The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034015	Shewanella livingstonensis strain LMG 19866 chromosome, complete genome	4839879	1580123	1587624	4839879		Staphylococcus_phage(50.0%)	7	NA	NA
AZG72517.1|1580123_1581791_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	29.5	2.7e-40
AZG72518.1|1582052_1583306_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.1	1.0e-100
AZG72519.1|1583421_1583871_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AZG72520.1|1583936_1585082_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	1.2e-47
AZG72521.1|1585145_1585805_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	31.5	4.3e-26
AZG72522.1|1585920_1587024_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	38.4	7.4e-63
AZG72523.1|1587147_1587624_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.0	1.6e-30
>prophage 2
CP034015	Shewanella livingstonensis strain LMG 19866 chromosome, complete genome	4839879	2082316	2092189	4839879		Faustovirus(14.29%)	9	NA	NA
AZG72885.1|2082316_2083531_+	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	30.8	2.6e-32
AZG72886.1|2083603_2083987_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.0	1.2e-52
AZG72887.1|2084001_2084325_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	40.2	1.7e-20
AZG72888.1|2084380_2084905_+	co-chaperone HscB	NA	NA	NA	NA	NA
AZG72889.1|2084973_2086833_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	40.2	5.5e-103
AZG72890.1|2086841_2087177_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AZG72891.1|2087348_2088245_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	35.8	1.6e-36
AZG72892.1|2088422_2088854_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.7e-18
AZG72893.1|2089660_2092189_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.2	8.2e-33
>prophage 3
CP034015	Shewanella livingstonensis strain LMG 19866 chromosome, complete genome	4839879	2925470	2987897	4839879	tRNA,transposase,integrase	Paenibacillus_phage(15.38%)	52	2917447:2917476	2941408:2941437
2917447:2917476	attL	AATGTGGCGGAGGGATAGGGATTTGAACCC	NA	NA	NA	NA
AZG73520.1|2925470_2926592_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AZG73521.1|2926588_2927509_-	hypothetical protein	NA	NA	NA	NA	NA
AZG73522.1|2927791_2928994_-|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	48.9	1.5e-109
AZG73523.1|2928979_2929072_+	CRISPR-associated DxTHG motif protein	NA	NA	NA	NA	NA
AZG73524.1|2929334_2930666_-	hypothetical protein	NA	NA	NA	NA	NA
AZG73525.1|2930934_2931270_-	hypothetical protein	NA	NA	NA	NA	NA
AZG73526.1|2931377_2932388_-	S9 family peptidase	NA	NA	NA	NA	NA
AZG73527.1|2933689_2935363_-	hypothetical protein	NA	NA	NA	NA	NA
AZG73528.1|2935349_2936540_-|integrase	site-specific integrase	integrase	Q774Z5	Bordetella_phage	26.0	9.2e-19
AZG73529.1|2936747_2936987_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZG73530.1|2937143_2937653_+	hypothetical protein	NA	NA	NA	NA	NA
AZG73531.1|2937810_2938221_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
AZG73532.1|2938676_2938982_+	hypothetical protein	NA	NA	NA	NA	NA
AZG73533.1|2939225_2939567_-	hypothetical protein	NA	NA	NA	NA	NA
AZG73534.1|2939992_2941324_-	hypothetical protein	NA	NA	NA	NA	NA
AZG73535.1|2941670_2942419_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	33.9	6.0e-16
2941408:2941437	attR	AATGTGGCGGAGGGATAGGGATTTGAACCC	NA	NA	NA	NA
AZG73536.1|2942678_2943581_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZG73537.1|2943795_2944455_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	45.4	7.8e-36
AZG73538.1|2944520_2944910_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	38.6	9.7e-18
