1329817_1330135_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	86.1	3.3e-40
AZH64551.1|1330121_1330598_+	lysozyme	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
AZH64552.1|1330814_1330997_+	hypothetical protein	NA	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
AZH64553.1|1331087_1331381_-	lipoprotein bor	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
AZH64554.1|1331807_1332188_+	hypothetical protein	NA	H6WZK5	Escherichia_phage	72.2	2.6e-39
AZH64555.1|1332310_1332664_-	hypothetical protein	NA	NA	NA	NA	NA
AZH68127.1|1332551_1332872_-	hypothetical protein	NA	NA	NA	NA	NA
AZH64556.1|1332806_1333001_+	DNA-packaging protein	NA	NA	NA	NA	NA
AZH64557.1|1333140_1333686_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
AZH64558.1|1333660_1335586_+|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
AZH64559.1|1335582_1335789_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AZH64560.1|1335785_1337387_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
AZH64561.1|1337367_1338687_+|capsid	capsid assembly protein	capsid	A0A2I6TC87	Escherichia_phage	97.7	1.1e-230
AZH64562.1|1338696_1339029_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
AZH64563.1|1339084_1340110_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
AZH64564.1|1340151_1340550_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	1.0e-62
AZH64565.1|1340561_1340915_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
AZH64566.1|1340926_1341505_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.7	5.9e-80
AZH64567.1|1341501_1341897_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
AZH68128.1|1341904_1342645_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	1.6e-130
AZH64568.1|1342660_1343083_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
AZH64569.1|1343064_1343499_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AZH64570.1|1343491_1346053_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.6	0.0e+00
AZH64571.1|1346049_1346379_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
AZH64572.1|1346378_1347077_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
AZH64573.1|1347081_1347825_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
AZH64574.1|1347722_1348364_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.5	2.9e-96
AZH64575.1|1348424_1351907_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
AZH64576.1|1353230_1353656_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
AZH64577.1|1353652_1354003_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AZH64578.1|1354033_1355647_+|transposase	IS66 family transposase ISEc23	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
AZH68129.1|1355948_1356527_+	hypothetical protein	NA	A0A0E3M0V5	Enterobacteria_phage	75.9	2.2e-82
AZH64579.1|1356523_1356802_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
AZH64580.1|1356814_1357108_+	hypothetical protein	NA	NA	NA	NA	NA
AZH64581.1|1357199_1358057_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AZH64582.1|1358053_1358911_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AZH64583.1|1358907_1359735_-	manganese/iron transporter ATP-binding protein	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	29.0	1.9e-07
1364597:1364612	attR	TAGCTTTGGAAAACAG	NA	NA	NA	NA
>prophage 5
CP023853	Escherichia coli strain 2/0 chromosome, complete genome	5174317	1494769	1564483	5174317	protease,lysis,integrase,head,holin,capsid,terminase,tail,portal	Enterobacteria_phage(27.59%)	85	1490943:1490957	1496853:1496867
1490943:1490957	attL	ACTCCTTGTTCGGGA	NA	NA	NA	NA
AZH64716.1|1494769_1495900_-|integrase	integrase	integrase	O21940	Phage_21	51.4	3.4e-103
AZH64717.1|1495877_1496126_-	excisionase	NA	NA	NA	NA	NA
AZH64718.1|1496190_1498662_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
1496853:1496867	attR	ACTCCTTGTTCGGGA	NA	NA	NA	NA
AZH64719.1|1498754_1498946_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
AZH64720.1|1498942_1499131_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AZH64721.1|1499453_1499648_+	hypothetical protein	NA	NA	NA	NA	NA
AZH64722.1|1499696_1499915_-	hypothetical protein	NA	NA	NA	NA	NA
AZH64723.1|1499944_1500115_-	hypothetical protein	NA	NA	NA	NA	NA
AZH68140.1|1500074_1500230_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
AZH64724.1|1500502_1501219_-	LexA family transcriptional repressor	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
AZH64725.1|1501268_1501484_+	transcriptional regulator	NA	NA	NA	NA	NA
AZH64726.1|1501480_1501906_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AZH68141.1|1501928_1502891_+	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
AZH64727.1|1502897_1503644_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
AZH64728.1|1503665_1504436_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
AZH64729.1|1504451_1504877_+	DUF977 domain-containing protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
AZH64730.1|1505051_1505717_+	hypothetical protein	NA	NA	NA	NA	NA
AZH64731.1|1505897_1506110_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
AZH64732.1|1506151_1506331_-	hypothetical protein	NA	NA	NA	NA	NA
AZH64733.1|1506277_1506550_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
AZH64734.1|1506551_1507607_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
