The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034086	Methylocystis rosea strain GW6 chromosome, complete genome	3642720	7910	52019	3642720	transposase	Stx2-converting_phage(33.33%)	28	NA	NA
AZG75273.1|7910_8306_-|transposase	transposase	transposase	NA	NA	NA	NA
AZG78428.1|9016_10645_+	recombinase family protein	NA	R9TP69	Rhizobium_phage	47.1	1.4e-129
AZG75274.1|10941_11817_+	phosphoribulokinase	NA	NA	NA	NA	NA
AZG78429.1|11828_13832_+	transketolase	NA	NA	NA	NA	NA
AZG75275.1|13850_14933_+	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
AZG75276.1|14937_15618_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
AZG75277.1|16259_17846_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	47.9	4.4e-85
AZG75278.1|17842_18610_-	DUF2924 domain-containing protein	NA	NA	NA	NA	NA
AZG75279.1|19233_20022_+	DUF4261 domain-containing protein	NA	NA	NA	NA	NA
AZG75280.1|20018_20705_+	DUF1629 domain-containing protein	NA	NA	NA	NA	NA
AZG75281.1|20773_28435_+	DUF4214 domain-containing protein	NA	NA	NA	NA	NA
AZG75282.1|28866_31059_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	31.0	2.1e-45
AZG75283.1|31058_32552_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
AZG75284.1|32562_34044_+	channel protein TolC	NA	NA	NA	NA	NA
AZG78430.1|34750_36046_-	cytochrome P450	NA	I6WI04	Cotesia_sesamiae_Mombasa_bracovirus	23.2	2.0e-14
AZG75285.1|36068_36722_-	hypothetical protein	NA	NA	NA	NA	NA
AZG75286.1|36800_37583_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AZG75287.1|38155_38506_+	hypothetical protein	NA	NA	NA	NA	NA
AZG75288.1|39297_39534_+	hypothetical protein	NA	NA	NA	NA	NA
AZG75289.1|39700_40654_-	hypothetical protein	NA	NA	NA	NA	NA
AZG75290.1|43732_43990_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78431.1|44393_44918_+	hypothetical protein	NA	NA	NA	NA	NA
AZG75291.1|45349_45745_+	cupin domain-containing protein	NA	Q2I8C5	Bacillus_phage	46.3	7.0e-24
AZG75292.1|46302_47835_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	41.2	2.1e-108
AZG75293.1|47904_48261_-|transposase	transposase	transposase	S5VXZ8	Leptospira_phage	29.9	9.5e-12
AZG75294.1|48257_48719_-|transposase	transposase	transposase	NA	NA	NA	NA
AZG75295.1|49990_51598_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	43.5	9.6e-104
AZG75296.1|51671_52019_-|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	54.7	2.2e-29
>prophage 2
CP034086	Methylocystis rosea strain GW6 chromosome, complete genome	3642720	279110	292741	3642720	protease,capsid,tail,head	Paracoccus_phage(40.0%)	15	NA	NA
AZG75476.1|279110_279722_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	46.0	3.4e-33
AZG75477.1|279891_281487_-	DUF2793 domain-containing protein	NA	A0A0B5A0F6	Paracoccus_phage	35.6	3.0e-25
AZG75478.1|281495_285374_-	hypothetical protein	NA	A0A0B5A7K5	Paracoccus_phage	40.2	1.8e-225
AZG75479.1|285508_285940_-	peptidase P60	NA	F4YXU4	Roseobacter_phage	43.1	2.4e-25
AZG75480.1|285936_286827_-	DUF2163 domain-containing protein	NA	A0A1V0DY93	Dinoroseobacter_phage	40.7	1.3e-57
AZG75481.1|286954_287593_-	TIGR02217 family protein	NA	A0A0B5A2K3	Paracoccus_phage	51.4	8.9e-53
AZG75482.1|287608_288202_-|tail	phage tail tape measure protein	tail	K7RVL7	Vibrio_phage	42.1	4.0e-07
AZG78449.1|288198_288372_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
AZG75483.1|288434_288791_-	gene transfer agent family protein	NA	NA	NA	NA	NA
AZG78450.1|288951_289359_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
AZG75484.1|289371_289779_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
AZG75485.1|289789_290116_-|head,tail	head-tail adaptor protein	head,tail	A0A0K1LLK9	Bacillus_phage	32.3	4.6e-05
AZG75486.1|290112_290688_-	hypothetical protein	NA	NA	NA	NA	NA
AZG75487.1|290758_291985_-|capsid	phage major capsid protein	capsid	Q3HQT0	Burkholderia_phage	40.9	1.1e-78
AZG75488.1|292138_292741_-|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	50.7	1.5e-30
>prophage 3
CP034086	Methylocystis rosea strain GW6 chromosome, complete genome	3642720	1527275	1580051	3642720	protease,transposase,tRNA	uncultured_Mediterranean_phage(35.71%)	52	NA	NA
AZG76566.1|1527275_1528655_-	LysM peptidoglycan-binding domain-containing protein	NA	Q8SBN9	Clostridium_phage	37.4	1.4e-15
