The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034090	Proteus mirabilis strain PmSC1111 chromosome, complete genome	4189199	1432	10276	4189199		Caulobacter_phage(50.0%)	9	NA	NA
AZH04175.1|1432_2578_-	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	27.4	9.2e-32
AZH04176.1|2970_3555_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.2	4.2e-17
AZH04177.1|3555_4692_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
AZH04178.1|4716_5172_+	Tellurium resistance protein TerB	NA	NA	NA	NA	NA
AZH04179.1|5206_6232_+	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.9	1.0e-74
AZH04180.1|6299_6878_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.5	2.4e-33
AZH04181.1|6954_7530_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
AZH04182.1|7626_8307_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
AZH04183.1|8707_10276_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	7.2e-11
>prophage 2
CP034090	Proteus mirabilis strain PmSC1111 chromosome, complete genome	4189199	272693	324708	4189199	head,holin,integrase,terminase	Morganella_phage(22.64%)	74	273789:273845	321601:321657
AZH04390.1|272693_273566_-	bifunctional 5,10-methylene-tetrahydrofolate dehydrogenase/5,10-methylene-tetrahydrofolate cyclohydrolase	NA	A0A249XZQ2	Enterococcus_phage	36.8	5.7e-34
273789:273845	attL	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTACCATTTAAAATCAAT	NA	NA	NA	NA
AZH04391.1|273854_275012_-|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	74.9	4.0e-176
AZH04392.1|275245_275440_-	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	85.9	5.7e-27
AZH04393.1|276058_276277_-	hypothetical protein	NA	NA	NA	NA	NA
AZH04394.1|276273_276609_-	DUF2591 domain-containing protein	NA	E9NID9	Enterobacter_phage	38.8	3.1e-12
AZH04395.1|276932_277286_-	hypothetical protein	NA	NA	NA	NA	NA
AZH04396.1|277412_277607_-	hypothetical protein	NA	NA	NA	NA	NA
AZH04397.1|277642_277828_-	hook protein	NA	NA	NA	NA	NA
AZH04398.1|278306_279005_-	exonuclease	NA	A0A2R2Z325	Escherichia_phage	57.3	2.0e-74
AZH04399.1|279001_279886_-	recombinase RecT	NA	A0A2L1IV84	Escherichia_phage	62.2	1.0e-94
AZH04400.1|279882_280134_-	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	94.0	1.6e-37
AZH04401.1|280130_280406_-	hypothetical protein	NA	NA	NA	NA	NA
AZH04402.1|280628_281570_-	cell envelope biogenesis protein TolA	NA	A0A2I7QK72	Vibrio_phage	46.6	2.3e-20
AZH04403.1|281674_281995_-	hypothetical protein	NA	NA	NA	NA	NA
AZH04404.1|281997_282345_-	hypothetical protein	NA	NA	NA	NA	NA
AZH04405.1|282513_283068_+	hypothetical protein	NA	NA	NA	NA	NA
AZH04406.1|283083_283305_-	hypothetical protein	NA	A0A1P8DTK1	Proteus_phage	90.9	5.1e-08
AZH04407.1|283749_284166_-	hypothetical protein	NA	NA	NA	NA	NA
AZH04408.1|284158_284623_-	hypothetical protein	NA	NA	NA	NA	NA
AZH04409.1|284698_285424_-	helix-turn-helix transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	42.0	8.9e-41
AZH04410.1|285528_285756_+	helix-turn-helix domain-containing protein	NA	E5AGE7	Erwinia_phage	67.6	6.0e-20
AZH04411.1|285858_286206_+	hypothetical protein	NA	A0A1P8DTF0	Proteus_phage	34.3	5.8e-06
AZH04412.1|286471_286651_+	hypothetical protein	NA	G9L679	Escherichia_phage	59.6	2.9e-09
AZH04413.1|286643_287741_+	DNA replication protein	NA	E5AGE9	Erwinia_phage	56.5	9.5e-103
AZH04414.1|287740_289117_+	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	58.3	4.2e-156
AZH04415.1|289319_289541_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZH04416.1|289527_289767_+	hypothetical protein	NA	NA	NA	NA	NA
AZH04417.1|289763_290072_+	hypothetical protein	NA	NA	NA	NA	NA
AZH04418.1|290096_290306_+	hypothetical protein	NA	A0A1X9Y878	Proteus_phage	70.3	1.2e-22
AZH04419.1|290315_290759_+	hypothetical protein	NA	A0A1P8DTD8	Proteus_phage	91.9	4.2e-33
AZH04420.1|290870_291464_+	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	92.3	1.4e-92
AZH04421.1|291616_291808_+	hypothetical protein	NA	A0A1P8DTD3	Proteus_phage	87.3	6.8e-25
AZH04422.1|291804_292443_+	hypothetical protein	NA	Q8HA89	Salmonella_phage	35.9	3.9e-32
AZH04423.1|293011_293401_+	hypothetical protein	NA	S4TRS4	Salmonella_phage	35.0	4.2e-13
AZH04424.1|293397_293685_+|holin	phage holin family protein	holin	NA	NA	NA	NA
AZH04425.1|293677_294082_+	structural protein	NA	A0A2I7RXE2	Vibrio_phage	50.8	6.9e-27
AZH04426.1|294078_294459_+	hypothetical protein	NA	NA	NA	NA	NA
AZH04427.1|294346_294604_+	peptidase	NA	Q8SBD8	Shigella_phage	44.0	4.4e-11
AZH04428.1|294950_295535_+	hypothetical protein	NA	Q3LZN7	Bacteriophage	48.2	2.0e-22
AZH04429.1|295531_295738_+	hypothetical protein	NA	NA	NA	NA	NA
AZH04430.1|295920_296529_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	69.1	2.2e-64
AZH04431.1|296531_298016_+|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	88.7	7.9e-270
AZH04432.1|298017_299394_+	DUF4055 domain-containing protein	NA	A0A1W6JNV0	Morganella_phage	79.5	9.8e-214
AZH04433.1|299402_300467_+|head	phage head morphogenesis protein	head	A0A1W6JNT7	Morganella_phage	51.4	2.4e-103