AZH64735.1|1507607_1507988_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.9e-35
AZH64736.1|1507984_1508806_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.7e-80
AZH64737.1|1509032_1509230_+	TrmB family transcriptional regulator	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
AZH64738.1|1509381_1510431_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	4.4e-198
AZH64739.1|1510870_1511197_+	hypothetical protein	NA	NA	NA	NA	NA
AZH64740.1|1511232_1511364_+	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	100.0	1.1e-05
AZH64741.1|1511644_1511980_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
AZH64742.1|1512240_1514094_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
AZH64743.1|1514244_1514460_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
AZH64744.1|1514464_1514809_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
AZH64745.1|1514774_1515047_-	hypothetical protein	NA	NA	NA	NA	NA
AZH64746.1|1515152_1515686_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
AZH64747.1|1515763_1515976_+	hypothetical protein	NA	A0A0M4S639	Salmonella_phage	60.5	2.7e-06
AZH68142.1|1516240_1516327_+	hypothetical protein	NA	NA	NA	NA	NA
AZH64748.1|1516328_1516823_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	87.7	1.7e-72
AZH64749.1|1516819_1517035_+	hypothetical protein	NA	NA	NA	NA	NA
AZH68143.1|1517031_1517196_+	hypothetical protein	NA	Q9T1L1	Enterobacteria_phage	77.8	3.3e-12
AZH64750.1|1517233_1517434_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
AZH64751.1|1517475_1517841_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
AZH64752.1|1518131_1518695_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
AZH64753.1|1518691_1520353_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
AZH64754.1|1520416_1522354_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
AZH68144.1|1522398_1522620_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
AZH64755.1|1522565_1525151_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.9	0.0e+00
AZH64756.1|1525147_1525474_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
AZH64757.1|1525483_1525834_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AZH64758.1|1525830_1526277_+	hypothetical protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AZH64759.1|1526273_1526618_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AZH64760.1|1526684_1527401_+|tail	phage tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
AZH64761.1|1527415_1527790_+|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
AZH64762.1|1527813_1528095_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.9	2.3e-45
AZH64763.1|1528142_1531385_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.6	0.0e+00
AZH64764.1|1531377_1531719_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
AZH64765.1|1531718_1532417_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
AZH64766.1|1532427_1533171_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	4.3e-147
AZH64767.1|1533068_1533749_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.8	3.8e-110
AZH64768.1|1534091_1537565_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
AZH64769.1|1537632_1538091_+	hypothetical protein	NA	Q9EV15	Enterobacteria_phage	89.0	9.5e-65
AZH64770.1|1539760_1540507_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
AZH64771.1|1540968_1543794_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	63.6	9.0e-04
AZH64772.1|1543795_1544329_+|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
AZH64773.1|1544359_1544887_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.7	8.4e-73
AZH64774.1|1544902_1545871_-|tail	phage tail protein	tail	A0A0F7LDR4	Escherichia_phage	38.8	6.5e-47
AZH68145.1|1545996_1546179_+	DNA-invertase	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
AZH64775.1|1546295_1546433_+|capsid	nucleocapsid protein	capsid	NA	NA	NA	NA
AZH68146.1|1546377_1547004_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZH64776.1|1547102_1547372_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
AZH64777.1|1547783_1548341_-	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
AZH64778.1|1548337_1548613_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
AZH64779.1|1548988_1549795_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AZH64780.1|1549794_1550988_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AZH64781.1|1550999_1552358_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
AZH64782.1|1552361_1553957_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
AZH64783.1|1553956_1555519_-	anthranilate synthase component I	NA	NA	NA	NA	NA
AZH68147.1|1555610_1555655_-	trp operon leader peptide	NA	NA	NA	NA	NA
AZH64784.1|1555792_1556674_+	phosphatase	NA	NA	NA	NA	NA
AZH64785.1|1556670_1557291_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AZH64786.1|1557318_1559214_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
AZH64787.1|1559426_1560302_+	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
AZH68148.1|1560507_1561494_+	hypothetical protein	NA	NA	NA	NA	NA
AZH64788.1|1561503_1561812_+	hypothetical protein	NA	NA	NA	NA	NA
AZH64789.1|1561868_1562459_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AZH64790.1|1562455_1563214_-	NAD(P)-dependent oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