AZG76567.1|1528768_1529455_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1J0MC50	Streptomyces_phage	31.5	3.2e-08
AZG76568.1|1529451_1530225_-	5'/3'-nucleotidase SurE	NA	NA	NA	NA	NA
AZG76569.1|1530305_1530854_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
AZG76570.1|1530791_1532177_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.8	1.0e-106
AZG76571.1|1532332_1533118_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	44.8	3.0e-50
AZG76572.1|1533114_1533546_-	preprotein translocase subunit TatA	NA	NA	NA	NA	NA
AZG76573.1|1533702_1533939_-	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
AZG76574.1|1534104_1534860_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	45.1	1.8e-44
AZG76575.1|1534884_1535691_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	35.8	2.2e-32
AZG76576.1|1535820_1536231_-	PIN domain-containing protein	NA	NA	NA	NA	NA
AZG76577.1|1536227_1536479_-	hypothetical protein	NA	NA	NA	NA	NA
AZG76578.1|1536519_1537527_-	beta-N-acetylhexosaminidase	NA	A0A1B1IVS3	uncultured_Mediterranean_phage	43.2	1.5e-25
AZG76579.1|1537536_1538850_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
AZG76580.1|1538937_1540719_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
AZG78551.1|1540820_1542119_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
AZG76581.1|1542306_1542645_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	42.7	2.3e-15
AZG76582.1|1542731_1543640_+	sugar kinase	NA	NA	NA	NA	NA
AZG76583.1|1544259_1544595_+	hypothetical protein	NA	NA	NA	NA	NA
AZG76584.1|1544793_1545087_+	hypothetical protein	NA	NA	NA	NA	NA
AZG76585.1|1545542_1546379_+	hypothetical protein	NA	NA	NA	NA	NA
AZG76586.1|1546403_1547597_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
AZG76587.1|1547796_1548279_+	hypothetical protein	NA	NA	NA	NA	NA
AZG76588.1|1548340_1548805_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
AZG76589.1|1548808_1549222_-|protease	Zn-dependent protease	protease	NA	NA	NA	NA
AZG76590.1|1549312_1549609_+	hypothetical protein	NA	NA	NA	NA	NA
AZG76591.1|1550173_1551586_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
AZG76592.1|1551868_1552870_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AZG76593.1|1552869_1553283_+	VOC family protein	NA	NA	NA	NA	NA
AZG76594.1|1553341_1553728_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AZG76595.1|1553963_1554359_+	hypothetical protein	NA	NA	NA	NA	NA
AZG76596.1|1554391_1554619_-	dodecin domain-containing protein	NA	NA	NA	NA	NA
AZG76597.1|1554695_1556204_-	YcjX family protein	NA	NA	NA	NA	NA
AZG76598.1|1556363_1557650_-	citrate synthase	NA	NA	NA	NA	NA
AZG78552.1|1557962_1559387_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
AZG76599.1|1559605_1560316_+	transcriptional repressor LexA	NA	A0A2K9V3G4	Faecalibacterium_phage	41.1	2.5e-11
AZG76600.1|1560428_1562693_-	ComEC family competence protein	NA	NA	NA	NA	NA
AZG76601.1|1562908_1563271_+	DUF983 domain-containing protein	NA	NA	NA	NA	NA
AZG76602.1|1563291_1565067_-	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
AZG76603.1|1565231_1565750_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AZG76604.1|1566066_1568184_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AZG78553.1|1568180_1568555_-	hypothetical protein	NA	NA	NA	NA	NA
AZG76605.1|1568551_1569757_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
AZG76606.1|1569759_1572117_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AZG76607.1|1572837_1573515_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AZG76608.1|1573511_1574882_+	sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.9	1.0e-05
AZG76609.1|1575281_1576814_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	41.2	2.1e-108
AZG76610.1|1576883_1577240_-|transposase	transposase	transposase	S5VXZ8	Leptospira_phage	29.9	9.5e-12
AZG76611.1|1577236_1577698_-|transposase	transposase	transposase	NA	NA	NA	NA
AZG76612.1|1577646_1578099_+	hypothetical protein	NA	NA	NA	NA	NA
AZG76613.1|1578095_1578449_+|transposase	transposase	transposase	S5VXZ8	Leptospira_phage	32.0	2.2e-13
AZG76614.1|1578518_1580051_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	40.1	1.5e-106
>prophage 4
CP034086	Methylocystis rosea strain GW6 chromosome, complete genome	3642720	3233346	3375607	3642720	integrase,protease,transposase,capsid,plate,tail	Ochrobactrum_phage(23.81%)	142	3341024:3341044	3351005:3351025
