The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034123	Klebsiella pneumoniae strain BJCFK909 chromosome, complete genome	5471151	448664	518042	5471151	terminase,portal,tRNA,capsid,head,protease,integrase,tail	uncultured_Caudovirales_phage(61.11%)	74	466272:466289	482267:482284
AZH18437.1|448664_449612_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
AZH18438.1|449626_450136_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
AZH18439.1|450264_451389_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
AZH18440.1|451360_451834_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
AZH18441.1|451859_452402_+	hypothetical protein	NA	NA	NA	NA	NA
AZH18442.1|452406_452979_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
AZH18443.1|452982_453801_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
AZH18444.1|453797_454055_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
AZH18445.1|454030_454585_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
AZH18446.1|460380_460602_-	hypothetical protein	NA	NA	NA	NA	NA
AZH18447.1|460895_464006_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AZH18448.1|464018_465158_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AZH18449.1|465536_466187_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
466272:466289	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
AZH18450.1|466462_467689_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
AZH18451.1|467781_468723_+	hypothetical protein	NA	NA	NA	NA	NA
AZH18452.1|468904_469189_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AZH18453.1|469199_469979_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
AZH23056.1|470102_470297_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AZH23055.1|470430_470700_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
AZH18454.1|470692_470881_+	hypothetical protein	NA	NA	NA	NA	NA
AZH18455.1|470873_471188_+	hypothetical protein	NA	NA	NA	NA	NA
AZH18456.1|471184_471553_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
AZH18457.1|471549_471915_+	hypothetical protein	NA	NA	NA	NA	NA
AZH18458.1|471914_474050_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
AZH18459.1|474392_474728_+	hypothetical protein	NA	NA	NA	NA	NA
AZH18460.1|474776_475289_-	hypothetical protein	NA	NA	NA	NA	NA
AZH18461.1|475552_476719_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
AZH18462.1|476770_477331_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
AZH18463.1|477332_478574_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
AZH18464.1|478570_478906_+|head,tail	head-tail adaptor	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
AZH18465.1|478902_479202_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
AZH18466.1|479201_479645_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
AZH18467.1|479771_479963_+|terminase	terminase	terminase	NA	NA	NA	NA
AZH18468.1|479920_480277_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
AZH18469.1|480260_481922_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
AZH18470.1|481924_482116_+	hypothetical protein	NA	NA	NA	NA	NA
AZH18471.1|482269_482566_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
482267:482284	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
AZH18472.1|482590_483556_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
AZH18473.1|483713_483941_-	hypothetical protein	NA	NA	NA	NA	NA
AZH18474.1|483913_484795_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AZH23057.1|484806_486258_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
AZH18475.1|486247_486490_-	DUF997 family protein	NA	NA	NA	NA	NA
AZH18476.1|486600_487950_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AZH18477.1|487960_488428_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
AZH18478.1|488450_488903_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
AZH18479.1|489126_489735_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
AZH18480.1|489734_490736_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
AZH18481.1|490964_491156_+	hypothetical protein	NA	NA	NA	NA	NA
AZH18482.1|491235_493176_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
AZH18483.1|493481_494525_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
AZH18484.1|494595_495588_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AZH18485.1|495587_496076_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AZH18486.1|496083_496665_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AZH18487.1|496667_498137_+	ribonuclease G	NA	NA	NA	NA	NA
AZH18488.1|498174_501972_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
AZH18489.1|502060_503506_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AZH18490.1|503541_504471_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
AZH18491.1|504602_504806_+	protein AaeX	NA	NA	NA	NA	NA
AZH18492.1|504813_505746_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
AZH18493.1|505751_507719_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
AZH18494.1|507798_508074_+	hypothetical protein	NA	NA	NA	NA	NA
AZH18495.1|508124_508391_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AZH18496.1|508489_508753_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AZH18497.1|509128_509599_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
AZH18498.1|510013_510952_+	malate dehydrogenase	NA	NA	NA	NA	NA
AZH18499.1|511088_512147_-|protease	serine endoprotease DegS	protease	NA	NA	NA	NA
AZH18500.1|512234_513602_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
AZH18501.1|513775_514174_-	DUF1043 family protein	NA	NA	NA	NA	NA
AZH18502.1|514364_515492_+	cell division protein ZapE	NA	NA	NA	NA	NA
AZH18503.1|515757_516186_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AZH18504.1|516201_516594_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
AZH23058.1|516703_516907_-	hypothetical protein	NA	NA	NA	NA	NA
AZH18505.1|516905_517544_+	stringent starvation protein A	NA	NA	NA	NA	NA
AZH18506.1|517547_518042_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
>prophage 2
CP034123	Klebsiella pneumoniae strain BJCFK909 chromosome, complete genome	5471151	1210855	1259999	5471151	portal,capsid,head,lysis,plate,tRNA,integrase,transposase,tail,coat	Salmonella_phage(80.0%)	63	1209260:1209277	1239533:1239550
1209260:1209277	attL	CGGCAAAGAGGCGGGCGA	NA	NA	NA	NA
AZH19168.1|1210855_1211836_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AZH19169.1|1211881_1212880_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	94.5	2.2e-183
AZH19170.1|1212882_1213512_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
AZH19171.1|1213634_1213877_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
AZH19172.1|1213909_1214419_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
AZH19173.1|1214426_1214627_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
AZH19174.1|1214590_1214929_+	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
AZH19175.1|1214996_1215230_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
AZH19176.1|1215229_1215457_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
AZH19177.1|1215453_1216305_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
AZH19178.1|1216301_1218686_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
AZH19179.1|1218915_1219167_+	hypothetical protein	NA	NA	NA	NA	NA
AZH23090.1|1219166_1220651_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AZH19180.1|1220758_1220947_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
AZH19181.1|1220958_1221192_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
AZH19182.1|1221287_1221971_-	hypothetical protein	NA	NA	NA	NA	NA
AZH19183.1|1221957_1223037_-	hypothetical protein	NA	NA	NA	NA	NA
AZH19184.1|1223036_1224038_-	hypothetical protein	NA	NA	NA	NA	NA
AZH19185.1|1224559_1224829_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
AZH19186.1|1224885_1225929_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
AZH19187.1|1225928_1227692_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