AZH04434.1|300541_301228_+	hypothetical protein	NA	A0A1W6JNU9	Morganella_phage	81.5	1.2e-74
AZH04435.1|301233_302184_+	hypothetical protein	NA	A0A1W6JNV5	Morganella_phage	87.5	7.8e-154
AZH04436.1|302226_302604_+	hypothetical protein	NA	A0A1W6JP09	Morganella_phage	71.2	5.8e-44
AZH04437.1|302605_302947_+	hypothetical protein	NA	A0A1W6JNW7	Morganella_phage	80.5	3.1e-52
AZH04438.1|302949_303318_+	HK97 gp10 family phage protein	NA	A0A1W6JNX7	Morganella_phage	86.1	7.9e-54
AZH04439.1|303314_303686_+	hypothetical protein	NA	A0A1W6JNU7	Morganella_phage	70.7	3.3e-47
AZH04440.1|303759_304005_+	hypothetical protein	NA	NA	NA	NA	NA
AZH04441.1|304055_304811_+	DNA breaking-rejoining protein	NA	A0A1W6JNT1	Morganella_phage	78.9	9.7e-107
AZH04442.1|304860_305553_+	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	71.5	3.4e-90
AZH04443.1|305573_306392_-	ORF6N domain-containing protein	NA	G9L689	Escherichia_phage	62.3	8.8e-37
AZH07731.1|306388_307144_-	DNA-binding protein	NA	A0A2H4JDP7	uncultured_Caudovirales_phage	43.7	2.0e-35
AZH04444.1|307217_307385_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	46.3	4.0e-05
AZH04445.1|307504_307837_+	Arc family DNA-binding protein	NA	H6WRU6	Salmonella_phage	80.9	8.5e-15
AZH04446.1|307892_308303_+	hypothetical protein	NA	A0A286S1N7	Klebsiella_phage	45.3	1.1e-19
AZH04447.1|308329_308875_+	hypothetical protein	NA	NA	NA	NA	NA
AZH04448.1|308943_312285_+	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	43.5	4.4e-167
AZH04449.1|312413_312914_-	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	40.7	4.9e-22
AZH04450.1|313007_313484_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	73.0	2.5e-60
AZH04451.1|313483_313954_+	DUF1833 domain-containing protein	NA	F1C5F1	Cronobacter_phage	51.9	6.8e-42
AZH04452.1|313950_314343_+	peptidoglycan endopeptidase	NA	F1C5F2	Cronobacter_phage	59.5	2.5e-45
AZH04453.1|314329_316798_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	52.2	6.0e-254
AZH07732.1|316828_317638_-	phage antirepressor Ant	NA	I6S627	Salmonella_phage	47.6	1.1e-68
AZH04454.1|317708_317885_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	67.3	4.2e-13
AZH04455.1|317991_318318_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	41.3	3.2e-06
AZH04456.1|318373_318754_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AZH04457.1|318842_321131_+	SGNH/GDSL hydrolase family protein	NA	A0A291AXF7	Shigella_phage	56.1	1.0e-45
AZH04458.1|321195_321426_-	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	96.1	4.8e-33
AZH04459.1|322121_322817_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
321601:321657	attR	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTACCATTTAAAATCAAT	NA	NA	NA	NA
AZH04460.1|323219_323891_+	hypothetical protein	NA	NA	NA	NA	NA
AZH04461.1|324081_324708_-	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	31.6	1.3e-11
>prophage 3
CP034090	Proteus mirabilis strain PmSC1111 chromosome, complete genome	4189199	825632	844578	4189199	holin	Escherichia_phage(28.57%)	20	NA	NA
AZH04852.1|825632_826448_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.4	2.1e-54
AZH04853.1|826830_827130_+|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	51.0	1.9e-21
AZH04854.1|827132_827537_+	structural protein	NA	A0A0A0RQM4	Escherichia_phage	47.9	1.7e-25
AZH04855.1|828018_828531_+	hypothetical protein	NA	NA	NA	NA	NA
AZH04856.1|828539_830027_+	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.7	1.4e-77
AZH04857.1|830037_830490_+	hypothetical protein	NA	NA	NA	NA	NA
AZH04858.1|830548_831007_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	47.7	5.6e-25
AZH04859.1|831089_833393_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.3	1.1e-15
AZH04860.1|833395_833884_+	hypothetical protein	NA	NA	NA	NA	NA
AZH04861.1|833896_834217_+	hypothetical protein	NA	NA	NA	NA	NA
AZH04862.1|834185_834998_+	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	9.0e-42
AZH04863.1|835000_835693_+	hypothetical protein	NA	A1Z003	Burkholderia_virus	37.1	1.6e-34
AZH04864.1|835689_836034_+	hypothetical protein	NA	NA	NA	NA	NA
AZH04865.1|836026_837214_+	hypothetical protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	37.9	1.4e-72
AZH04866.1|837210_837867_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.4	6.6e-35
AZH04867.1|839324_839504_-	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
AZH04868.1|840072_840615_+	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.7	3.2e-19
AZH04869.1|840730_841507_-	diguanylate cyclase	NA	A0A077SK59	Escherichia_phage	39.8	5.1e-42
AZH04870.1|841510_842128_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	67.8	1.3e-88
AZH04871.1|842139_844578_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	54.5	5.0e-261
>prophage 4
CP034090	Proteus mirabilis strain PmSC1111 chromosome, complete genome	4189199	1378607	1388599	4189199		Escherichia_phage(66.67%)	8	NA	NA
AZH05345.1|1378607_1381052_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.4	3.3e-220
AZH05346.1|1381063_1381681_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	2.2e-72