AZG78670.1|3233346_3235059_+|protease	serine protease	protease	A0A217EQY2	Bacillus_phage	37.3	2.4e-28
AZG78054.1|3235051_3235825_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AZG78055.1|3236146_3236629_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AZG78056.1|3236696_3237599_+	isoaspartyl peptidase/L-asparaginase	NA	NA	NA	NA	NA
AZG78057.1|3237701_3238028_-	hypothetical protein	NA	NA	NA	NA	NA
AZG78058.1|3238305_3240141_-	hypothetical protein	NA	A0A1B1IVF2	uncultured_Mediterranean_phage	31.2	1.3e-51
AZG78059.1|3240305_3240722_-	hypothetical protein	NA	NA	NA	NA	NA
AZG78060.1|3240943_3242104_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
AZG78671.1|3242326_3243931_+	adenosine deaminase	NA	NA	NA	NA	NA
AZG78061.1|3243927_3244077_-	lmo0937 family membrane protein	NA	NA	NA	NA	NA
AZG78062.1|3244109_3244442_-	HNS-dependent expression A	NA	NA	NA	NA	NA
AZG78063.1|3244546_3245338_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZG78064.1|3245413_3246283_-	xanthine dehydrogenase	NA	NA	NA	NA	NA
AZG78065.1|3246640_3247942_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
AZG78066.1|3247938_3249237_+	thiol oxidoreductase	NA	NA	NA	NA	NA
AZG78672.1|3249254_3251462_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AZG78067.1|3251524_3252460_-	hypothetical protein	NA	NA	NA	NA	NA
AZG78068.1|3252964_3254254_+	DUF4102 domain-containing protein	NA	A0A221SAN4	Ralstonia_phage	33.4	2.2e-42
AZG78069.1|3254343_3254922_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78070.1|3255051_3255306_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78071.1|3255540_3255756_-	hypothetical protein	NA	NA	NA	NA	NA
AZG78072.1|3257850_3258189_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AZG78073.1|3258992_3259880_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	56.8	2.7e-92
AZG78074.1|3259892_3260774_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
AZG78075.1|3260784_3261375_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A1D8EQH2	Escherichia_phage	44.8	3.4e-30
AZG78076.1|3261355_3262432_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	51.8	3.5e-94
AZG78077.1|3262264_3263371_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78078.1|3263462_3263675_+|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	44.0	3.9e-05
AZG78079.1|3264068_3264971_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
AZG78080.1|3266025_3266832_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78081.1|3267744_3270063_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78673.1|3270674_3270926_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78082.1|3271137_3271500_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78674.1|3271902_3272202_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78083.1|3272260_3273106_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZG78084.1|3274829_3275351_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78085.1|3275663_3276377_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AZG78086.1|3276441_3277278_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZG78087.1|3277310_3278273_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZG78088.1|3278604_3278886_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78089.1|3278882_3279098_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78090.1|3279141_3280674_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	41.2	2.1e-108
AZG78091.1|3280743_3281100_-|transposase	transposase	transposase	S5VXZ8	Leptospira_phage	29.9	9.5e-12
AZG78092.1|3281096_3281558_-|transposase	transposase	transposase	NA	NA	NA	NA
AZG78093.1|3282540_3283485_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78094.1|3283517_3283877_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZG78095.1|3283873_3284221_+|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	54.7	2.2e-29
AZG78096.1|3284294_3285902_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	43.5	9.6e-104
AZG78097.1|3286243_3287143_-	hypothetical protein	NA	NA	NA	NA	NA
AZG78098.1|3287139_3288015_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AZG78099.1|3288043_3289936_-	hypothetical protein	NA	NA	NA	NA	NA