AZH19188.1|1227832_1228666_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
AZH19189.1|1228682_1229735_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
AZH19190.1|1229738_1230392_+	hypothetical protein	NA	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
AZH19191.1|1230487_1230952_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
AZH19192.1|1230951_1231155_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
AZH23091.1|1231158_1231374_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
AZH19193.1|1231354_1231864_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
AZH19194.1|1231868_1232252_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
AZH19195.1|1232248_1232677_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
AZH19196.1|1232606_1232810_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	77.6	3.0e-23
AZH19197.1|1232772_1233195_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
AZH19198.1|1233187_1233634_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
AZH19199.1|1233656_1234523_-	hypothetical protein	NA	NA	NA	NA	NA
AZH19200.1|1234617_1235190_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
AZH19201.1|1235186_1235549_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
AZH19202.1|1235535_1236444_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
AZH19203.1|1236436_1237108_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
AZH19204.1|1237109_1239059_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
AZH19205.1|1239068_1240187_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
1239533:1239550	attR	CGGCAAAGAGGCGGGCGA	NA	NA	NA	NA
AZH19206.1|1240238_1241312_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
AZH19207.1|1241460_1242633_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
AZH19208.1|1242642_1243158_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
AZH19209.1|1243210_1243510_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
AZH19210.1|1243524_1243644_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AZH19211.1|1243636_1246267_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	41.9	8.9e-115
AZH19212.1|1246263_1246749_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
AZH19213.1|1246745_1247840_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
AZH19214.1|1247906_1248125_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
AZH19215.1|1248152_1248530_-	hypothetical protein	NA	NA	NA	NA	NA
AZH19216.1|1249133_1249616_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
AZH19217.1|1249726_1250203_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AZH19218.1|1250192_1250483_+	RnfH family protein	NA	NA	NA	NA	NA
AZH19219.1|1250549_1250891_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AZH19220.1|1251038_1252700_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AZH19221.1|1252786_1253665_-	NAD(+) kinase	NA	NA	NA	NA	NA
AZH19222.1|1253789_1254380_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AZH19223.1|1254499_1255786_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AZH19224.1|1255805_1256597_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AZH19225.1|1256760_1258125_+	signal recognition particle protein	NA	NA	NA	NA	NA
AZH19226.1|1258384_1258633_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AZH23092.1|1258651_1259200_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AZH19227.1|1259231_1259999_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
CP034123	Klebsiella pneumoniae strain BJCFK909 chromosome, complete genome	5471151	1366021	1431592	5471151	tail,transposase,terminase,holin	Salmonella_phage(31.48%)	70	NA	NA
AZH19316.1|1366021_1367488_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
AZH19317.1|1367555_1369133_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
AZH19318.1|1369325_1370576_+	DUF4102 domain-containing protein	NA	A0A1X9TCT6	Enterobacter_phage	85.1	3.1e-206
AZH19319.1|1370592_1370784_-	hypothetical protein	NA	NA	NA	NA	NA
AZH19320.1|1370780_1371551_-	dcm methylase	NA	D5LH17	Escherichia_phage	52.0	2.7e-64
AZH19321.1|1371547_1372141_-	adenine methylase	NA	T1SA14	Salmonella_phage	91.9	9.6e-110
AZH19322.1|1372137_1372296_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	4.3e-17
AZH19323.1|1372288_1372582_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	3.0e-32
AZH19324.1|1372691_1372940_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	70.7	1.0e-28
AZH19325.1|1372988_1373870_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	82.6	2.7e-132
AZH19326.1|1373866_1374688_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	82.4	6.0e-134
AZH19327.1|1374684_1374984_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	52.5	1.1e-18
AZH19328.1|1375358_1375940_-	XRE family transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.8e-64
AZH19329.1|1376094_1376328_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	1.2e-23
AZH19330.1|1376474_1376684_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
AZH19331.1|1376683_1377451_+	primosomal protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
AZH19332.1|1377447_1378233_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
AZH19333.1|1378352_1378697_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	85.1	6.3e-53
AZH19334.1|1378889_1379300_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	55.6	7.3e-16
AZH19335.1|1379283_1379475_+	hypothetical protein	NA	NA	NA	NA	NA
AZH19336.1|1379471_1380116_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	79.3	8.0e-110
AZH19337.1|1381268_1382207_+	DUF551 domain-containing protein	NA	R9TQX3	Aeromonas_phage	61.8	6.1e-42
AZH19338.1|1382291_1382597_+	hypothetical protein	NA	Q7Y3Y0	Yersinia_phage	43.4	1.7e-14
AZH19339.1|1382589_1382928_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	88.2	1.9e-49
AZH19340.1|1383005_1383335_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	56.1	5.1e-28
AZH19341.1|1383392_1383977_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	89.1	5.8e-91
AZH19342.1|1383973_1385449_+|terminase	terminase	terminase	Q858H3	Salmonella_phage	93.5	1.3e-280
AZH19343.1|1385480_1385723_+	hypothetical protein	NA	NA	NA	NA	NA
AZH19344.1|1386184_1386391_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
AZH19345.1|1386405_1388088_+|tail	phage tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.4	1.5e-264
AZH19346.1|1388084_1388381_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
AZH19347.1|1388383_1389064_+	peptidase	NA	G9L6C4	Escherichia_phage	84.0	6.1e-76
AZH19348.1|1389078_1390005_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	93.8	4.3e-157
AZH19349.1|1390009_1391201_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
AZH19350.1|1391424_1391862_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.7	1.3e-66
AZH19351.1|1391872_1392214_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	2.4e-36
AZH19352.1|1392264_1392588_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
AZH19353.1|1392587_1393193_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	77.0	4.0e-87
AZH19354.1|1393192_1395670_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.4	0.0e+00
AZH19355.1|1395669_1396134_+	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
AZH19356.1|1396133_1396673_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	8.0e-71
AZH19357.1|1396683_1399200_+	hypothetical protein	NA	T1SBJ1	Salmonella_phage	81.5	0.0e+00
AZH19358.1|1399196_1400999_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	82.0	1.5e-270
AZH19359.1|1401003_1403478_+	hypothetical protein	NA	T1S9I6	Salmonella_phage	94.8	0.0e+00
AZH19360.1|1403673_1403970_+	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	92.7	7.5e-47
AZH19361.1|1404013_1404211_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	63.5	3.7e-18
AZH19362.1|1404214_1404472_-	DUF1902 domain-containing protein	NA	NA	NA	NA	NA
AZH19363.1|1404564_1405254_-	anti-repressor protein	NA	G9L6E2	Escherichia_phage	65.2	2.1e-79
AZH19364.1|1405568_1405865_-	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	64.0	1.1e-24