AZH05347.1|1381682_1382543_+	dimethylsulfoxide reductase	NA	A0A077SK59	Escherichia_phage	35.5	3.7e-25
AZH05348.1|1382682_1383294_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	39.1	7.3e-28
AZH05349.1|1383346_1383808_-	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	34.6	7.0e-15
AZH05350.1|1383807_1384494_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
AZH05351.1|1384829_1386530_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AZH05352.1|1386541_1388599_+	K(+)-transporting ATPase subunit B	NA	E4ZFI9	Streptococcus_phage	26.1	6.3e-31
>prophage 5
CP034090	Proteus mirabilis strain PmSC1111 chromosome, complete genome	4189199	1648290	1664938	4189199	capsid,tail,lysis,portal,terminase,head,protease	Salmonella_phage(12.5%)	23	NA	NA
AZH05569.1|1648290_1648689_-	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	47.7	9.2e-32
AZH05570.1|1648720_1649026_-	hypothetical protein	NA	NA	NA	NA	NA
AZH05571.1|1649037_1649619_-	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.0	2.4e-52
AZH05572.1|1649618_1650215_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	52.8	4.6e-51
AZH05573.1|1650215_1653491_-|tail	phage tail tape measure protein	tail	B7SE05	Pseudomonas_virus	45.6	6.4e-54
AZH05574.1|1653617_1653809_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
AZH05575.1|1653833_1654112_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
AZH05576.1|1654108_1654525_-	hypothetical protein	NA	NA	NA	NA	NA
AZH05577.1|1654589_1655255_-	hypothetical protein	NA	NA	NA	NA	NA
AZH05578.1|1655264_1655606_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
AZH05579.1|1655611_1656085_-	hypothetical protein	NA	A0A0R6PHU8	Moraxella_phage	31.5	1.9e-12
AZH05580.1|1656074_1656404_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AZH05581.1|1656403_1656703_-	hypothetical protein	NA	K7PKV5	Enterobacterial_phage	64.3	2.8e-33
AZH05582.1|1656741_1657908_-|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	79.8	5.6e-170
AZH05583.1|1657911_1658580_-|head,protease	HK97 family phage prohead protease	head,protease	K7PM91	Enterobacterial_phage	65.3	1.1e-82
AZH05584.1|1658597_1659866_-|portal	phage portal protein	portal	Q77W97	Enterobacteria_phage	80.2	5.1e-201
AZH05585.1|1659865_1661599_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.5	6.9e-148
AZH05586.1|1661552_1662020_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	5.5e-44
AZH05587.1|1662143_1662356_-	hypothetical protein	NA	A0A1W6JP16	Morganella_phage	44.8	1.4e-07
AZH05588.1|1662358_1662697_-	HNH endonuclease	NA	F1C587	Cronobacter_phage	67.9	1.6e-40
AZH05589.1|1663594_1664056_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	47.6	3.7e-24
AZH05590.1|1664198_1664669_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	60.5	7.5e-49
AZH05591.1|1664668_1664938_-	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	4.6e-19
>prophage 6
CP034090	Proteus mirabilis strain PmSC1111 chromosome, complete genome	4189199	1669242	1680357	4189199	integrase	Morganella_phage(28.57%)	17	1664465:1664478	1679950:1679963
1664465:1664478	attL	TTTGTAATAACGCA	NA	NA	NA	NA
AZH05597.1|1669242_1669455_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	75.7	7.6e-25
AZH05598.1|1669797_1670196_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	55.0	1.0e-30
AZH05599.1|1670223_1671249_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	47.6	2.8e-88
AZH05600.1|1671248_1671956_-	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	51.7	5.6e-56
AZH05601.1|1672127_1673219_-	replication protein	NA	H2DE83	Erwinia_phage	55.3	8.2e-30
AZH05602.1|1673231_1673411_-	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	55.2	1.1e-11
AZH05603.1|1673400_1673610_-	hypothetical protein	NA	NA	NA	NA	NA
AZH05604.1|1673699_1674158_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	50.8	3.9e-26
AZH05605.1|1674242_1674482_-	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	54.8	3.0e-14
AZH05606.1|1674585_1675068_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	51.4	3.7e-11
AZH05607.1|1675510_1675693_+	hypothetical protein	NA	NA	NA	NA	NA
AZH05608.1|1675716_1676091_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	71.4	3.2e-42
AZH05609.1|1676156_1676984_+	DUF2303 family protein	NA	A0A2R2Z323	Escherichia_phage	56.6	5.5e-79
AZH05610.1|1677040_1677571_+	HD family hydrolase	NA	A0A1W6JP41	Morganella_phage	58.6	5.7e-53
AZH05611.1|1677632_1677875_+	excisionase	NA	NA	NA	NA	NA
AZH05612.1|1677855_1678983_+|integrase	integrase	integrase	O21925	Phage_21	60.3	1.4e-125
AZH05613.1|1679103_1680357_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.6e-21
1679950:1679963	attR	TTTGTAATAACGCA	NA	NA	NA	NA
>prophage 7
CP034090	Proteus mirabilis strain PmSC1111 chromosome, complete genome	4189199	1792820	1846175	4189199	transposase,tRNA,plate,protease	Tupanvirus(16.67%)	39	NA	NA
AZH07759.1|1792820_1794563_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
AZH05714.1|1794646_1795165_+	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