AZG78100.1|3289907_3291326_-	hypothetical protein	NA	NA	NA	NA	NA
AZG78101.1|3291525_3294240_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78102.1|3294856_3296464_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	43.5	9.6e-104
AZG78103.1|3296537_3296885_-|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	54.7	2.2e-29
AZG78104.1|3296881_3297241_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZG78105.1|3302251_3302803_-	DUF721 domain-containing protein	NA	NA	NA	NA	NA
AZG78106.1|3302878_3303940_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AZG78107.1|3303962_3304229_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78108.1|3304247_3305744_-	glycerol kinase	NA	NA	NA	NA	NA
AZG78109.1|3305840_3306215_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78110.1|3306513_3306750_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
AZG78111.1|3306777_3307260_+	bacterioferritin	NA	NA	NA	NA	NA
AZG78112.1|3307315_3307933_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZG78113.1|3308120_3309011_+	UDP-2,3-diacylglucosamine diphosphatase	NA	A0A218MKA7	uncultured_virus	47.7	4.1e-64
AZG78114.1|3309010_3310111_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AZG78115.1|3310210_3310993_+	molybdopterin-synthase adenylyltransferase MoeB	NA	A0A1V0SAV8	Catovirus	24.8	2.4e-07
AZG78116.1|3310976_3311330_-	RidA family protein	NA	NA	NA	NA	NA
AZG78117.1|3311474_3312182_-	hypothetical protein	NA	NA	NA	NA	NA
AZG78118.1|3312371_3314273_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.7	1.4e-29
AZG78119.1|3314272_3315175_-	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
AZG78120.1|3315628_3316207_-	hypothetical protein	NA	NA	NA	NA	NA
AZG78121.1|3316403_3317396_-	aldo/keto reductase	NA	NA	NA	NA	NA
AZG78122.1|3318073_3318982_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78123.1|3319058_3319295_-	hypothetical protein	NA	NA	NA	NA	NA
AZG78124.1|3319295_3319715_-	mercury transporter MerT	NA	NA	NA	NA	NA
AZG78125.1|3319784_3320192_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AZG78126.1|3320813_3321161_-	hypothetical protein	NA	NA	NA	NA	NA
AZG78127.1|3321170_3321884_-	helix-turn-helix transcriptional regulator	NA	R9U2Q5	Rhizobium_phage	27.2	2.0e-08
AZG78128.1|3321926_3322289_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78129.1|3322420_3323269_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78130.1|3323272_3325390_+|integrase	integrase	integrase	M4T586	Rhodobacter_phage	39.6	1.3e-132
AZG78131.1|3325506_3326310_+	ATP-binding protein	NA	M4SPU5	Rhodobacter_phage	40.1	3.9e-37
AZG78132.1|3326309_3326573_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78133.1|3326569_3327190_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78675.1|3327273_3327609_+	transcriptional regulator	NA	NA	NA	NA	NA
AZG78134.1|3327601_3328009_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78135.1|3327912_3328842_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78136.1|3328819_3329350_+	host-nuclease inhibitor protein Gam	NA	G8GWC4	Rhodobacter_phage	46.5	3.8e-33
AZG78137.1|3329346_3329544_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78138.1|3329540_3329735_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78139.1|3329731_3330415_+	regulatory protein GemA	NA	NA	NA	NA	NA
AZG78140.1|3330414_3330675_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78141.1|3330671_3330893_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78142.1|3330999_3331809_+	hypothetical protein	NA	A0A076GD02	Sinorhizobium_phage	40.0	5.1e-29
AZG78143.1|3331805_3332222_+	hypothetical protein	NA	A0A219VHE2	Ochrobactrum_phage	40.5	3.2e-19
AZG78144.1|3332328_3333309_+	hypothetical protein	NA	A0A219VHE4	Ochrobactrum_phage	40.5	6.0e-24
AZG78145.1|3333367_3334144_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78146.1|3334381_3334783_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78147.1|3334779_3335079_+	hypothetical protein	NA	M4SPS4	Rhodobacter_phage	47.9	4.8e-17
AZG78148.1|3335080_3335659_+	DUF3486 family protein	NA	A0A219VH75	Ochrobactrum_phage	33.0	4.2e-17
AZG78149.1|3337274_3338960_+	DUF935 family protein	NA	A0A219VH73	Ochrobactrum_phage	40.3	2.2e-98
AZG78150.1|3338959_3340171_+	hypothetical protein	NA	A0A219VH74	Ochrobactrum_phage	37.6	3.2e-67