AZH19365.1|1408755_1408950_+	hypothetical protein	NA	NA	NA	NA	NA
AZH19366.1|1409142_1409547_+	hypothetical protein	NA	A0A0F6R7N0	Escherichia_coli_O157_typing_phage	82.6	1.0e-54
AZH19367.1|1409533_1409839_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	2.7e-39
AZH19368.1|1409828_1410458_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.9	1.8e-90
AZH19369.1|1410454_1410955_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	76.9	1.3e-59
AZH19370.1|1411141_1413010_-	phosphatase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
AZH19371.1|1412993_1414172_-	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
AZH19372.1|1414465_1415698_-	MFS transporter	NA	NA	NA	NA	NA
AZH19373.1|1415795_1416683_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZH19374.1|1416779_1416971_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	79.3	3.3e-19
AZH19375.1|1417323_1419552_+	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
AZH19376.1|1419605_1421138_-	exopolyphosphatase	NA	NA	NA	NA	NA
AZH19377.1|1421141_1423202_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
AZH19378.1|1423382_1424024_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	1.2e-28
AZH19379.1|1424020_1425058_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
AZH19380.1|1425321_1426215_+	beta-glucoside kinase	NA	NA	NA	NA	NA
AZH19381.1|1426224_1427658_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AZH19382.1|1427875_1428502_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AZH19383.1|1428597_1429884_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
AZH19384.1|1429982_1430684_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
AZH19385.1|1430680_1431592_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
>prophage 4
CP034123	Klebsiella pneumoniae strain BJCFK909 chromosome, complete genome	5471151	1745361	1752266	5471151		Planktothrix_phage(33.33%)	6	NA	NA
AZH23107.1|1745361_1746225_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	7.4e-10
AZH19660.1|1746235_1747009_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	5.1e-26
AZH23108.1|1747249_1748143_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
AZH19661.1|1748388_1749750_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
AZH19662.1|1750068_1750791_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AZH19663.1|1750787_1752266_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.9e-29
>prophage 5
CP034123	Klebsiella pneumoniae strain BJCFK909 chromosome, complete genome	5471151	1795611	1806635	5471151	transposase	Escherichia_phage(33.33%)	9	NA	NA
AZH19693.1|1795611_1797018_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
AZH19694.1|1797244_1798660_+	mannose-1-phosphate guanylyltransferase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
AZH19695.1|1798681_1800052_+	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	25.9	6.4e-32
AZH19696.1|1800206_1801271_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	9.8e-105
AZH19697.1|1801284_1802154_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.7	1.7e-110
AZH19698.1|1802185_1803076_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
AZH19699.1|1803090_1803645_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	2.9e-52
AZH19700.1|1803824_1804991_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	9.1e-112
AZH19701.1|1805654_1806635_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 6
CP034123	Klebsiella pneumoniae strain BJCFK909 chromosome, complete genome	5471151	2798523	2809398	5471151		Escherichia_phage(85.71%)	9	NA	NA
AZH20609.1|2798523_2801631_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AZH20610.1|2801685_2802951_+	MFS transporter	NA	NA	NA	NA	NA
AZH20611.1|2802981_2804070_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AZH20612.1|2804156_2804417_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
AZH20613.1|2804714_2805575_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AZH20614.1|2805595_2806357_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AZH20615.1|2806347_2806581_+	hypothetical protein	NA	NA	NA	NA	NA
AZH20616.1|2806618_2807521_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AZH20617.1|2808777_2809398_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 7
CP034123	Klebsiella pneumoniae strain BJCFK909 chromosome, complete genome	5471151	3002663	3073313	5471151	terminase,plate,head,lysis,transposase,tail	uncultured_Caudovirales_phage(32.69%)	85	NA	NA
AZH20797.1|3002663_3003749_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AZH20798.1|3003712_3005467_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AZH20799.1|3007138_3010564_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
AZH20800.1|3010547_3011687_-	hypothetical protein	NA	NA	NA	NA	NA
AZH20801.1|3011683_3011941_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
AZH20802.1|3011985_3014403_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
AZH20803.1|3014390_3014921_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AZH20804.1|3014988_3015519_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AZH20805.1|3015587_3016118_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AZH20806.1|3016185_3016716_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AZH20807.1|3016784_3017315_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
AZH20808.1|3017378_3018158_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
AZH20809.1|3018158_3020537_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.2e-18
AZH20810.1|3020529_3023184_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.5e-96
AZH20811.1|3023448_3023940_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
AZH20812.1|3023944_3025651_-	OmpA family protein	NA	NA	NA	NA	NA
AZH20813.1|3025647_3026337_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AZH23174.1|3026333_3027674_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AZH20814.1|3027686_3029231_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AZH20815.1|3029302_3030283_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
AZH20816.1|3030340_3030550_+	hypothetical protein	NA	NA	NA	NA	NA
AZH20817.1|3030878_3031127_+	DinI family protein	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
AZH20818.1|3031349_3031634_-	hypothetical protein	NA	NA	NA	NA	NA
AZH20819.1|3031738_3031948_-	hypothetical protein	NA	NA	NA	NA	NA
AZH20820.1|3031944_3032676_-	hypothetical protein	NA	NA	NA	NA	NA
AZH23175.1|3032686_3033415_-	hypothetical protein	NA	NA	NA	NA	NA
AZH20821.1|3035765_3035963_-	hypothetical protein	NA	NA	NA	NA	NA
AZH20822.1|3035962_3036829_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
AZH20823.1|3036828_3037602_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
AZH20824.1|3037598_3038795_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
AZH20825.1|3038794_3039148_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
AZH20826.1|3039149_3039803_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
AZH20827.1|3039856_3040423_-	hypothetical protein	NA	NA	NA	NA	NA
AZH20828.1|3040459_3040645_+	hypothetical protein	NA	NA	NA	NA	NA
AZH20829.1|3040697_3041039_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
AZH20830.1|3041038_3042061_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
AZH20831.1|3042063_3042366_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	55.2	2.0e-26
AZH20832.1|3042366_3042966_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
AZH20833.1|3042965_3044969_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
AZH20834.1|3044958_3045111_-	NTP pyrophosphohydrolase	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
AZH20835.1|3045146_3045572_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
AZH20836.1|3045575_3046016_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
AZH20837.1|3046026_3047172_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
AZH23176.1|3047175_3047616_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
AZH20838.1|3047710_3048097_-|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