AZH05715.1|1795472_1795643_-	ribosome modulation factor	NA	NA	NA	NA	NA
AZH05716.1|1796131_1796536_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
AZH05717.1|1796623_1797196_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
AZH05718.1|1797195_1798848_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
AZH05719.1|1798840_1800130_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
AZH05720.1|1800222_1802154_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.7	4.3e-50
AZH05721.1|1802160_1804275_-	ribosomal RNA large subunit methyltransferase K/L	NA	NA	NA	NA	NA
AZH05722.1|1804384_1805527_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
AZH05723.1|1805793_1806345_-	cell division protein ZapC	NA	NA	NA	NA	NA
AZH05724.1|1806559_1807570_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AZH05725.1|1809122_1811738_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	21.6	5.7e-21
AZH05726.1|1812079_1813294_+	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.7	1.6e-42
AZH05727.1|1813308_1813500_-	hypothetical protein	NA	NA	NA	NA	NA
AZH05728.1|1813573_1814974_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	37.6	6.9e-82
AZH07760.1|1815318_1816431_+	porin	NA	Q1MVN1	Enterobacteria_phage	51.3	1.3e-96
AZH05729.1|1816783_1817974_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
AZH07761.1|1818042_1818261_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AZH05730.1|1818398_1819361_-	hypothetical protein	NA	NA	NA	NA	NA
AZH05731.1|1820253_1820868_-	DUF1963 domain-containing protein	NA	NA	NA	NA	NA
AZH05732.1|1824471_1825680_-|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	81.0	5.6e-189
AZH05733.1|1826262_1826655_-	thioredoxin	NA	NA	NA	NA	NA
AZH05734.1|1826651_1827923_-	hypothetical protein	NA	NA	NA	NA	NA
AZH05735.1|1827946_1828909_-	hypothetical protein	NA	NA	NA	NA	NA
AZH05736.1|1828912_1830487_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
AZH05737.1|1830487_1831513_-	3-oxoacyl-ACP synthase	NA	NA	NA	NA	NA
AZH05738.1|1831515_1832571_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
AZH05739.1|1832585_1833116_-	hypothetical protein	NA	NA	NA	NA	NA
AZH05740.1|1833118_1835269_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
AZH05741.1|1835352_1835871_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
AZH05742.1|1837768_1838269_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AZH05743.1|1838289_1839768_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AZH07762.1|1839773_1840205_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AZH05744.1|1840212_1841988_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AZH05745.1|1841951_1842989_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AZH07763.1|1842993_1844262_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AZH05746.1|1844263_1844815_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AZH05747.1|1844807_1846175_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 8
CP034090	Proteus mirabilis strain PmSC1111 chromosome, complete genome	4189199	2079223	2127475	4189199	tRNA,lysis,tail,terminase	Cronobacter_phage(17.95%)	59	NA	NA
AZH07770.1|2079223_2080891_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	85.0	1.0e-286
AZH05936.1|2081135_2081276_+	hypothetical protein	NA	A0A1P8DTI0	Proteus_phage	89.1	4.7e-15
AZH05937.1|2081769_2082312_+	uroepithelial cell adherence major pilin UcaA	NA	NA	NA	NA	NA
AZH05938.1|2082377_2083103_+	molecular chaperone	NA	NA	NA	NA	NA
AZH05939.1|2083112_2085647_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AZH05940.1|2085656_2086739_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AZH05941.1|2086839_2087145_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZH05942.1|2087845_2088106_-	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	57.4	1.9e-17
AZH05943.1|2088155_2088770_-	hypothetical protein	NA	NA	NA	NA	NA
AZH05944.1|2088771_2089140_-	hypothetical protein	NA	NA	NA	NA	NA
AZH05945.1|2089133_2093327_-	DUF1983 domain-containing protein	NA	F1C571	Cronobacter_phage	54.5	1.7e-301
AZH05946.1|2093378_2093966_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	59.9	1.4e-57
AZH05947.1|2093962_2094673_-	peptidase P60	NA	A0A1P8DTI6	Proteus_phage	61.2	1.2e-85
AZH05948.1|2094669_2095413_-|tail	phage minor tail protein L	tail	K7PJS0	Enterobacterial_phage	59.4	7.6e-88
AZH05949.1|2095409_2095751_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	50.0	9.0e-28
AZH05950.1|2095894_2096095_+	hypothetical protein	NA	NA	NA	NA	NA
AZH05951.1|2096114_2096405_-	hypothetical protein	NA	NA	NA	NA	NA
AZH05952.1|2096416_2099347_-|tail	phage tail tape measure protein	tail	A0A0K0VLY2	Klebsiella_phage	34.9	3.1e-132
AZH05953.1|2099407_2100229_-	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	51.9	6.2e-22
AZH05954.1|2100352_2101495_-	hypothetical protein	NA	NA	NA	NA	NA
AZH05955.1|2101617_2102352_-	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	56.7	1.3e-66
AZH05956.1|2102428_2103001_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	58.4	4.6e-32