AZG78151.1|3340536_3341505_+	hypothetical protein	NA	A0A219VH76	Ochrobactrum_phage	30.1	2.5e-30
3341024:3341044	attL	AGCTTGCCGCCGCGCTCGGCG	NA	NA	NA	NA
AZG78152.1|3341542_3341917_+	DUF2190 domain-containing protein	NA	NA	NA	NA	NA
AZG78153.1|3341950_3342919_+|capsid	capsid protein	capsid	A0A219VH83	Ochrobactrum_phage	45.8	5.1e-76
AZG78154.1|3342931_3343207_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78155.1|3343377_3343611_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78156.1|3343610_3344078_+	DUF1320 domain-containing protein	NA	NA	NA	NA	NA
AZG78157.1|3344077_3344563_+	phage morphogenesis protein	NA	A0A1B0T6K4	Pelagibaca_phage	31.1	2.1e-09
AZG78158.1|3344559_3345081_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78159.1|3345077_3345734_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78160.1|3345745_3345979_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78161.1|3345990_3346389_+|integrase	integrase	integrase	A0A219VH96	Ochrobactrum_phage	29.8	3.0e-06
AZG78162.1|3346438_3347365_+|plate	baseplate assembly protein	plate	A0A0A8IKZ9	Aurantimonas_phage	51.0	9.2e-75
AZG78163.1|3347361_3348009_+|tail	phage tail protein I	tail	A0A0A8IL57	Aurantimonas_phage	42.0	4.7e-41
AZG78164.1|3348010_3350278_+	hypothetical protein	NA	A0A0A8ILB4	Aurantimonas_phage	40.8	1.4e-153
AZG78165.1|3350288_3350492_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78166.1|3351701_3352199_+	DUF4376 domain-containing protein	NA	A0A1S5R1J2	Pseudomonas_phage	45.3	1.8e-16
3351005:3351025	attR	AGCTTGCCGCCGCGCTCGGCG	NA	NA	NA	NA
AZG78167.1|3352195_3352573_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78168.1|3352475_3353204_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78169.1|3353200_3353683_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78170.1|3353684_3355376_+	hypothetical protein	NA	A0A0P1KKK5	Acinetobacter_phage	40.6	4.9e-74
AZG78171.1|3355488_3356763_+	hypothetical protein	NA	A0A219VHA7	Ochrobactrum_phage	35.2	4.9e-50
AZG78172.1|3356786_3357317_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78173.1|3357313_3357757_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78174.1|3358005_3360195_+|tail	phage tail tape measure protein	tail	A0A2H4J8X5	uncultured_Caudovirales_phage	26.5	1.3e-10
AZG78175.1|3360194_3360611_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78176.1|3360607_3360814_+|tail	phage tail protein	tail	NA	NA	NA	NA
AZG78177.1|3360823_3361846_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78178.1|3362033_3362846_+	DNA adenine methylase	NA	A0A219VHB5	Ochrobactrum_phage	57.0	5.2e-82
AZG78179.1|3363160_3366496_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78180.1|3367342_3367627_+	peptidoglycan-binding protein	NA	NA	NA	NA	NA
AZG78181.1|3367640_3368126_+	peptidoglycan-binding protein	NA	A0A2L0HNW5	Microbacterium_phage	35.9	8.4e-11
AZG78676.1|3368255_3368690_+	peptidoglycan-binding protein	NA	A0A0A0RNZ5	Bacillus_phage	50.0	4.7e-05
AZG78182.1|3368765_3369212_+	peptidoglycan-binding protein	NA	U5PWQ2	Bacillus_phage	30.1	3.1e-12
AZG78183.1|3369344_3370094_+	L,D-transpeptidase	NA	NA	NA	NA	NA
AZG78184.1|3371509_3372271_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78185.1|3372542_3372962_-	hypothetical protein	NA	NA	NA	NA	NA
AZG78186.1|3373119_3373773_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
AZG78677.1|3373917_3374757_+	cytochrome c	NA	NA	NA	NA	NA
AZG78678.1|3374758_3375607_-|protease	serine protease	protease	NA	NA	NA	NA
>prophage 1
CP034087	Methylocystis rosea strain GW6 plasmid pGW6_1, complete sequence	347969	80809	143430	347969	integrase,transposase	Streptococcus_phage(14.29%)	53	73220:73236	106168:106184
73220:73236	attL	CTCGGCGAGAACCTCGG	NA	NA	NA	NA
AZG78776.1|80809_82153_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	27.4	2.6e-30
AZG78777.1|82391_83510_+	preprotein translocase subunit Tim44	NA	NA	NA	NA	NA
AZG78778.1|83750_84038_+	co-chaperone GroES	NA	A0A221S4A8	uncultured_virus	49.5	3.7e-22
AZG78779.1|84085_85720_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	59.4	1.3e-172
AZG78780.1|85982_86213_+	WGR domain-containing protein	NA	NA	NA	NA	NA
AZG78781.1|86444_86825_+	VOC family protein	NA	NA	NA	NA	NA
AZG78782.1|87141_87333_-	hypothetical protein	NA	NA	NA	NA	NA