AZH20839.1|3048096_3048603_-	hypothetical protein	NA	NA	NA	NA	NA
AZH20840.1|3048599_3049019_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
AZH20841.1|3048987_3049269_-	hypothetical protein	NA	NA	NA	NA	NA
AZH20842.1|3049308_3050250_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
AZH20843.1|3050261_3050756_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
AZH20844.1|3050759_3051962_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
AZH23177.1|3052013_3052562_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
AZH20845.1|3052617_3054069_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
AZH20846.1|3054306_3055707_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
AZH20847.1|3055657_3056410_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	66.0	4.0e-12
AZH20848.1|3056511_3056832_-	negative regulator GrlR	NA	NA	NA	NA	NA
AZH20849.1|3056924_3057182_-	Rz1 lytic protein	NA	S5FXQ4	Shigella_phage	70.9	2.3e-23
AZH20850.1|3057066_3057456_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
AZH20851.1|3057452_3057983_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
AZH20852.1|3057985_3058234_-|lysis	lysis protein	lysis	NA	NA	NA	NA
AZH20853.1|3058639_3059422_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
AZH20854.1|3059418_3059895_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
AZH20855.1|3059891_3060854_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	99.1	8.1e-183
AZH20856.1|3060855_3062514_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
AZH20857.1|3062822_3063116_-	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	97.6	2.8e-38
AZH20858.1|3063090_3063312_-	XRE family transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
AZH20859.1|3063409_3064078_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
AZH20860.1|3064248_3064563_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
AZH20861.1|3064555_3064744_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
AZH20862.1|3064913_3065279_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
AZH20863.1|3065271_3065526_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
AZH20864.1|3065497_3065716_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
AZH20865.1|3065712_3066138_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
AZH20866.1|3066134_3066329_+	hypothetical protein	NA	NA	NA	NA	NA
AZH20867.1|3066325_3067153_+	SPFH/Band 7/PHB domain protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
AZH20868.1|3067257_3067776_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
AZH20869.1|3067781_3068492_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
AZH20870.1|3068481_3068706_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
AZH20871.1|3068702_3068915_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
AZH20872.1|3068911_3069391_+	hypothetical protein	NA	NA	NA	NA	NA
AZH20873.1|3069569_3069812_+	AlpA family transcriptional regulator	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
AZH20874.1|3069792_3070974_-	DUF4102 domain-containing protein	NA	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
AZH20875.1|3071170_3071719_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
AZH20876.1|3071917_3072334_-	hypothetical protein	NA	NA	NA	NA	NA
AZH20877.1|3072332_3073313_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 8
CP034123	Klebsiella pneumoniae strain BJCFK909 chromosome, complete genome	5471151	3108561	3139605	5471151	integrase,transposase,holin	Enterobacteria_phage(37.5%)	43	3108343:3108358	3136911:3136926
3108343:3108358	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
AZH20908.1|3108561_3109233_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
AZH23181.1|3109419_3110247_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
AZH20909.1|3110322_3111588_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
AZH20910.1|3111589_3112009_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
AZH23182.1|3112088_3113573_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AZH20911.1|3113572_3113824_-	hypothetical protein	NA	NA	NA	NA	NA
AZH20912.1|3114470_3114893_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
AZH20913.1|3115485_3116190_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZH20914.1|3116805_3117153_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AZH23183.1|3117316_3118108_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AZH20915.1|3119089_3119794_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZH20916.1|3119830_3120118_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	95.4	4.4e-36
AZH20917.1|3120114_3120654_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
AZH23184.1|3120650_3120950_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
AZH23185.1|3121599_3122289_-	antiterminator	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
AZH20918.1|3122288_3122429_-	YlcG family protein	NA	NA	NA	NA	NA
AZH20919.1|3122425_3123064_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
AZH20920.1|3123056_3123725_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
AZH20921.1|3123721_3123889_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
AZH20922.1|3123869_3124337_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
AZH20923.1|3124857_3125886_+	hypothetical protein	NA	NA	NA	NA	NA
AZH20924.1|3126093_3126339_-	hypothetical protein	NA	NA	NA	NA	NA
AZH20925.1|3126394_3126697_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZH20926.1|3126693_3127542_-	AAA family ATPase	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
AZH20927.1|3127538_3128399_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
AZH20928.1|3128484_3128706_-	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AZH20929.1|3128746_3128974_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
AZH23186.1|3129085_3129784_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
AZH20930.1|3129806_3129926_+	hypothetical protein	NA	NA	NA	NA	NA
AZH20931.1|3130071_3131148_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
AZH20932.1|3131229_3131433_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
AZH20933.1|3131861_3132056_+	hypothetical protein	NA	NA	NA	NA	NA
AZH20934.1|3132144_3132429_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
AZH20935.1|3132444_3133290_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
AZH20936.1|3133286_3133574_+	hypothetical protein	NA	NA	NA	NA	NA
AZH20937.1|3133575_3134256_+	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
AZH20938.1|3134252_3134681_+	regulator	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
AZH20939.1|3134677_3135340_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
AZH20940.1|3135336_3135651_+	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	1.6e-10
AZH20941.1|3135547_3136735_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	52.4	1.1e-120
AZH20942.1|3136911_3137802_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
3136911:3136926	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
AZH20943.1|3137801_3138794_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
AZH20944.1|3138795_3139605_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 9
CP034123	Klebsiella pneumoniae strain BJCFK909 chromosome, complete genome	5471151	3267277	3396866	5471151	terminase,portal,tRNA,capsid,head,holin,protease,integrase,tail	Klebsiella_phage(31.87%)	152	3294080:3294094	3394677:3394691
AZH21063.1|3267277_3267778_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
AZH21064.1|3267894_3268341_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AZH23190.1|3268324_3269116_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZH21065.1|3269217_3270402_+	MFS transporter	NA	NA	NA	NA	NA
AZH21066.1|3270433_3271126_-	hypothetical protein	NA	NA	NA	NA	NA
AZH21067.1|3271271_3271781_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AZH23191.1|3271767_3272124_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AZH21068.1|3272113_3272353_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AZH21069.1|3272653_3273667_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.4e-12