AZH64791.1|1563433_1564483_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 6
CP023853	Escherichia coli strain 2/0 chromosome, complete genome	5174317	2058869	2147115	5174317	transposase,tRNA,plate,integrase,head,holin,capsid,terminase,tail,portal	Escherichia_phage(22.22%)	107	2104566:2104625	2147177:2147301
AZH65258.1|2058869_2059592_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	54.4	1.6e-69
AZH65259.1|2059696_2060218_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AZH65260.1|2060327_2061338_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
AZH65261.1|2061346_2061958_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AZH68166.1|2062096_2062162_-	hypothetical protein	NA	NA	NA	NA	NA
AZH65262.1|2062232_2062835_+	hypothetical protein	NA	NA	NA	NA	NA
AZH65263.1|2062836_2063358_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
AZH65264.1|2063392_2064133_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AZH65265.1|2064161_2064614_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
AZH65266.1|2064606_2066379_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AZH65267.1|2066688_2067255_+	hydrolase	NA	NA	NA	NA	NA
AZH65268.1|2067251_2068070_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
AZH65269.1|2068122_2068518_+	hypothetical protein	NA	NA	NA	NA	NA
AZH65270.1|2068558_2069302_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
AZH65271.1|2069298_2070270_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AZH65272.1|2070305_2072735_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	NA	NA	NA	NA
AZH65273.1|2072759_2073860_-	cytochrome C	NA	NA	NA	NA	NA
AZH65274.1|2074247_2074994_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AZH68167.1|2075007_2075574_-	VOC family protein	NA	NA	NA	NA	NA
AZH65275.1|2075789_2077523_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
AZH65276.1|2077575_2077968_-	flagellar protein FlhE	NA	NA	NA	NA	NA
AZH65277.1|2077967_2080046_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
AZH65278.1|2080038_2081187_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
AZH65279.1|2081375_2082020_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
AZH65280.1|2082030_2082420_-	two-component system response regulator	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
AZH65281.1|2082434_2083484_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
AZH65282.1|2083486_2084347_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
AZH65283.1|2084637_2086299_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
AZH65284.1|2086443_2086947_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AZH65285.1|2086967_2088932_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
AZH65286.1|2088936_2089863_-	motility protein MotB	NA	NA	NA	NA	NA
AZH65287.1|2089859_2090747_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
AZH65288.1|2090873_2091452_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
AZH65289.1|2091454_2091805_-	flagellar transcriptional activator FlhD	NA	NA	NA	NA	NA
AZH65290.1|2092584_2093013_+	universal stress protein UspC	NA	NA	NA	NA	NA
AZH65291.1|2093019_2094444_-	trehalose-6-phosphate synthase	NA	NA	NA	NA	NA
AZH65292.1|2094418_2095219_-	trehalose-phosphatase	NA	NA	NA	NA	NA
AZH65293.1|2095385_2096372_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
AZH65294.1|2096386_2097901_-	arabinose import ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
AZH65295.1|2097970_2098960_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZH65296.1|2099045_2099285_-	hypothetical protein	NA	NA	NA	NA	NA
AZH65297.1|2099754_2100258_+	non-heme ferritin	NA	NA	NA	NA	NA
AZH65298.1|2100335_2100587_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
AZH65299.1|2100698_2100845_+	hypothetical protein	NA	NA	NA	NA	NA
AZH65300.1|2101051_2101375_+	hypothetical protein	NA	NA	NA	NA	NA
AZH65301.1|2101546_2102044_+	non-heme ferritin	NA	NA	NA	NA	NA
AZH65302.1|2102081_2102321_-	DUF2492 domain-containing protein	NA	NA	NA	NA	NA
AZH65303.1|2102511_2103723_+	tyrosine transporter	NA	NA	NA	NA	NA
AZH65304.1|2103773_2104439_-	YecA family protein	NA	NA	NA	NA	NA
2104566:2104625	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
AZH65305.1|2104910_2105330_-	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
AZH65306.1|2106544_2106769_-|tail	phage tail protein	tail	NA	NA	NA	NA
AZH68168.1|2106930_2107320_-	hypothetical protein	NA	E5FFG4	Burkholderia_phage	37.9	1.0e-14
AZH65307.1|2107355_2108996_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
AZH65308.1|2109104_2109386_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AZH65309.1|2109398_2109911_-|tail	phage tail protein	tail	NA	NA	NA	NA
AZH65310.1|2109928_2111431_-|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
AZH65311.1|2111427_2111817_-	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
AZH65312.1|2111816_2113001_-	hypothetical protein	NA	J9QDX3	Clostridium_phage	35.2	2.5e-16
AZH65313.1|2112993_2113620_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
AZH65314.1|2113622_2114543_-|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
AZH65315.1|2114539_2114881_-|plate	baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	1.1e-20
AZH65316.1|2114883_2115786_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
AZH65317.1|2115766_2116303_-	hypothetical protein	NA	NA	NA	NA	NA