AZG78783.1|87711_87891_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78784.1|88178_89363_+	plasmid partitioning protein RepA	NA	A0A240F4U1	Ochrobactrum_phage	64.8	1.2e-140
AZG78785.1|89435_90428_+	plasmid partitioning protein RepB	NA	A0A240F4U0	Ochrobactrum_phage	45.0	3.1e-68
AZG78786.1|90579_91911_+	replication initiation protein RepC	NA	L7TKN6	Rhizobium_phage	27.8	1.0e-18
AZG78787.1|91951_92863_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	52.3	5.6e-32
AZG78788.1|92906_93173_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AZG78789.1|93169_93595_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
AZG78790.1|93748_94024_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AZG78791.1|94020_94458_+	plasmid maintenance toxin (PemK-like)	NA	NA	NA	NA	NA
AZG78792.1|94520_96338_-	DUF2786 domain-containing protein	NA	NA	NA	NA	NA
AZG78793.1|96467_97556_-|integrase	integrase	integrase	NA	NA	NA	NA
AZG78794.1|97972_99589_+	plasmid replication initiator-like protein	NA	M4T586	Rhodobacter_phage	24.4	6.9e-09
AZG78795.1|99581_100460_+	AAA family ATPase	NA	NA	NA	NA	NA
AZG78796.1|100408_101497_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78797.1|101798_102974_+	DUF1403 family protein	NA	NA	NA	NA	NA
AZG78798.1|102973_103753_+	SMC-Scp complex subunit ScpB	NA	NA	NA	NA	NA
AZG78799.1|103846_104269_+	invasion associated locus B family protein	NA	NA	NA	NA	NA
AZG78800.1|104304_104688_+|transposase	transposase	transposase	NA	NA	NA	NA
AZG78801.1|104684_104981_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78802.1|104943_107919_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	42.6	1.6e-229
106168:106184	attR	CTCGGCGAGAACCTCGG	NA	NA	NA	NA
AZG78803.1|108244_109537_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	55.9	2.9e-127
AZG78804.1|109839_111066_-	cation:proton antiporter	NA	NA	NA	NA	NA
AZG78805.1|111210_111984_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
AZG78806.1|111991_112429_-	EamA family transporter	NA	NA	NA	NA	NA
AZG78807.1|112484_113603_-	Na+-dependent transporter	NA	NA	NA	NA	NA
AZG78808.1|113668_114082_-	hypothetical protein	NA	NA	NA	NA	NA
AZG78809.1|114655_115573_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AZG78810.1|116173_116839_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AZG78811.1|116835_118140_+	hypothetical protein	NA	Q8QNA2	Ectocarpus_siliculosus_virus	25.1	2.6e-06
AZG78966.1|118659_120297_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
AZG78812.1|120381_121005_+	universal stress protein	NA	NA	NA	NA	NA
AZG78813.1|121011_122334_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AZG78814.1|122374_125437_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.2	3.1e-66
AZG78815.1|126060_127161_-	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.6	3.1e-21
AZG78816.1|127153_127828_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
AZG78817.1|127835_128615_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZG78818.1|128628_129306_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZG78819.1|129298_130123_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
AZG78820.1|130184_130547_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZG78967.1|131016_132066_+	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
AZG78821.1|133057_136813_+	efflux RND transporter periplasmic adaptor subunit	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	28.8	7.8e-72
AZG78822.1|137093_138206_-	hypothetical protein	NA	NA	NA	NA	NA
AZG78823.1|138393_138798_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78824.1|139505_139844_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78825.1|140127_140694_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78826.1|142605_143430_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 2
CP034087	Methylocystis rosea strain GW6 plasmid pGW6_1, complete sequence	347969	251361	331091	347969	transposase	Salmonella_phage(28.57%)	60	NA	NA
AZG78895.1|251361_252199_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
AZG78896.1|252373_252988_-	NYN domain-containing protein	NA	NA	NA	NA	NA
AZG78897.1|253976_254195_-	hypothetical protein	NA	NA	NA	NA	NA