AZH05957.1|2103326_2104046_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZH05958.1|2104101_2104911_-	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	33.3	1.8e-21
AZH05959.1|2104917_2105151_-	hypothetical protein	NA	NA	NA	NA	NA
AZH05960.1|2105376_2105664_-	hypothetical protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	49.3	6.9e-13
AZH05961.1|2105678_2105984_-	hypothetical protein	NA	I6PDG2	Cronobacter_phage	55.4	6.6e-22
AZH05962.1|2106035_2106692_-|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	56.7	5.6e-58
AZH05963.1|2106736_2107138_-	hypothetical protein	NA	NA	NA	NA	NA
AZH05964.1|2107134_2107716_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	52.1	3.5e-48
AZH05965.1|2107717_2108068_-	hypothetical protein	NA	I6PD77	Cronobacter_phage	42.5	1.2e-19
AZH05966.1|2108070_2108550_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	47.7	3.8e-32
AZH05967.1|2108589_2108874_-	hypothetical protein	NA	NA	NA	NA	NA
AZH05968.1|2108876_2109830_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	71.2	5.3e-126
AZH05969.1|2109843_2110605_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.3	1.5e-67
AZH05970.1|2110716_2111838_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	51.2	1.8e-104
AZH05971.1|2111834_2113205_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	48.8	9.0e-119
AZH05972.1|2113204_2114692_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	89.0	5.9e-265
AZH05973.1|2114694_2115303_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	69.1	2.2e-64
AZH05974.1|2115485_2115692_-	hypothetical protein	NA	NA	NA	NA	NA
AZH05975.1|2115688_2116273_-	hypothetical protein	NA	Q3LZN7	Bacteriophage	48.2	2.0e-22
AZH05976.1|2116620_2117082_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	34.1	4.4e-09
AZH05977.1|2117224_2117695_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	62.5	4.4e-49
AZH05978.1|2117694_2117964_-	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	6.0e-19
AZH05979.1|2118017_2118440_-	hypothetical protein	NA	NA	NA	NA	NA
AZH05980.1|2118598_2119120_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
AZH05981.1|2119429_2120062_-	antitermination protein	NA	NA	NA	NA	NA
AZH05982.1|2120061_2120418_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	70.7	4.7e-43
AZH05983.1|2120414_2120705_-	DUF1364 domain-containing protein	NA	A0A2H4JIC4	uncultured_Caudovirales_phage	68.1	7.2e-34
AZH05984.1|2120783_2121233_-	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	32.2	2.9e-13
AZH07771.1|2121300_2121630_-	hypothetical protein	NA	A0A1C9LVV9	Vibrio_phage	39.0	1.1e-22
AZH05985.1|2121657_2123043_-	helicase	NA	Q716D2	Shigella_phage	47.7	1.4e-114
AZH05986.1|2123042_2123810_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	51.9	1.5e-22
AZH05987.1|2124074_2124422_-	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	72.9	1.1e-36
AZH05988.1|2124567_2124777_-	XRE family transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	83.3	1.2e-25
AZH05989.1|2124882_2125527_+	LexA family transcriptional regulator	NA	A0A077KGZ5	Edwardsiella_phage	65.0	1.9e-79
AZH05990.1|2125561_2126341_+	hypothetical protein	NA	NA	NA	NA	NA
AZH05991.1|2126337_2126703_+	hypothetical protein	NA	NA	NA	NA	NA
AZH05992.1|2127157_2127475_+	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	52.3	7.1e-19
>prophage 9
CP034090	Proteus mirabilis strain PmSC1111 chromosome, complete genome	4189199	2175566	2184099	4189199		Mycobacterium_phage(28.57%)	9	NA	NA
AZH06040.1|2175566_2175941_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
AZH06041.1|2176549_2177038_+	hypothetical protein	NA	NA	NA	NA	NA
AZH06042.1|2177339_2177549_-	cold shock-like protein CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
AZH06043.1|2177746_2178220_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
AZH06044.1|2178501_2178726_+	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
AZH06045.1|2178737_2179142_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	4.8e-12
AZH06046.1|2179170_2181297_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.3	1.5e-205
AZH06047.1|2181322_2182291_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.0	3.5e-133
AZH06048.1|2182899_2184099_+	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
>prophage 10
CP034090	Proteus mirabilis strain PmSC1111 chromosome, complete genome	4189199	3286141	3307641	4189199	transposase,tRNA,integrase	unidentified_phage(25.0%)	21	3279349:3279362	3312443:3312456
3279349:3279362	attL	ATCTTTAACTTGCC	NA	NA	NA	NA
AZH06962.1|3286141_3287506_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
AZH06963.1|3287709_3288927_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	28.3	6.3e-15
AZH06964.1|3288923_3289292_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZH06965.1|3289647_3290601_-	replication protein	NA	NA	NA	NA	NA
AZH06966.1|3290587_3290815_-	DNA-binding protein	NA	NA	NA	NA	NA
AZH06967.1|3290965_3293725_-	conjugal transfer mating pair stabilization protein TraN	NA	NA	NA	NA	NA