AZH65318.1|2116299_2116980_-	hypothetical protein	NA	NA	NA	NA	NA
AZH65319.1|2117011_2117392_-	hypothetical protein	NA	NA	NA	NA	NA
AZH65320.1|2117388_2117808_-	DNA-packaging protein	NA	NA	NA	NA	NA
AZH65321.1|2117842_2118877_-|capsid	minor capsid protein E	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
AZH65322.1|2118935_2119265_-|head	head protein	head	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
AZH65323.1|2119264_2120572_-|capsid	capsid assembly protein	capsid	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
AZH65324.1|2120571_2122146_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
AZH65325.1|2122142_2122376_-	hypothetical protein	NA	NA	NA	NA	NA
AZH65326.1|2122375_2124238_-|terminase	terminase	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
AZH65327.1|2124224_2124791_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
AZH68169.1|2125159_2125405_+	hypothetical protein	NA	NA	NA	NA	NA
AZH65328.1|2125464_2125659_-	hypothetical protein	NA	NA	NA	NA	NA
AZH65329.1|2125666_2126146_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
AZH65330.1|2126145_2126418_-|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
AZH65331.1|2126417_2126801_-	hypothetical protein	NA	NA	NA	NA	NA
AZH65332.1|2126913_2127585_-	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
AZH65333.1|2127584_2127878_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
AZH65334.1|2127874_2128471_-	DUF1367 domain-containing protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
AZH65335.1|2128548_2128728_-	hypothetical protein	NA	NA	NA	NA	NA
AZH65336.1|2128879_2129521_-	hypothetical protein	NA	NA	NA	NA	NA
AZH65337.1|2129764_2129998_+	hypothetical protein	NA	NA	NA	NA	NA
AZH65338.1|2130396_2130885_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
AZH65339.1|2130894_2131500_+	hypothetical protein	NA	NA	NA	NA	NA
AZH65340.1|2131962_2132661_-	lysogenic protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
AZH65341.1|2133848_2134772_+	hypothetical protein	NA	NA	NA	NA	NA
AZH68170.1|2134946_2135735_-	hypothetical protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
AZH65342.1|2136007_2136229_-	hypothetical protein	NA	NA	NA	NA	NA
AZH65343.1|2136416_2136641_-	hypothetical protein	NA	NA	NA	NA	NA
AZH65344.1|2136637_2136949_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
AZH65345.1|2136945_2137182_-	hypothetical protein	NA	NA	NA	NA	NA
AZH65346.1|2137183_2137594_-	hypothetical protein	NA	NA	NA	NA	NA
AZH65347.1|2137632_2139048_-	helicase DnaB	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
AZH65348.1|2139037_2139793_-	replication protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
AZH65349.1|2139789_2140014_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
AZH65350.1|2140053_2140530_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
AZH65351.1|2140588_2140819_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
AZH65352.1|2140917_2141331_+	transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
AZH65353.1|2142341_2142662_+	hypothetical protein	NA	NA	NA	NA	NA
AZH65354.1|2142692_2144909_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
AZH65355.1|2144905_2145475_+	hypothetical protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
AZH65356.1|2145474_2145657_+	hypothetical protein	NA	NA	NA	NA	NA
AZH65357.1|2145706_2145931_+	hypothetical protein	NA	H9C154	Pectobacterium_phage	56.3	7.3e-10
AZH65358.1|2145866_2146130_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
AZH65359.1|2146098_2147115_+|integrase	integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
2147177:2147301	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAAT	NA	NA	NA	NA
>prophage 7
CP023853	Escherichia coli strain 2/0 chromosome, complete genome	5174317	2196667	2274101	5174317	transposase,integrase	Bacillus_phage(30.0%)	60	2199663:2199678	2277129:2277144
AZH65420.1|2196667_2197390_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	54.4	3.1e-70
AZH65421.1|2197494_2198016_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AZH65422.1|2198276_2198927_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
AZH65423.1|2198962_2199292_+	hypothetical protein	NA	NA	NA	NA	NA
2199663:2199678	attL	GTTCAGCCGCTCCGGC	NA	NA	NA	NA
AZH68172.1|2199779_2200577_+	protein MtfA	NA	NA	NA	NA	NA
AZH65424.1|2200914_2202177_+|integrase	integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.5	2.6e-72
AZH65425.1|2202370_2203675_-	salicylate synthase	NA	NA	NA	NA	NA
AZH65426.1|2203702_2204983_-	MFS transporter	NA	NA	NA	NA	NA
AZH65427.1|2204975_2206778_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
AZH65428.1|2206764_2208567_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.6	6.5e-32
AZH65429.1|2208733_2209693_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZH65430.1|2209883_2215991_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	27.3	1.8e-33
AZH65431.1|2216078_2225570_+	polyketide synthase	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
AZH65432.1|2225566_2226667_+	thiazolinyl imide reductase	NA	NA	NA	NA	NA
AZH65433.1|2226663_2227467_+	thioesterase	NA	NA	NA	NA	NA
AZH65434.1|2227470_2229048_+	2,3-dihydroxybenzoate-AMP ligase	NA	NA	NA	NA	NA
AZH65435.1|2229178_2231200_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AZH65436.1|2231792_2232599_+	hypothetical protein	NA	NA	NA	NA	NA