AZH21070.1|3273724_3273826_+	hypothetical protein	NA	NA	NA	NA	NA
AZH23192.1|3273825_3273900_+	protein YoaJ	NA	NA	NA	NA	NA
AZH21071.1|3274017_3274143_+	hypothetical protein	NA	NA	NA	NA	NA
AZH21072.1|3274202_3274466_-	DUF2534 family protein	NA	NA	NA	NA	NA
AZH21073.1|3274596_3275235_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
AZH21074.1|3275324_3276239_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
AZH21075.1|3276454_3276646_+	hypothetical protein	NA	NA	NA	NA	NA
AZH21076.1|3276900_3277944_-	type II asparaginase	NA	NA	NA	NA	NA
AZH21077.1|3278246_3279455_+	HD domain-containing protein	NA	NA	NA	NA	NA
AZH21078.1|3279528_3281313_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
AZH21079.1|3281319_3282210_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZH21080.1|3282330_3283839_+	UbiD family decarboxylase	NA	NA	NA	NA	NA
AZH21081.1|3284149_3284836_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AZH21082.1|3285233_3285413_-	hypothetical protein	NA	NA	NA	NA	NA
AZH21083.1|3285452_3286085_-	DNA-binding protein	NA	NA	NA	NA	NA
AZH21084.1|3286651_3286849_+	hypothetical protein	NA	NA	NA	NA	NA
AZH21085.1|3286964_3287975_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AZH21086.1|3287971_3289378_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
AZH21087.1|3289433_3290321_-	manganese catalase family protein	NA	NA	NA	NA	NA
AZH21088.1|3290337_3290844_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AZH21089.1|3290870_3291365_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AZH21090.1|3291455_3291641_-	stress-induced acidophilic repeat motif-containing protein	NA	NA	NA	NA	NA
AZH21091.1|3292262_3293456_+	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
AZH21092.1|3293568_3293796_+	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
3294080:3294094	attL	TGGCTGGCGTTCTTT	NA	NA	NA	NA
AZH21093.1|3294232_3294556_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AZH21094.1|3294548_3294941_+	amino acid-binding protein	NA	NA	NA	NA	NA
AZH21095.1|3294937_3295651_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AZH21096.1|3295923_3296076_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
AZH21097.1|3296230_3297727_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	63.7	1.4e-125
AZH21098.1|3297795_3310500_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	47.1	0.0e+00
AZH21099.1|3310562_3311156_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	76.6	8.0e-80
AZH21100.1|3311182_3311605_-	hypothetical protein	NA	J9Q806	Salmonella_phage	50.0	5.9e-29
AZH21101.1|3311646_3312357_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	90.3	1.9e-136
AZH21102.1|3312358_3313114_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.5	4.6e-125
AZH21103.1|3313110_3313449_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	1.4e-57
AZH21104.1|3313448_3316784_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	88.3	0.0e+00
AZH23193.1|3316783_3317002_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	90.5	5.4e-34
AZH21105.1|3317016_3317382_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
AZH21106.1|3317439_3317901_-|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
AZH21107.1|3317932_3318334_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	2.3e-62
AZH21108.1|3318330_3318720_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
AZH21109.1|3318700_3319039_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	90.2	2.8e-53
AZH21110.1|3319035_3319353_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
AZH21111.1|3319333_3319594_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	60.5	7.4e-22
AZH21112.1|3319652_3320939_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.0	9.8e-216
AZH21113.1|3321016_3321937_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
AZH21114.1|3321973_3323233_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.8	1.8e-222
AZH21115.1|3323232_3323412_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
AZH21116.1|3323405_3325127_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.5e-190
AZH21117.1|3325126_3325561_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
AZH21118.1|3325809_3326241_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.6	1.8e-41
AZH21119.1|3326237_3326561_-	hypothetical protein	NA	NA	NA	NA	NA
AZH21120.1|3326512_3326875_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
AZH21121.1|3327201_3327426_+	hypothetical protein	NA	NA	NA	NA	NA
AZH21122.1|3327464_3327902_-	hypothetical protein	NA	NA	NA	NA	NA
AZH21123.1|3328851_3329202_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	7.9e-11
AZH21124.1|3329198_3329696_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	84.6	1.1e-77
AZH21125.1|3329695_3329911_-|holin	holin	holin	A5LH82	Enterobacteria_phage	88.7	2.7e-30
AZH21126.1|3331715_3331919_+	hypothetical protein	NA	NA	NA	NA	NA
AZH21127.1|3332162_3332765_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.6	1.1e-76
AZH21128.1|3332781_3333813_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	4.7e-96
AZH21129.1|3333812_3334016_-	hypothetical protein	NA	NA	NA	NA	NA
AZH21130.1|3334012_3334405_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	8.0e-12
AZH21131.1|3334445_3334736_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	56.9	8.0e-17
AZH21132.1|3334747_3334981_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.1	3.7e-25
AZH23194.1|3335059_3336544_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AZH21133.1|3336543_3336795_-	hypothetical protein	NA	NA	NA	NA	NA
AZH21134.1|3337384_3338746_-	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
AZH21135.1|3338919_3339633_-	hypothetical protein	NA	NA	NA	NA	NA
AZH23195.1|3339984_3340854_+	hypothetical protein	NA	NA	NA	NA	NA
AZH21136.1|3340942_3342334_+	hypothetical protein	NA	NA	NA	NA	NA
AZH21137.1|3342682_3343123_-	hypothetical protein	NA	NA	NA	NA	NA
AZH21138.1|3343136_3343601_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	72.2	4.1e-63
AZH23196.1|3343593_3344598_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	40.0	1.0e-31
AZH21139.1|3344657_3345212_-	hypothetical protein	NA	NA	NA	NA	NA
AZH21140.1|3345214_3345439_-	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	62.5	1.3e-19
AZH21141.1|3345527_3345965_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	62.2	1.3e-39
AZH23197.1|3346286_3346601_-	hypothetical protein	NA	NA	NA	NA	NA
AZH21142.1|3346763_3346982_+	hypothetical protein	NA	NA	NA	NA	NA
AZH21143.1|3346991_3347186_+	DUF1482 family protein	NA	NA	NA	NA	NA
AZH21144.1|3347228_3347573_+	transcriptional regulator	NA	NA	NA	NA	NA
AZH21145.1|3347714_3349853_+	exonuclease	NA	S4TNL0	Salmonella_phage	42.7	5.6e-99
AZH21146.1|3349905_3350151_+	excisionase	NA	NA	NA	NA	NA
AZH21147.1|3350131_3351259_+|integrase	integrase	integrase	O21925	Phage_21	58.4	4.4e-119
AZH21148.1|3351376_3351559_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	3.7e-20
AZH21149.1|3351940_3352702_-	hypothetical protein	NA	Q6J1W3	Lactobacillus_phage	29.4	2.5e-09
AZH21150.1|3353736_3354462_-	hypothetical protein	NA	NA	NA	NA	NA
AZH21151.1|3354513_3355779_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	82.9	8.1e-207
AZH21152.1|3355781_3356201_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	56.7	1.2e-34
AZH21153.1|3356279_3356522_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	81.0	1.6e-31
AZH21154.1|3356521_3356764_+	hypothetical protein	NA	NA	NA	NA	NA
AZH21155.1|3357539_3358292_-	hypothetical protein	NA	NA	NA	NA	NA
AZH21156.1|3358302_3360471_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	45.1	6.7e-100
AZH21157.1|3360548_3363617_-	kinase	NA	A0A286S259	Klebsiella_phage	66.3	0.0e+00
AZH21158.1|3363613_3364000_-	nitrite transporter	NA	H2BD94	Pseudomonas_phage	35.7	4.0e-16
AZH21159.1|3364007_3364490_-	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	67.7	8.5e-56
AZH21160.1|3364476_3364950_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	63.5	3.9e-53