AZH06968.1|3293821_3294355_-	regulator	NA	NA	NA	NA	NA
AZH06969.1|3294755_3295969_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	65.1	7.5e-117
AZH06970.1|3296229_3296439_-	hypothetical protein	NA	NA	NA	NA	NA
AZH06971.1|3296625_3296916_+	hypothetical protein	NA	NA	NA	NA	NA
AZH06972.1|3297072_3297777_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZH07807.1|3297890_3298667_+	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
AZH06973.1|3298687_3298909_+	hypothetical protein	NA	NA	NA	NA	NA
AZH06974.1|3298895_3299921_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
AZH06975.1|3300342_3301095_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	38.7	2.4e-33
AZH06976.1|3302905_3303391_+	phenol hydroxylase	NA	NA	NA	NA	NA
AZH06977.1|3303587_3304678_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
AZH06978.1|3304767_3305583_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
AZH06979.1|3305669_3305972_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AZH06980.1|3305865_3306117_-	hypothetical protein	NA	NA	NA	NA	NA
AZH06981.1|3306147_3307641_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
3312443:3312456	attR	GGCAAGTTAAAGAT	NA	NA	NA	NA
>prophage 11
CP034090	Proteus mirabilis strain PmSC1111 chromosome, complete genome	4189199	3311325	3362486	4189199	transposase,integrase	Escherichia_phage(33.33%)	51	3339459:3339518	3367101:3368697
AZH06985.1|3311325_3312030_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
AZH07808.1|3312114_3312516_-	hypothetical protein	NA	NA	NA	NA	NA
AZH06986.1|3312524_3315476_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
AZH06987.1|3315478_3316039_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AZH07809.1|3316164_3316515_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AZH06988.1|3316717_3317731_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AZH06989.1|3317897_3318740_+	alpha/beta fold putative hydrolase EstX	NA	W8EKH7	Mycobacterium_phage	26.1	3.0e-08
AZH06990.1|3318835_3319444_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
AZH06991.1|3319501_3320293_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AZH06992.1|3320554_3321814_+	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
AZH06993.1|3321906_3322698_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AZH06994.1|3322867_3323200_+	quaternary ammonium compound efflux SMR transporter QacL	NA	E5E3Y9	Acinetobacter_phage	35.3	2.0e-08
AZH06995.1|3323339_3323525_+	hypothetical protein	NA	NA	NA	NA	NA
AZH06996.1|3324379_3325171_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	NA	NA	NA	NA
AZH06997.1|3325639_3325885_-	hypothetical protein	NA	NA	NA	NA	NA
AZH06998.1|3325922_3326786_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AZH06999.1|3327016_3327721_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZH07000.1|3327871_3328687_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
AZH07001.1|3328876_3329581_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZH07002.1|3329731_3330547_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
AZH07003.1|3330736_3331441_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZH07004.1|3331845_3332343_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
AZH07005.1|3332454_3332745_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
AZH07006.1|3333391_3334096_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZH07810.1|3334120_3334858_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
AZH07007.1|3335074_3336289_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
AZH07008.1|3336316_3336622_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZH07009.1|3336733_3338227_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AZH07010.1|3338257_3338470_+	hypothetical protein	NA	NA	NA	NA	NA
AZH07011.1|3338503_3339208_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZH07012.1|3339432_3339636_-	hypothetical protein	NA	NA	NA	NA	NA
3339459:3339518	attL	CTAGGAGCTCGGATCTCAGGACGAAGGTCTCCGCGAATGTCCGGTCGATCCGCGCGACGT	NA	NA	NA	NA
AZH07013.1|3339654_3339834_+	hypothetical protein	NA	NA	NA	NA	NA
AZH07014.1|3339763_3340603_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
AZH07015.1|3340596_3340944_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AZH07016.1|3341074_3341554_-	hypothetical protein	NA	NA	NA	NA	NA
AZH07017.1|3341647_3342121_-	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
AZH07018.1|3342277_3343291_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AZH07811.1|3343259_3343541_+|transposase	transposase	transposase	NA	NA	NA	NA
AZH07019.1|3343564_3344149_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	58.1	5.5e-49
AZH07020.1|3344227_3345217_+	ATP-binding protein	NA	NA	NA	NA	NA
AZH07021.1|3345237_3347781_+	S8 family peptidase	NA	NA	NA	NA	NA
AZH07022.1|3347858_3349784_+	DUF2813 domain-containing protein	NA	NA	NA	NA	NA
AZH07023.1|3349780_3351442_+	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	22.8	7.1e-09
AZH07812.1|3352510_3353383_+|integrase	integrase	integrase	NA	NA	NA	NA