AZH65437.1|2232525_2232696_+	adhesin	NA	NA	NA	NA	NA
AZH65438.1|2232731_2233994_+	adhesin	NA	NA	NA	NA	NA
AZH65439.1|2234213_2234690_+	invasin	NA	NA	NA	NA	NA
AZH65440.1|2234817_2235870_-	hypothetical protein	NA	NA	NA	NA	NA
AZH65441.1|2236184_2237501_+	MFS transporter	NA	NA	NA	NA	NA
AZH65442.1|2237602_2239057_+	AMP nucleosidase	NA	NA	NA	NA	NA
AZH65443.1|2239399_2240116_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AZH65444.1|2240326_2240530_+	hypothetical protein	NA	NA	NA	NA	NA
AZH65445.1|2240745_2242233_-	FMN/FAD transporter	NA	NA	NA	NA	NA
AZH65446.1|2242506_2243457_-	transcriptional regulator Cbl	NA	NA	NA	NA	NA
AZH65447.1|2243558_2244476_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
AZH65448.1|2244933_2245866_-	L,D-transpeptidase	NA	NA	NA	NA	NA
AZH65449.1|2245930_2247010_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
AZH65450.1|2247021_2247765_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
AZH65451.1|2247761_2248307_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
AZH65452.1|2248458_2248581_-	cobalamin biosynthesis protein	NA	NA	NA	NA	NA
AZH65453.1|2249674_2249872_+	hypothetical protein	NA	NA	NA	NA	NA
AZH65454.1|2249799_2250027_-	hypothetical protein	NA	NA	NA	NA	NA
AZH65455.1|2249978_2252126_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AZH65456.1|2252496_2253141_-	transcriptional regulator	NA	A0A0F7L444	uncultured_marine_virus	50.5	8.2e-54
AZH68173.1|2253125_2254349_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.5	2.0e-61
AZH65457.1|2255396_2256050_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
AZH65458.1|2256063_2257260_+	hypothetical protein	NA	NA	NA	NA	NA
AZH68174.1|2257237_2257819_+	acetyltransferase	NA	NA	NA	NA	NA
AZH65459.1|2257820_2258594_+	YaiO family outer membrane beta-barrel protein	NA	NA	NA	NA	NA
AZH65460.1|2259595_2260810_+	ribokinase	NA	NA	NA	NA	NA
AZH65461.1|2260823_2261582_+	cytoplasmic protein	NA	NA	NA	NA	NA
AZH65462.1|2261635_2262601_+	hypothetical protein	NA	NA	NA	NA	NA
AZH65463.1|2262603_2263638_+	phosphotriesterase	NA	NA	NA	NA	NA
AZH65464.1|2265952_2266450_-	hypothetical protein	NA	NA	NA	NA	NA
AZH65465.1|2266350_2266752_-	hypothetical protein	NA	NA	NA	NA	NA
AZH65466.1|2266917_2267523_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AZH65467.1|2267686_2267887_+	hypothetical protein	NA	NA	NA	NA	NA
AZH65468.1|2268126_2268267_-	hemolysin expression modulating family protein	NA	NA	NA	NA	NA
AZH68175.1|2268253_2268634_+	hypothetical protein	NA	NA	NA	NA	NA
AZH65469.1|2268601_2268835_-	hypothetical protein	NA	NA	NA	NA	NA
AZH65470.1|2269066_2270263_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AZH65471.1|2270311_2270665_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AZH65472.1|2270743_2271361_+	hypothetical protein	NA	NA	NA	NA	NA
AZH65473.1|2271834_2272050_+	hypothetical protein	NA	NA	NA	NA	NA
AZH65474.1|2272386_2273082_-|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	88.4	2.3e-118
AZH65475.1|2273078_2274101_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
2277129:2277144	attR	GCCGGAGCGGCTGAAC	NA	NA	NA	NA
>prophage 8
CP023853	Escherichia coli strain 2/0 chromosome, complete genome	5174317	2288716	2295168	5174317	transposase	Acidithiobacillus_phage(16.67%)	9	NA	NA
AZH65487.1|2288716_2290258_+|transposase	IS21 family transposase ISEc12	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
AZH65488.1|2290272_2291019_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
AZH65489.1|2291467_2291878_+	hypothetical protein	NA	NA	NA	NA	NA
AZH65490.1|2292098_2292917_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
AZH65491.1|2292916_2293162_+	antirestriction protein	NA	NA	NA	NA	NA
AZH65492.1|2293255_2293729_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
AZH68178.1|2293774_2294221_+	hypothetical protein	NA	NA	NA	NA	NA
AZH65493.1|2294283_2294505_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
AZH65494.1|2294523_2295168_+	antitoxin of toxin-antitoxin stability system	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
>prophage 9
CP023853	Escherichia coli strain 2/0 chromosome, complete genome	5174317	2325971	2332274	5174317		Enterobacteria_phage(66.67%)	6	NA	NA
AZH65526.1|2325971_2326514_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
AZH65527.1|2326518_2327397_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
AZH65528.1|2327454_2328354_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
AZH68182.1|2328353_2329439_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
AZH65529.1|2329811_2330705_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
AZH65530.1|2330879_2332274_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
>prophage 10
CP023853	Escherichia coli strain 2/0 chromosome, complete genome	5174317	2426450	2435895	5174317		Enterobacteria_phage(85.71%)	10	NA	NA
AZH65599.1|2426450_2427587_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
AZH65600.1|2427583_2429587_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
AZH65601.1|2429711_2430173_+	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
AZH65602.1|2430213_2430684_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AZH65603.1|2430730_2431450_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AZH65604.1|2431446_2433132_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AZH65605.1|2433353_2434085_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