AZH21161.1|3364949_3367646_-|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	62.4	4.9e-201
AZH21162.1|3367626_3367944_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	51.5	1.4e-19
AZH21163.1|3367964_3368360_-|tail	phage tail protein	tail	M9NZD7	Enterobacteria_phage	27.5	1.9e-08
AZH21164.1|3368402_3368885_-|tail	phage tail protein	tail	M9NYX0	Enterobacteria_phage	68.6	5.7e-60
AZH21165.1|3368892_3369291_-|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	57.8	3.2e-40
AZH21166.1|3369287_3369839_-|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	67.3	1.6e-53
AZH21167.1|3369828_3370122_-	ATP-binding protein	NA	NA	NA	NA	NA
AZH21168.1|3370114_3370441_-	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	66.4	4.0e-33
AZH21169.1|3370521_3372537_-|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	84.2	0.0e+00
AZH21170.1|3372481_3373981_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.6	1.1e-247
AZH21171.1|3373977_3374193_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	75.7	6.5e-24
AZH21172.1|3374189_3376298_-|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	83.5	0.0e+00
AZH21173.1|3376297_3376789_-	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	84.0	6.4e-67
AZH21174.1|3377109_3377295_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	61.1	2.4e-11
AZH23198.1|3377362_3377623_-	hypothetical protein	NA	NA	NA	NA	NA
AZH21175.1|3377849_3378095_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	3.0e-33
AZH23199.1|3378484_3378673_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	89.8	6.3e-23
AZH21176.1|3378623_3378899_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	46.7	8.6e-13
AZH21177.1|3378895_3379243_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	78.3	3.0e-39
AZH21178.1|3379239_3379779_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	5.7e-101
AZH23200.1|3379775_3380075_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	83.8	4.5e-39
AZH21179.1|3380244_3380484_-	hypothetical protein	NA	NA	NA	NA	NA
AZH21180.1|3380634_3381213_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.7	2.2e-50
AZH21181.1|3381226_3382207_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	67.5	2.7e-133
AZH21182.1|3382219_3382597_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	3.9e-48
AZH21183.1|3382606_3383416_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	68.9	5.9e-110
AZH21184.1|3383412_3384327_-	transcriptional regulator	NA	H2DE83	Erwinia_phage	60.6	1.8e-30
AZH21185.1|3384283_3384496_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	72.7	2.2e-16
AZH21186.1|3384733_3385195_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
AZH21187.1|3385220_3385430_-	cell division protein	NA	NA	NA	NA	NA
AZH21188.1|3385524_3386169_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	40.7	8.2e-38
AZH21189.1|3386468_3387392_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	62.9	1.5e-104
AZH21190.1|3387477_3387777_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	47.8	1.0e-14
AZH21191.1|3387776_3388562_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.6	1.3e-61
AZH21192.1|3388689_3389181_+	ead/Ea22-like family protein	NA	E7C9P6	Salmonella_phage	53.4	5.1e-32
AZH21193.1|3389177_3389441_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	78.0	1.1e-30
AZH21194.1|3389433_3390078_+	hypothetical protein	NA	A0A2R2Z312	Escherichia_phage	42.8	1.1e-39
AZH21195.1|3390077_3390290_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
AZH21196.1|3391085_3391304_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	51.7	3.0e-08
AZH21197.1|3391303_3391576_+	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	40.4	4.4e-09
AZH21198.1|3391604_3391841_+	excisionase	NA	NA	NA	NA	NA
AZH21199.1|3391830_3392973_+|integrase	integrase	integrase	Q77Z02	Phage_21	82.2	9.1e-173
AZH21200.1|3393086_3394337_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	6.7e-20
AZH21201.1|3394577_3395228_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
3394677:3394691	attR	AAAGAACGCCAGCCA	NA	NA	NA	NA
AZH21202.1|3395244_3395703_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AZH23201.1|3395759_3396866_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 10
CP034123	Klebsiella pneumoniae strain BJCFK909 chromosome, complete genome	5471151	3612844	3705795	5471151	portal,tRNA,lysis,plate,head,capsid,protease,integrase,tail	Salmonella_phage(56.9%)	96	3668370:3668388	3705870:3705888
AZH21389.1|3612844_3614137_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
AZH21390.1|3614227_3615571_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
AZH21391.1|3615579_3616191_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AZH21392.1|3616313_3620567_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
AZH21393.1|3620702_3621197_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AZH21394.1|3621702_3622698_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
AZH21395.1|3622812_3624579_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
AZH21396.1|3624579_3626301_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
AZH21397.1|3626345_3627047_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AZH21398.1|3627400_3627619_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AZH21399.1|3627739_3630019_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AZH21400.1|3630049_3630367_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AZH21401.1|3630692_3630914_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AZH21402.1|3630990_3632931_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AZH21403.1|3632927_3634043_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AZH21404.1|3634189_3635848_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AZH21405.1|3636267_3636963_+	aquaporin Z	NA	NA	NA	NA	NA
AZH21406.1|3637078_3637978_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
AZH21407.1|3638121_3639774_+	hydroxylamine reductase	NA	NA	NA	NA	NA
AZH21408.1|3639784_3640753_+	NADH oxidoreductase	NA	NA	NA	NA	NA
AZH21409.1|3640703_3640907_+	hypothetical protein	NA	NA	NA	NA	NA
AZH21410.1|3640964_3641399_-	DoxX family protein	NA	NA	NA	NA	NA
AZH21411.1|3641550_3643269_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
AZH21412.1|3643307_3644309_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AZH21413.1|3644319_3645762_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AZH21414.1|3645849_3646863_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AZH21415.1|3646859_3647690_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
AZH21416.1|3647721_3648861_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AZH21417.1|3648913_3649093_+	hypothetical protein	NA	NA	NA	NA	NA
AZH21418.1|3649738_3650254_+	lipoprotein	NA	NA	NA	NA	NA
AZH21419.1|3650480_3651209_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
AZH21420.1|3651229_3651961_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZH21421.1|3651967_3652684_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
AZH21422.1|3652683_3653352_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
AZH21423.1|3653535_3654267_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZH21424.1|3654309_3655782_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
AZH21425.1|3655778_3656495_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
AZH21426.1|3656573_3657701_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
AZH21427.1|3657742_3658231_-	DUF2593 family protein	NA	NA	NA	NA	NA
AZH21428.1|3658288_3659134_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AZH21429.1|3659130_3660084_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AZH23215.1|3660094_3661228_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
AZH21430.1|3661391_3662504_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AZH21431.1|3662852_3663332_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AZH21432.1|3663420_3664323_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
AZH21433.1|3665144_3665432_-	DUF1418 family protein	NA	NA	NA	NA	NA
AZH21434.1|3665634_3665898_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