AZG78898.1|254330_254606_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AZG78899.1|254602_255124_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZG78900.1|255366_256794_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	23.9	4.1e-13
AZG78901.1|257571_258003_-	hypothetical protein	NA	NA	NA	NA	NA
AZG78902.1|258029_258398_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AZG78903.1|258495_259005_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZG78904.1|259158_259386_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78905.1|259382_259652_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78974.1|260213_260435_-	hypothetical protein	NA	NA	NA	NA	NA
AZG78906.1|261203_262121_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
AZG78907.1|262888_264259_-	TolC family protein	NA	NA	NA	NA	NA
AZG78908.1|267178_267799_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78909.1|267927_268194_-	acyl carrier protein	NA	NA	NA	NA	NA
AZG78910.1|268190_269345_-	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
AZG78911.1|269341_270352_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
AZG78912.1|270345_271332_-	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
AZG78913.1|271328_273173_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	51.0	1.9e-135
AZG78914.1|274613_275993_+	universal stress protein	NA	NA	NA	NA	NA
AZG78915.1|276597_277065_-	hypothetical protein	NA	NA	NA	NA	NA
AZG78916.1|277387_279025_+	formylmethanofuran dehydrogenase subunit A	NA	NA	NA	NA	NA
AZG78917.1|279012_279207_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78975.1|279470_280079_+	formate dehydrogenase	NA	NA	NA	NA	NA
AZG78918.1|282215_282497_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78919.1|282604_284368_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
AZG78920.1|284852_285956_+	dihydroorotase	NA	NA	NA	NA	NA
AZG78921.1|285957_286821_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78922.1|287393_288929_+	acyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
AZG78923.1|289541_289868_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78924.1|290126_291764_+	formylmethanofuran dehydrogenase subunit A	NA	NA	NA	NA	NA
AZG78976.1|292588_292795_-	hypothetical protein	NA	NA	NA	NA	NA
AZG78925.1|292841_293117_-	hypothetical protein	NA	NA	NA	NA	NA
AZG78926.1|293563_294853_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	2.0e-14
AZG78977.1|295072_295978_-	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
AZG78927.1|296072_297347_-	crotonyl-CoA carboxylase/reductase	NA	NA	NA	NA	NA
AZG78928.1|297494_298133_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
AZG78929.1|298442_301052_-	DUF2309 domain-containing protein	NA	NA	NA	NA	NA
AZG78930.1|301071_302661_-	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
AZG78931.1|302762_303668_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZG78978.1|303673_304552_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZG78932.1|305036_306623_+	MFS transporter	NA	NA	NA	NA	NA
AZG78933.1|306622_308212_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
AZG78934.1|308267_309461_+	HlyD family secretion protein	NA	NA	NA	NA	NA
AZG78935.1|309544_310246_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78936.1|310641_311703_-	Na+-dependent transporter	NA	NA	NA	NA	NA
AZG78937.1|311828_312194_-	hypothetical protein	NA	NA	NA	NA	NA
AZG78938.1|312281_312662_-	peptidase	NA	NA	NA	NA	NA
AZG78939.1|312804_313134_-	hypothetical protein	NA	NA	NA	NA	NA
AZG78940.1|313480_317086_-	efflux RND transporter periplasmic adaptor subunit	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	32.1	4.1e-78
AZG78941.1|317344_317632_-	hypothetical protein	NA	NA	NA	NA	NA
AZG78942.1|317874_319218_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
AZG78943.1|319353_319575_-	hypothetical protein	NA	NA	NA	NA	NA
AZG78979.1|323122_323458_+	hypothetical protein	NA	NA	NA	NA	NA
AZG78980.1|323817_325734_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	R4TQL5	Phaeocystis_globosa_virus	43.1	1.4e-96
AZG78944.1|325746_326601_+	1-phosphofructokinase family hexose kinase	NA	NA	NA	NA	NA
AZG78945.1|326669_327665_+	DUF4158 domain-containing protein	NA	A0A1B0V7H9	Salmonella_phage	34.2	4.7e-40
AZG78946.1|327540_328839_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
AZG78947.1|328871_331091_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	46.2	6.7e-180