AZH65606.1|2434144_2434252_+	hypothetical protein	NA	NA	NA	NA	NA
AZH65607.1|2434232_2434964_-	ABC transporter permease	NA	NA	NA	NA	NA
AZH65608.1|2434968_2435895_-	ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.6e-08
>prophage 11
CP023853	Escherichia coli strain 2/0 chromosome, complete genome	5174317	2811630	2858801	5174317	integrase,holin,terminase,tail	Escherichia_phage(48.08%)	60	2813458:2813474	2855687:2855703
AZH65949.1|2811630_2811783_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	90.0	7.1e-17
AZH65950.1|2811800_2811992_+	DUF2633 domain-containing protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
AZH65951.1|2812053_2812191_+	succinate dehydrogenase	NA	NA	NA	NA	NA
AZH65952.1|2812293_2812812_+	hypothetical protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
AZH65953.1|2812827_2813367_+	hypothetical protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
2813458:2813474	attL	AATCATTCCCACTCAAT	NA	NA	NA	NA
AZH65954.1|2813561_2814059_-	DUF2514 domain-containing protein	NA	A0A193GYU6	Enterobacter_phage	67.7	1.1e-53
AZH65955.1|2814055_2814685_-	endolysin	NA	G9L6E8	Escherichia_phage	96.2	8.4e-112
AZH65956.1|2814674_2814983_-|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	91.2	7.3e-45
AZH65957.1|2814972_2815374_-	hypothetical protein	NA	A0A193GYV1	Enterobacter_phage	85.0	5.4e-56
AZH65958.1|2815471_2818123_-	hypothetical protein	NA	G9L6E4	Escherichia_phage	78.3	8.5e-65
AZH68189.1|2818318_2818576_+	hypothetical protein	NA	G9L6E3	Escherichia_phage	100.0	3.4e-43
AZH65959.1|2818599_2819106_-	hypothetical protein	NA	NA	NA	NA	NA
AZH68190.1|2819095_2819599_-	hypothetical protein	NA	NA	NA	NA	NA
AZH65960.1|2820046_2820703_+	phage antirepressor Ant	NA	A0A0P0ZDY7	Stx2-converting_phage	81.0	7.5e-55
AZH65961.1|2820832_2821159_+	hypothetical protein	NA	NA	NA	NA	NA
AZH65962.1|2821145_2821658_+	hypothetical protein	NA	NA	NA	NA	NA
AZH65963.1|2821739_2821901_+	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
AZH65964.1|2821937_2822387_-	hypothetical protein	NA	NA	NA	NA	NA
AZH65965.1|2822399_2822840_+	hypothetical protein	NA	NA	NA	NA	NA
AZH65966.1|2822840_2826230_-	hypothetical protein	NA	A0A1E1GEP2	Vibrio_phage	36.9	8.1e-185
AZH65967.1|2826229_2828977_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	43.8	6.2e-119
AZH65968.1|2828976_2829552_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	95.3	7.0e-81
AZH65969.1|2829551_2830016_-	hypothetical protein	NA	G9L6D1	Escherichia_phage	100.0	8.4e-85
AZH65970.1|2830015_2832487_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	99.3	0.0e+00
AZH65971.1|2832486_2833092_-	hypothetical protein	NA	G9L6C9	Escherichia_phage	100.0	2.8e-112
AZH65972.1|2833148_2833484_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
AZH65973.1|2833494_2833932_-	hypothetical protein	NA	G9L6C6	Escherichia_phage	98.6	2.4e-73
AZH65974.1|2833983_2834970_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	99.7	5.6e-187
AZH65975.1|2834984_2835680_-	peptidase	NA	G9L6C4	Escherichia_phage	99.1	1.1e-93
AZH65976.1|2835682_2835979_-	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
AZH65977.1|2835975_2837655_-|tail	phage tail protein	tail	G9L6C2	Escherichia_phage	99.3	1.8e-302
AZH65978.1|2837669_2837876_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
AZH65979.1|2838578_2838986_+	hypothetical protein	NA	Q716B1	Shigella_phage	74.6	2.0e-42
AZH65980.1|2839043_2840519_-|terminase	terminase	terminase	A0A0F6TK57	Escherichia_coli_O157_typing_phage	99.0	1.4e-295
AZH65981.1|2840515_2841226_-|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	85.2	1.0e-105
AZH65982.1|2841222_2841435_-	hypothetical protein	NA	Q7Y4V0	Enterobacteria_phage	50.7	2.3e-13
AZH65983.1|2841452_2841791_-	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	99.1	8.3e-58
AZH65984.1|2841826_2842069_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	78.8	5.8e-29
AZH65985.1|2842135_2842936_-	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	83.0	6.1e-83
AZH68191.1|2842932_2843220_-	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	100.0	9.5e-55
AZH65986.1|2843449_2844199_-	hypothetical protein	NA	Q1MVF9	Enterobacteria_phage	86.1	2.8e-106
AZH65987.1|2844200_2844500_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	99.0	1.3e-57
AZH65988.1|2844496_2844973_-	hypothetical protein	NA	A0A2I6TCH0	Escherichia_phage	56.9	5.1e-29
AZH65989.1|2845639_2845993_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	75.0	5.7e-41
AZH68192.1|2846110_2846896_-	replication protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	99.6	3.6e-152
AZH65990.1|2846892_2847732_-	primosomal protein	NA	Q286X4	Escherichia_phage	95.7	5.2e-117
AZH65991.1|2847747_2847948_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	6.0e-32
AZH65992.1|2848098_2848329_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	97.4	2.9e-38
AZH65993.1|2848483_2849068_+	XRE family transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
AZH65994.1|2849376_2849676_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	99.0	1.7e-46
AZH65995.1|2849672_2850572_+	endonuclease	NA	Q858E0	Salmonella_phage	90.3	1.8e-155
AZH65996.1|2850581_2851604_+	recombinase RecT	NA	Q858E1	Salmonella_phage	92.9	7.1e-177