AZH21435.1|3665904_3666288_-	hypothetical protein	NA	NA	NA	NA	NA
AZH21436.1|3666554_3668240_+	transporter	NA	NA	NA	NA	NA
3668370:3668388	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
AZH21437.1|3668459_3668678_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AZH21438.1|3668769_3669870_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
AZH21439.1|3669866_3670352_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
AZH21440.1|3670348_3672976_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
AZH21441.1|3672968_3673088_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AZH21442.1|3673102_3673402_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
AZH21443.1|3673454_3673970_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
AZH21444.1|3673979_3675152_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
AZH21445.1|3675290_3676367_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
AZH21446.1|3676396_3676600_-	hypothetical protein	NA	NA	NA	NA	NA
AZH21447.1|3676596_3677328_-	hypothetical protein	NA	NA	NA	NA	NA
AZH21448.1|3677331_3680283_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
AZH21449.1|3680284_3680884_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
AZH21450.1|3680876_3681785_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
AZH21451.1|3681771_3682134_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	4.9e-48
AZH21452.1|3682130_3682703_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
AZH21453.1|3682797_3683490_+	hypothetical protein	NA	NA	NA	NA	NA
AZH21454.1|3683486_3683933_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
AZH21455.1|3683925_3684357_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
AZH21456.1|3684452_3684881_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
AZH21457.1|3684877_3685261_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
AZH21458.1|3685265_3685775_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
AZH21459.1|3685755_3685971_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
AZH21460.1|3685974_3686178_-|tail	phage tail protein	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
AZH21461.1|3686177_3686642_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
AZH21462.1|3686737_3687388_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
AZH21463.1|3687391_3688450_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
AZH21464.1|3688466_3689300_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
AZH21465.1|3689442_3691209_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
AZH21466.1|3691208_3692234_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
AZH21467.1|3692295_3694038_-	hypothetical protein	NA	NA	NA	NA	NA
AZH21468.1|3694313_3694991_-	hypothetical protein	NA	NA	NA	NA	NA
AZH21469.1|3695105_3695411_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AZH23216.1|3695349_3695538_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AZH21470.1|3695691_3698106_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AZH21471.1|3698102_3698960_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
AZH21472.1|3698956_3699184_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
AZH21473.1|3699183_3699417_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
AZH21474.1|3699484_3699826_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
AZH21475.1|3699789_3699990_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
AZH21476.1|3699997_3700507_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AZH21477.1|3700539_3700761_-	regulator	NA	NA	NA	NA	NA
AZH23217.1|3700906_3701785_+	Repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
AZH21478.1|3701796_3702741_+	hypothetical protein	NA	NA	NA	NA	NA
AZH23218.1|3702839_3704324_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AZH21479.1|3704323_3704575_-	hypothetical protein	NA	NA	NA	NA	NA
AZH21480.1|3704742_3705795_+|integrase	site-specific integrase	integrase	A0A218M4I3	Erwinia_phage	57.0	1.0e-106
3705870:3705888	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 11
CP034123	Klebsiella pneumoniae strain BJCFK909 chromosome, complete genome	5471151	4358219	4372280	5471151	transposase	Enterobacteria_phage(66.67%)	15	NA	NA
AZH22061.1|4358219_4359272_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	57.9	1.4e-111
AZH22062.1|4359435_4360359_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
AZH22063.1|4360627_4361731_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
AZH22064.1|4361741_4362995_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
AZH22065.1|4363347_4364538_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	62.7	6.4e-145
AZH22066.1|4364525_4365476_+	cobyrinic acid a,c-diamide synthase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
AZH22067.1|4365475_4365901_+	hypothetical protein	NA	NA	NA	NA	NA
AZH22068.1|4366468_4367035_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
AZH22069.1|4367052_4367298_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
AZH22070.1|4367294_4368032_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	59.4	1.9e-70
AZH22071.1|4368573_4368840_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
AZH22072.1|4368836_4369394_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
AZH22073.1|4369390_4369618_+	hypothetical protein	NA	NA	NA	NA	NA
AZH22074.1|4369614_4369935_+	hypothetical protein	NA	NA	NA	NA	NA
AZH22075.1|4369946_4372280_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
>prophage 12
CP034123	Klebsiella pneumoniae strain BJCFK909 chromosome, complete genome	5471151	4840948	4850473	5471151	transposase	Enterobacteria_phage(83.33%)	10	NA	NA
AZH22478.1|4840948_4843282_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
AZH22479.1|4843296_4843617_-	hypothetical protein	NA	NA	NA	NA	NA
AZH22480.1|4843613_4843841_-	hypothetical protein	NA	NA	NA	NA	NA
AZH22481.1|4843837_4844386_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
AZH22482.1|4845209_4845947_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
AZH22483.1|4845943_4846189_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
AZH22484.1|4846206_4846773_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
AZH22485.1|4847513_4848593_+	hypothetical protein	NA	NA	NA	NA	NA
AZH22486.1|4848593_4849130_+	hypothetical protein	NA	NA	NA	NA	NA
AZH22487.1|4849492_4850473_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 1
CP034124	Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence	200216	15236	47711	200216	transposase,integrase	Salmonella_phage(25.0%)	27	NA	NA
AZH23302.1|15236_16166_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.4	5.6e-72
AZH23303.1|16310_17090_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.4	6.0e-51
AZH23461.1|17086_17899_-	hypothetical protein	NA	NA	NA	NA	NA
AZH23304.1|18452_18842_-	hypothetical protein	NA	NA	NA	NA	NA
AZH23462.1|18825_19056_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AZH23305.1|19052_19469_+	PIN domain-containing protein	NA	NA	NA	NA	NA
AZH23306.1|19542_21105_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AZH23307.1|21089_22112_+	DNA helicase UvrD	NA	NA	NA	NA	NA
AZH23308.1|23645_24650_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AZH23309.1|24740_25175_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AZH23310.1|25260_27666_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	46.1	1.0e-141
AZH23311.1|27662_28739_+	signal peptidase II	NA	NA	NA	NA	NA
AZH23463.1|28868_29426_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	2.6e-48
AZH23312.1|29428_32398_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.3	0.0e+00
AZH23313.1|32476_33481_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AZH23314.1|33766_34261_+	DNA-binding protein	NA	NA	NA	NA	NA
AZH23315.1|34494_35418_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	1.7e-166
AZH23316.1|35484_35955_-	hypothetical protein	NA	NA	NA	NA	NA
AZH23464.1|37498_37942_+	hypothetical protein	NA	NA	NA	NA	NA
AZH23317.1|37962_38751_+	hypothetical protein	NA	NA	NA	NA	NA