>prophage 1
CP034088	Methylocystis rosea strain GW6 plasmid pGW6_2, complete sequence	218994	9816	48830	218994	transposase,integrase	Stx2-converting_phage(16.67%)	34	42864:42879	50624:50639
AZG78988.1|9816_10164_+|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	54.7	2.2e-29
AZG78989.1|10237_11845_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	43.5	9.6e-104
AZG78990.1|11868_12708_-	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	34.2	4.7e-09
AZG78991.1|12724_14623_-	methylase	NA	NA	NA	NA	NA
AZG78992.1|14701_15706_-|integrase	integrase	integrase	A0A2K9VH72	Gordonia_phage	31.0	4.0e-15
AZG78993.1|15702_16617_-|integrase	integrase	integrase	D2XR58	Bacillus_phage	32.0	9.0e-06
AZG78994.1|16610_18170_-|integrase	integrase	integrase	A0A1L4BKH1	Thermus_phage	30.8	8.1e-07
AZG79143.1|18235_20887_-	hypothetical protein	NA	A0A076FMQ0	Aureococcus_anophage	22.2	2.7e-18
AZG78995.1|21109_21418_-	hypothetical protein	NA	NA	NA	NA	NA
AZG78996.1|21696_23760_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.8	2.5e-27
AZG78997.1|23799_24204_-	hypothetical protein	NA	NA	NA	NA	NA
AZG78998.1|24503_25148_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZG78999.1|25430_26756_+	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
AZG79000.1|26752_28207_+	hypothetical protein	NA	NA	NA	NA	NA
AZG79001.1|28411_29395_-	hypothetical protein	NA	A0A2R2Z336	Escherichia_phage	27.6	7.9e-08
AZG79002.1|29903_30575_-	hypothetical protein	NA	NA	NA	NA	NA
AZG79003.1|30574_31015_-	hypothetical protein	NA	NA	NA	NA	NA
AZG79004.1|31188_31806_-	hypothetical protein	NA	NA	NA	NA	NA
AZG79005.1|31802_32135_-	hypothetical protein	NA	NA	NA	NA	NA
AZG79144.1|32575_33139_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	35.4	2.1e-13
AZG79006.1|33122_33440_+	type VI secretion protein	NA	NA	NA	NA	NA
AZG79007.1|33439_33730_+	type VI secretion protein	NA	NA	NA	NA	NA
AZG79008.1|33739_36175_+	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
AZG79009.1|36164_36833_+	hypothetical protein	NA	NA	NA	NA	NA
AZG79010.1|36845_37562_+	type VI secretion protein	NA	NA	NA	NA	NA
AZG79011.1|37760_38855_+	type IV secretion system protein	NA	NA	NA	NA	NA
AZG79012.1|38860_39652_+	type VI secretion protein	NA	NA	NA	NA	NA
AZG79145.1|39681_40497_+	P-type conjugative transfer protein VirB9	NA	NA	NA	NA	NA
AZG79013.1|40513_41755_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
AZG79014.1|41732_42806_+	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
AZG79015.1|42821_45236_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
42864:42879	attL	GCCTGCGCCTTCTTCG	NA	NA	NA	NA
AZG79016.1|45685_46678_-|integrase	integrase	integrase	A0A1P8DJ76	Virus_Rctr85	29.4	3.1e-12
AZG79017.1|46674_47619_-|integrase	integrase	integrase	NA	NA	NA	NA
AZG79018.1|47615_48830_-|integrase	integrase	integrase	A0A2K9VF00	Mycobacterium_phage	29.9	9.4e-11
50624:50639	attR	GCCTGCGCCTTCTTCG	NA	NA	NA	NA
>prophage 2
CP034088	Methylocystis rosea strain GW6 plasmid pGW6_2, complete sequence	218994	100571	116175	218994	transposase	Stx2-converting_phage(50.0%)	14	NA	NA
AZG79057.1|100571_101033_+|transposase	transposase	transposase	NA	NA	NA	NA
AZG79058.1|101029_101386_+|transposase	transposase	transposase	NA	NA	NA	NA
AZG79059.1|101455_102988_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	41.2	2.1e-108
AZG79060.1|104805_105498_+	DUF1538 domain-containing protein	NA	NA	NA	NA	NA
AZG79061.1|105494_106223_+	DUF1538 domain-containing protein	NA	NA	NA	NA	NA
AZG79062.1|106228_106597_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
AZG79150.1|106888_107122_-	hypothetical protein	NA	NA	NA	NA	NA
AZG79063.1|107124_108735_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	41.1	3.8e-100
AZG79064.1|108833_109181_-|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	55.7	4.4e-30
AZG79065.1|109177_109555_-|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	46.6	7.0e-05
AZG79066.1|109747_111199_+|transposase	IS4 family transposase	transposase	Q9JMP3	Wolbachia_phage	32.6	4.7e-65
AZG79067.1|112528_112948_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	37.3	4.5e-13
AZG79068.1|112965_113298_-	hypothetical protein	NA	NA	NA	NA	NA
AZG79069.1|114513_116175_+|transposase	transposase	transposase	NA	NA	NA	NA