AZH65997.1|2851653_2851902_+	transcriptional regulator	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
AZH68193.1|2852059_2852311_+	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	98.8	8.9e-41
AZH68194.1|2852339_2853407_+	hypothetical protein	NA	T1SBJ4	Salmonella_phage	75.8	7.2e-156
AZH65998.1|2853403_2854051_+	adenine methylase	NA	A0A2R9YJG0	Escherichia_phage	97.7	8.9e-125
AZH65999.1|2854047_2854242_+	hypothetical protein	NA	A0A0F6R7M7	Escherichia_coli_O157_typing_phage	98.4	5.7e-27
AZH66000.1|2854245_2855496_-|integrase	integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.5	7.2e-240
AZH66001.1|2855688_2857266_-	GMP synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
2855687:2855703	attR	AATCATTCCCACTCAAT	NA	NA	NA	NA
AZH66002.1|2857334_2858801_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
>prophage 12
CP023853	Escherichia coli strain 2/0 chromosome, complete genome	5174317	3054719	3061859	5174317		Escherichia_phage(83.33%)	6	NA	NA
AZH66176.1|3054719_3057281_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
AZH66177.1|3057386_3058043_+	serine/threonine protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
AZH66178.1|3058093_3058861_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
AZH66179.1|3059056_3059965_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
AZH66180.1|3059961_3061224_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
AZH66181.1|3061220_3061859_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 13
CP023853	Escherichia coli strain 2/0 chromosome, complete genome	5174317	4992537	5038987	5174317	holin,transposase	Stx2-converting_phage(30.77%)	53	NA	NA
AZH67908.1|4992537_4994151_+|transposase	IS66 family transposase ISEc23	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
AZH67909.1|4994421_4995435_-	DUF4432 domain-containing protein	NA	NA	NA	NA	NA
AZH67910.1|4995446_4996763_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
AZH67911.1|4996790_4997711_-	ribokinase	NA	NA	NA	NA	NA
AZH67912.1|4998016_4998799_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
AZH67913.1|4998800_4998899_-	acetolactate synthase	NA	NA	NA	NA	NA
AZH68271.1|4999026_4999227_-	hypothetical protein	NA	NA	NA	NA	NA
AZH67914.1|4999414_4999612_+	hypothetical protein	NA	NA	NA	NA	NA
AZH67915.1|4999625_4999829_+	hypothetical protein	NA	NA	NA	NA	NA
AZH67916.1|5000003_5000132_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AZH67917.1|5000150_5000255_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
AZH67918.1|5000312_5000969_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZH67919.1|5001216_5002494_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
AZH67920.1|5002453_5002612_-|holin	choline transporter	holin	NA	NA	NA	NA
AZH67921.1|5002556_5004560_-|holin	high-affinity choline transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	4.4e-21
AZH67922.1|5004708_5005865_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	2.8e-68
AZH67923.1|5006169_5006601_-	hypothetical protein	NA	NA	NA	NA	NA
AZH67924.1|5006894_5008418_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.7e-44
AZH67925.1|5008912_5009326_+	hypothetical protein	NA	NA	NA	NA	NA
AZH67926.1|5009882_5010650_-	Fe(3+) dicitrate transport ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
AZH67927.1|5010650_5011607_-	iron-dicitrate transporter subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
AZH67928.1|5011603_5012602_-	Fe3+ dicitrate ABC transporter permease	NA	NA	NA	NA	NA
AZH67929.1|5012598_5013501_-	Fe(3+)-dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
AZH67930.1|5013545_5015870_-	fe(3+) dicitrate transporter fecA	NA	NA	NA	NA	NA
AZH67931.1|5015956_5016910_-	protein FecR	NA	NA	NA	NA	NA
AZH67932.1|5016906_5017428_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
AZH67933.1|5018974_5020348_+	esterase-like activity of phytase	NA	NA	NA	NA	NA
AZH67934.1|5020586_5021972_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
AZH67935.1|5022021_5022369_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AZH68272.1|5022365_5022746_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
AZH67936.1|5022864_5023101_-	hypothetical protein	NA	NA	NA	NA	NA
AZH67937.1|5023100_5023622_-	hypothetical protein	NA	NA	NA	NA	NA
AZH67938.1|5023522_5023930_-	hypothetical protein	NA	NA	NA	NA	NA
AZH67939.1|5024183_5024789_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AZH67940.1|5024952_5025150_+	hypothetical protein	NA	NA	NA	NA	NA
AZH67941.1|5025262_5025463_-	hypothetical protein	NA	NA	NA	NA	NA
AZH67942.1|5025482_5025632_-	hemolysin activation protein	NA	NA	NA	NA	NA
AZH67943.1|5026692_5027310_+	hypothetical protein	NA	NA	NA	NA	NA
AZH68273.1|5027215_5027413_-	hypothetical protein	NA	NA	NA	NA	NA
AZH67944.1|5027481_5027679_+	hypothetical protein	NA	NA	NA	NA	NA
AZH67945.1|5028162_5028378_-	hypothetical protein	NA	NA	NA	NA	NA
AZH67946.1|5028510_5029428_+	hypothetical protein	NA	NA	NA	NA	NA
AZH67947.1|5029512_5030385_+	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
AZH67948.1|5030757_5033604_+	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
AZH67949.1|5033638_5033833_+	hypothetical protein	NA	NA	NA	NA	NA
AZH67950.1|5033832_5033967_+	cytoplasmic protein	NA	NA	NA	NA	NA
AZH67951.1|5033987_5034806_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	9.4e-47