AZH07024.1|3353386_3353683_+	hypothetical protein	NA	NA	NA	NA	NA
AZH07025.1|3354531_3354801_+	hypothetical protein	NA	NA	NA	NA	NA
AZH07026.1|3355215_3355611_-	hypothetical protein	NA	NA	NA	NA	NA
AZH07027.1|3355607_3356465_-	hypothetical protein	NA	NA	NA	NA	NA
AZH07028.1|3356708_3358133_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
AZH07029.1|3358136_3361541_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AZH07030.1|3361781_3362486_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
3367101:3368697	attR	ACGTCGCGCGGATCGACCGGACATTCGCGGAGACCTTCGTCCTGAGATCCGAGCTCCTAGTCGCGAGTTGCAGCGACGGCATCGTCGGCTGTTGCACCTTGTCGGCCGAGGATCCCGAGTTCTGGCCCGACGCCCTCAAGGGGGAGGCCGCATATCTGCACAAGCTCGCGGTGCGACGGACACATGCGGGCCGGGGTGTCAGCTCCGCGCTGATCGAGGCTTGCCGCCATGCCGCGCGAACGCAGGGGTGCGCCAAGCTGCGGCTCGACTGCCACCCGAACCTGCGTGGCCTATACGAGCGGCTCGGATTCACCCACGTCGACACTTTCAATCCCGGCTGGGATCCAACCTTCATCGCAGAACGCCTAGAACTCGAAATCTAACGTCCGTTCGGGCATCGAGGTCCATGTCGGGGTGGGACGGGCCCGTGGCTTCAAGATCACTTGCAGTCCGACCGCGATGTCTTGGTTGCGCGAGAGGTTGTCGATATCCTCCACTTCCATCATCAACCCTGGATAATGCCGCCGCCGTCATCGCCGCCGACGCCCGTGCCGGGCTTTTCGGGCCTGTCAGGCTTGCTCGGCCTTCAGCCTGCCTGGGCGAGATCTCCGGCGGACGGATTAACGGCGGAGCTTCGCCGCCTTTCGTGCGTGTGAAGGCCGAAGATAGTTCTCTCAAAAACATCCGTTTATGAGAGATACCAAATGTCATTTTCAGAAGACGACTGCACCAGTTGATTGGGCGTAATGGCTGTTGTGCAGCCAGCTCCTGACAGTTCAATATCAGAAGTGATCTGCACCAATCTCGACTATGCTCAATACTCGTGTGGGCTCTGTTGCAAAAATCGTGAAGCTTGAGCATGCTTGGCGGAGATTGGACGGACGGAACGATGACGGATTTCAAGTGGCGCCATTTCCAGGGTGATGTGATCCTGTGGGCGGTGCGCTGGTATTGTCGCTATCCGATCAGCTATCGCGACCTTGAGGAAATGCTGGCGGAACGCGGCATTTCGGTCGACCATACGACGATCTATCGCTGGGTCCAGTGCTACGCCCCGGAGATGGAGAAGCGGCTGCGCTGGTTCTGGCGGCGTGGCTTTGATCCGAGCTGGCGCCTGGATGAAACCTACGTCAAGGTGCGGGGCAAGTGGACCTACCTGTACCGGGCAGTCGACAAGCGGGGCGACACGATCGATTTCTACCTGTCGCCGACCCGCAGCGCCAAGGCAGCGAAGCGGTTCCTGGGCAAGGCCCTGCGAGGCCTGAAGCACTGGGAAAAGCCTGCCACGCTCAATACCGACAAAGCGCCGAGCTATGGTGCAGCGATCACCGAATTGAAGCGCGAAGGAAAGCTGGACCGGGAGACGGCCCACCGGCAGGTGAAGTATCTCAATAACGTGATCGAGGCCGATCACGGAAAGCTCAAGATACTGATCAAGCCGGTGCGCGGTTTCAAATCGATCCCCACGGCCTATGCCACGATCAAGGGATTCGAAGTCATGCGAGCCCTGCGCAAAGGACAGGCTCGCCCCTGGTGCCTGCAGCCCGGCATCAGGGGCGAGGTGCGCCTTGTGGAGAGAGCTTTTGGCATTGGGCCC	NA	NA	NA	NA
>prophage 12
CP034090	Proteus mirabilis strain PmSC1111 chromosome, complete genome	4189199	4019597	4118740	4189199	transposase,integrase	Escherichia_phage(32.14%)	93	4106638:4106697	4117322:4117392
AZH07574.1|4019597_4022576_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
AZH07575.1|4022690_4022882_+	hypothetical protein	NA	A0A2I7RTF0	Vibrio_phage	50.0	1.8e-09
AZH07576.1|4022993_4024487_+|transposase	IS91-like element ISVsa3 family transposase	transposase	NA	NA	NA	NA
AZH07577.1|4024517_4025402_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
AZH07578.1|4025624_4026839_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
AZH07579.1|4026866_4027172_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZH07580.1|4027283_4027823_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AZH07832.1|4027794_4028631_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AZH07581.1|4028630_4029434_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
AZH07582.1|4029494_4030310_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
AZH07583.1|4030682_4031835_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	38.6	7.8e-47
AZH07584.1|4032139_4032409_-	hypothetical protein	NA	A0A218MNF2	uncultured_virus	75.0	1.2e-27
AZH07585.1|4032416_4032866_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A218MND2	uncultured_virus	57.9	9.1e-36
AZH07586.1|4033507_4034413_+	DNA polymerase III subunit epsilon	NA	NA	NA	NA	NA
AZH07587.1|4034500_4034800_+	hypothetical protein	NA	NA	NA	NA	NA
AZH07588.1|4035117_4036071_+	WYL domain-containing protein	NA	NA	NA	NA	NA
AZH07589.1|4036151_4037987_+	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	31.4	8.6e-40
AZH07590.1|4037988_4040640_+	restriction endonuclease subunit R	NA	NA	NA	NA	NA
AZH07591.1|4040736_4044618_+	hypothetical protein	NA	NA	NA	NA	NA
AZH07592.1|4044617_4047044_+	hypothetical protein	NA	NA	NA	NA	NA
AZH07593.1|4047115_4048297_+	DUF4268 domain-containing protein	NA	NA	NA	NA	NA
AZH07594.1|4048453_4050604_+	phosphohydrolase	NA	NA	NA	NA	NA
AZH07595.1|4050652_4052473_+	conjugal transfer protein	NA	NA	NA	NA	NA
AZH07596.1|4052482_4053043_+	conjugative transfer protein	NA	NA	NA	NA	NA
AZH07597.1|4053029_4053665_+	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
AZH07598.1|4053703_4054375_+	hypothetical protein	NA	NA	NA	NA	NA
AZH07599.1|4054367_4055474_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	29.0	1.3e-35
AZH07600.1|4055610_4055892_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
AZH07601.1|4055888_4056515_+	pilus assembly protein	NA	NA	NA	NA	NA
AZH07833.1|4056498_4057395_+	hypothetical protein	NA	NA	NA	NA	NA
AZH07602.1|4057397_4058687_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
AZH07603.1|4058683_4059334_+	conjugal transfer protein TraV	NA	NA	NA	NA	NA
AZH07604.1|4059330_4059717_+	hypothetical protein	NA	NA	NA	NA	NA