AZH23318.1|39201_40125_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.5	7.3e-165
AZH23319.1|40128_40371_+	hypothetical protein	NA	NA	NA	NA	NA
AZH23320.1|40316_40736_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZH23321.1|40732_41044_-	cytoplasmic protein	NA	NA	NA	NA	NA
AZH23465.1|45030_45525_+	nuclease	NA	A0A0R6PHV6	Moraxella_phage	38.6	5.9e-20
AZH23322.1|45861_46260_+	DNA-binding protein H-NS-like protein	NA	NA	NA	NA	NA
AZH23323.1|46706_47711_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP034124	Klebsiella pneumoniae strain BJCFK909 plasmid p1b1, complete sequence	200216	192058	199487	200216	transposase	Stx2-converting_phage(28.57%)	7	NA	NA
AZH23451.1|192058_193027_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.8	7.3e-14
AZH23452.1|193354_194947_-|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	3.2e-176
AZH23453.1|194977_195328_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
AZH23454.1|195324_195765_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	53.8	4.4e-19
AZH23455.1|195961_196144_+	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	57.1	9.1e-11
AZH23456.1|197349_198321_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.9	7.0e-150
AZH23457.1|198320_199487_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.4	2.0e-223
>prophage 1
CP034125	Klebsiella pneumoniae strain BJCFK909 plasmid p2b2, complete sequence	109179	1796	51111	109179	protease,transposase	Escherichia_phage(40.91%)	56	NA	NA
AZH23476.1|1796_2450_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AZH23477.1|2542_2800_+	antitoxin PemI	NA	NA	NA	NA	NA
AZH23478.1|2801_3134_+	mRNA interferase PemK	NA	NA	NA	NA	NA
AZH23479.1|4444_5149_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZH23480.1|6259_6964_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZH23481.1|7641_7830_-	hypothetical protein	NA	NA	NA	NA	NA
AZH23598.1|7921_8458_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	2.8e-84
AZH23482.1|8640_9501_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AZH23483.1|9670_10426_+	16S rRNA (guanine(1405)-N(7))-methyltransferase RmtB1	NA	NA	NA	NA	NA
AZH23484.1|10875_11580_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AZH23485.1|11570_11711_+	hypothetical protein	NA	NA	NA	NA	NA
AZH23486.1|13521_13803_+	hypothetical protein	NA	NA	NA	NA	NA
AZH23599.1|13925_14276_-	protein stbB	NA	NA	NA	NA	NA
AZH23487.1|14278_15241_-	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
AZH23600.1|15387_15681_+	hypothetical protein	NA	NA	NA	NA	NA
AZH23488.1|15621_15801_-	hypothetical protein	NA	NA	NA	NA	NA
AZH23489.1|15757_16441_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	5.6e-29
AZH23490.1|16441_16663_+	hypothetical protein	NA	NA	NA	NA	NA
AZH23491.1|16676_17111_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AZH23492.1|17810_18383_+	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
AZH23493.1|18355_18781_+	antirestriction protein	NA	NA	NA	NA	NA
AZH23494.1|18827_19250_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AZH23495.1|19246_19438_+	hypothetical protein	NA	NA	NA	NA	NA
AZH23496.1|19751_21419_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.3	1.7e-164
AZH23497.1|22298_22556_-	hypothetical protein	NA	NA	NA	NA	NA
AZH23498.1|22818_23049_+	hypothetical protein	NA	NA	NA	NA	NA
AZH23499.1|23100_24462_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
AZH23500.1|24508_25072_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	6.1e-21
AZH23501.1|25071_25320_+	hypothetical protein	NA	NA	NA	NA	NA
AZH23502.1|25223_25439_+	transporter	NA	NA	NA	NA	NA
AZH23503.1|25613_25850_-	hypothetical protein	NA	NA	NA	NA	NA
AZH23504.1|25914_26442_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	6.0e-47
AZH23505.1|26499_26733_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AZH23506.1|28885_29320_+	protein PsiB	NA	NA	NA	NA	NA
AZH23507.1|29316_30036_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AZH23508.1|30696_30915_+	hypothetical protein	NA	NA	NA	NA	NA
AZH23509.1|31089_31326_-	hypothetical protein	NA	NA	NA	NA	NA
AZH23510.1|31388_31685_+	hypothetical protein	NA	NA	NA	NA	NA
AZH23511.1|31795_32617_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	3.4e-44
AZH23512.1|32913_33561_-	lytic transglycosylase	NA	NA	NA	NA	NA
AZH23513.1|33837_34221_+	conjugal transfer protein TraM	NA	NA	NA	NA	NA
AZH23514.1|34501_35206_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZH23515.1|36839_37742_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AZH23516.1|37779_38013_-	hypothetical protein	NA	NA	NA	NA	NA
AZH23517.1|38003_38765_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AZH23518.1|38785_39646_-	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AZH23519.1|39566_39806_-	hypothetical protein	NA	NA	NA	NA	NA
AZH23520.1|39886_42853_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
AZH23521.1|42856_43417_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
AZH23522.1|44959_45238_+	hypothetical protein	NA	NA	NA	NA	NA
AZH23523.1|45348_45774_+	antirestriction protein	NA	A0A2D0W8Z5	Bordetella_virus	37.3	5.3e-17
AZH23524.1|46102_46399_+	transcriptional repressor protein KorC	NA	NA	NA	NA	NA
AZH23525.1|47633_48515_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AZH23526.1|48790_49771_-|transposase	IS481-like element ISKpn27 family transposase	transposase	A8RHK4	Spiroplasma_virus	27.4	2.9e-10
AZH23527.1|49893_50367_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	99.3	3.3e-76
AZH23528.1|50406_51111_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
CP034125	Klebsiella pneumoniae strain BJCFK909 plasmid p2b2, complete sequence	109179	68849	80008	109179		Escherichia_phage(50.0%)	11	NA	NA
AZH23546.1|68849_69716_+	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
AZH23547.1|70825_72031_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	5.3e-163
AZH23548.1|72027_73005_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.8	1.4e-86
AZH23549.1|73086_74358_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.7	7.5e-152
AZH23550.1|74357_74789_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
AZH23551.1|74947_75199_+	hypothetical protein	NA	NA	NA	NA	NA
AZH23605.1|75198_76683_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AZH23552.1|76931_77903_+	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
AZH23553.1|77905_78577_+	Mediator of plasmid stability	NA	NA	NA	NA	NA
AZH23554.1|78639_78870_+	hypothetical protein	NA	NA	NA	NA	NA
AZH23555.1|79306_80008_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
>prophage 1
CP034126	Klebsiella pneumoniae strain BJCFK909 plasmid p3s1, complete sequence	85665	552	14328	85665	transposase,integrase	Escherichia_phage(20.0%)	15	6963:7022	10507:11327
AZH23618.1|552_2046_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AZH23619.1|2076_2328_+	hypothetical protein	NA	NA	NA	NA	NA
AZH23620.1|2221_2524_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AZH23621.1|2610_3426_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
AZH23622.1|3755_3932_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
AZH23623.1|4113_5118_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
6963:7022	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
AZH23624.1|7014_7719_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZH23625.1|7965_8439_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
AZH23626.1|8594_9608_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AZH23702.1|9576_9861_+|transposase	transposase	transposase	NA	NA	NA	NA
AZH23627.1|10000_10525_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	48.4	1.2e-31
AZH23628.1|10558_11263_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZH23629.1|11561_12341_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	51.0	3.7e-69
10507:11327	attR	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCG	NA	NA	NA	NA
AZH23630.1|12340_12766_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.3	3.7e-31
AZH23703.1|12843_14328_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