AZH67952.1|5035147_5035621_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	8.7e-13
AZH68274.1|5035666_5036113_+	hypothetical protein	NA	NA	NA	NA	NA
AZH67953.1|5036175_5036397_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
AZH67954.1|5036559_5036928_+	antitoxin	NA	NA	NA	NA	NA
AZH67955.1|5037017_5037305_+	toxin YeeV	NA	NA	NA	NA	NA
AZH67956.1|5037445_5038987_+|transposase	IS21 family transposase ISEc12	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
>prophage 1
CP023854	Escherichia coli strain 2/0 plasmid p2_0.1, complete sequence	135053	22881	64093	135053	transposase	Escherichia_phage(36.36%)	51	NA	NA
AZH68304.1|22881_24250_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
AZH68305.1|24357_24516_+	protein hok	NA	NA	NA	NA	NA
AZH68418.1|25016_25205_+	hypothetical protein	NA	NA	NA	NA	NA
AZH68306.1|25206_25413_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AZH68307.1|25437_25725_+	hypothetical protein	NA	NA	NA	NA	NA
AZH68308.1|25759_26665_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	3.7e-44
AZH68309.1|26961_27564_-	lytic transglycosylase	NA	NA	NA	NA	NA
AZH68310.1|27894_28278_+	conjugal transfer protein TraM	NA	NA	NA	NA	NA
AZH68311.1|28411_29089_+	conjugal transfer protein TraJ	NA	NA	NA	NA	NA
AZH68312.1|29176_29404_+	relaxosome protein TraY	NA	NA	NA	NA	NA
AZH68313.1|29437_29800_+	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
AZH68314.1|29804_30116_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
AZH68315.1|30137_30704_+	protein TraE	NA	NA	NA	NA	NA
AZH68419.1|30747_31419_+	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
AZH68316.1|31418_32870_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
AZH68317.1|32838_33426_+	conjugal transfer protein TraP	NA	NA	NA	NA	NA
AZH68318.1|33364_33724_+	conjugal transfer protein TrbD	NA	NA	NA	NA	NA
AZH68319.1|33723_34239_+	type IV conjugative transfer system protein TraV	NA	NA	NA	NA	NA
AZH68320.1|34373_34595_+	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	40.8	4.4e-07
AZH68321.1|34754_37382_+	type IV secretion system protein TraC	NA	NA	NA	NA	NA
AZH68322.1|37378_37765_+	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
AZH68323.1|37761_38394_+	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
AZH68324.1|38390_39383_+	conjugal transfer protein TraU	NA	NA	NA	NA	NA
AZH68325.1|39406_39718_+	hypothetical protein	NA	NA	NA	NA	NA
AZH68326.1|39714_40365_+	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
AZH68327.1|40361_42212_+	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
AZH68328.1|42235_42496_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
AZH68329.1|42458_43232_+	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
AZH68330.1|45200_45548_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
AZH68331.1|45544_45949_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
AZH68332.1|47735_48233_+	entry exclusion protein	NA	NA	NA	NA	NA
AZH68420.1|48261_48996_+	complement resistance protein TraT	NA	NA	NA	NA	NA
AZH68333.1|49132_49978_+	hypothetical protein	NA	NA	NA	NA	NA
AZH68334.1|51271_51976_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZH68421.1|52878_53352_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
AZH68335.1|53482_54271_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
AZH68336.1|54476_54824_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AZH68337.1|54817_55657_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AZH68338.1|55586_55766_-	hypothetical protein	NA	NA	NA	NA	NA
AZH68339.1|55784_55988_+	hypothetical protein	NA	NA	NA	NA	NA
AZH68340.1|56143_57349_+	chromate transporter	NA	NA	NA	NA	NA
AZH68341.1|57359_57665_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AZH68342.1|57680_57863_-	resolvase	NA	NA	NA	NA	NA
AZH68422.1|57891_58656_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AZH68343.1|58846_59203_-	hypothetical protein	NA	NA	NA	NA	NA
AZH68344.1|59148_59733_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZH68345.1|59732_60971_-	MFS transporter	NA	NA	NA	NA	NA
AZH68346.1|60967_61873_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AZH68347.1|61994_62699_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZH68348.1|62710_63136_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AZH68349.1|63388_64093_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 2
CP023854	Escherichia coli strain 2/0 plasmid p2_0.1, complete sequence	135053	112567	123120	135053		Escherichia_phage(44.44%)	9	NA	NA
AZH68394.1|112567_113308_+	site-specific recombinase	NA	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
AZH68395.1|113592_114570_-	repFIB replication protein A	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
AZH68396.1|115702_116062_-	pdcB	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
AZH68397.1|116089_116269_-	PdcA protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
AZH68398.1|116273_116654_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
AZH68399.1|116653_116875_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
AZH68428.1|117057_118614_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.5	7.1e-104
AZH68400.1|118610_119882_+	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	28.0	1.5e-11
AZH68401.1|120003_123120_+	DEAD/DEAH box helicase	NA	A0A220A398	Liberibacter_phage	24.0	2.9e-27