AZH07605.1|4059937_4060729_+	hypothetical protein	NA	NA	NA	NA	NA
AZH07606.1|4060721_4061660_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
AZH07607.1|4061791_4062484_+	DsbC family protein	NA	NA	NA	NA	NA
AZH07608.1|4062483_4064883_+	type IV secretion system protein TraC	NA	NA	NA	NA	NA
AZH07609.1|4064875_4065223_+	plasmid-related protein	NA	NA	NA	NA	NA
AZH07834.1|4065299_4065719_+	S26 family signal peptidase	NA	NA	NA	NA	NA
AZH07835.1|4065729_4066854_+	pilus assembly protein	NA	NA	NA	NA	NA
AZH07610.1|4066837_4067866_+	conjugal transfer protein TraU	NA	NA	NA	NA	NA
AZH07611.1|4067868_4071561_+	conjugal transfer protein TraN	NA	NA	NA	NA	NA
AZH07612.1|4072019_4073438_+	hypothetical protein	NA	NA	NA	NA	NA
AZH07613.1|4073434_4075474_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
AZH07836.1|4075882_4076557_-	deoxyribonuclease I	NA	NA	NA	NA	NA
AZH07614.1|4077907_4078420_-	signal peptidase II	NA	NA	NA	NA	NA
AZH07615.1|4078423_4079320_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
AZH07616.1|4079415_4079823_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AZH07617.1|4080277_4080556_-	resolvase	NA	NA	NA	NA	NA
AZH07837.1|4080581_4080767_+	hypothetical protein	NA	NA	NA	NA	NA
AZH07618.1|4080763_4081102_-	hypothetical protein	NA	NA	NA	NA	NA
AZH07619.1|4081005_4082196_-	tetracycline efflux MFS transporter Tet(C)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.0	8.1e-07
AZH07620.1|4082288_4082948_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZH07621.1|4083780_4084485_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZH07622.1|4084674_4085490_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
AZH07623.1|4085619_4086324_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZH07624.1|4086610_4087246_+	serine recombinase	NA	NA	NA	NA	NA
AZH07625.1|4087482_4088430_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	38.7	6.4e-55
AZH07626.1|4089318_4090029_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.1	9.8e-93
AZH07627.1|4090122_4090446_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AZH07628.1|4090643_4091348_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZH07629.1|4091359_4092016_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZH07630.1|4092111_4093296_+	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
AZH07631.1|4093390_4094500_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	2.8e-33
AZH07632.1|4094989_4095694_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AZH07633.1|4095874_4096144_+	hypothetical protein	NA	NA	NA	NA	NA
AZH07634.1|4096077_4096377_+	DUF536 domain-containing protein	NA	NA	NA	NA	NA
AZH07635.1|4096408_4097458_+	Cfr family 23S rRNA (adenine(2503)-C(8))-methyltransferase	NA	NA	NA	NA	NA
AZH07636.1|4097688_4098393_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AZH07637.1|4098476_4099361_-	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AZH07638.1|4099416_4100892_-	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
AZH07639.1|4101448_4102531_-	hypothetical protein	NA	NA	NA	NA	NA
AZH07640.1|4102857_4103562_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZH07838.1|4103705_4104260_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AZH07839.1|4104390_4105221_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
AZH07641.1|4105358_4105991_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
AZH07642.1|4106075_4106528_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
4106638:4106697	attL	CGGCGTTAGATGCACTAAGCACATAATTGCTCACAGCCAAACTATCAGGTCAAGTCTGCT	NA	NA	NA	NA
AZH07643.1|4106750_4107098_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AZH07644.1|4107091_4107931_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
AZH07645.1|4107860_4108040_-	hypothetical protein	NA	NA	NA	NA	NA
AZH07646.1|4108094_4108799_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AZH07647.1|4108994_4109387_+	NimC/NimA family protein	NA	NA	NA	NA	NA
AZH07648.1|4109706_4110093_-	bleomycin binding protein	NA	NA	NA	NA	NA
AZH07649.1|4110161_4110341_+	hypothetical protein	NA	Q1MVP5	Enterobacteria_phage	85.7	7.3e-05
AZH07650.1|4110286_4110991_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AZH07651.1|4111078_4111282_+	hypothetical protein	NA	NA	NA	NA	NA
AZH07652.1|4111437_4112643_+	chromate efflux transporter	NA	NA	NA	NA	NA
AZH07653.1|4112796_4113501_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZH07654.1|4113391_4114351_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
AZH07840.1|4114508_4114982_+	trimethoprim-resistant dihydrofolate reductase DfrA32	NA	A0A1B2IBQ4	Erwinia_phage	33.1	6.5e-16
AZH07655.1|4115174_4116395_+	EreA family erythromycin esterase	NA	NA	NA	NA	NA
AZH07841.1|4116479_4117271_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AZH07656.1|4117450_4118740_-|transposase	ISL3-like element ISPpu12 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	40.4	9.5e-86
4117322:4117392	attR	CGGCGTTAGATGCACTAAGCACATAATTGCTCACAGCCAAACTATCAGGTCAAGTCTGCTTTTATTATTTT	NA	NA	NA	NA