AZG73539.1|2944929_2945286_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
AZG73540.1|2945282_2945588_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
AZG73541.1|2945581_2945920_+	TusE/DsrC/DsvC family sulfur relay protein	NA	NA	NA	NA	NA
AZG73542.1|2946420_2947707_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	42.9	1.1e-94
AZG73543.1|2947725_2948100_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	37.4	1.0e-08
AZG73544.1|2948092_2949424_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.6	3.7e-77
AZG73545.1|2949432_2950077_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AZG73546.1|2950088_2952737_-	DUF87 domain-containing protein	NA	A0A218M9A2	Mycobacterium_phage	47.2	3.4e-82
AZG73547.1|2953010_2953508_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
AZG73548.1|2953686_2954802_+	alanine dehydrogenase	NA	NA	NA	NA	NA
AZG73549.1|2955000_2957268_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	30.2	6.5e-13
AZG73550.1|2957490_2958705_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
AZG73551.1|2959008_2960274_-	sugar MFS transporter	NA	NA	NA	NA	NA
AZG73552.1|2960439_2962074_-	alpha-glucosidase	NA	NA	NA	NA	NA
AZG73553.1|2962580_2965298_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AZG73554.1|2965414_2966938_+	tryptophan 7-halogenase	NA	Q58MD8	Prochlorococcus_phage	30.3	3.6e-52
AZG73555.1|2967006_2968926_+	alpha-amylase	NA	NA	NA	NA	NA
AZG75186.1|2969102_2971013_+	alpha-amylase	NA	NA	NA	NA	NA
AZG73556.1|2971342_2971774_-	hypothetical protein	NA	NA	NA	NA	NA
AZG73557.1|2973827_2975141_-	coproporphyrinogen III oxidase family protein	NA	NA	NA	NA	NA
AZG73558.1|2975496_2975739_-	DUF2492 family protein	NA	NA	NA	NA	NA
AZG73559.1|2976010_2976235_-	hypothetical protein	NA	NA	NA	NA	NA
AZG73560.1|2976260_2977118_-	hypothetical protein	NA	NA	NA	NA	NA
AZG73561.1|2977597_2977852_+	hypothetical protein	NA	NA	NA	NA	NA
AZG73562.1|2978142_2978739_+|tRNA	tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY	tRNA	NA	NA	NA	NA
AZG73563.1|2978988_2979186_+	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
AZG73564.1|2981211_2981976_+	AAA family ATPase	NA	K4HZD4	Acidithiobacillus_phage	50.4	1.2e-56
AZG73565.1|2982671_2983421_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	33.9	6.0e-16
AZG73566.1|2983829_2984315_+	hypothetical protein	NA	NA	NA	NA	NA
AZG73567.1|2984355_2985123_+	hypothetical protein	NA	NA	NA	NA	NA
AZG73568.1|2985161_2985821_+	hypothetical protein	NA	NA	NA	NA	NA
AZG73569.1|2985859_2986270_+	hypothetical protein	NA	NA	NA	NA	NA
AZG73570.1|2986469_2987897_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 4
CP034015	Shewanella livingstonensis strain LMG 19866 chromosome, complete genome	4839879	3740722	3785393	4839879	transposase,integrase	Enterobacteria_phage(30.0%)	44	3750111:3750126	3763168:3763183
AZG74145.1|3740722_3742318_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	1.1e-70
AZG74146.1|3742401_3742749_-|transposase	transposase	transposase	S5VXZ8	Leptospira_phage	52.7	1.3e-21
AZG74147.1|3742742_3743072_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AZG74148.1|3743349_3743610_-	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
AZG74149.1|3743572_3743809_-	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
AZG74150.1|3743892_3744075_-	hypothetical protein	NA	NA	NA	NA	NA
AZG74151.1|3744071_3744584_-	hypothetical protein	NA	NA	NA	NA	NA
AZG74152.1|3744827_3745097_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
AZG74153.1|3745089_3745344_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
AZG75219.1|3745856_3746075_+	hypothetical protein	NA	NA	NA	NA	NA
AZG74154.1|3746354_3746609_+	hypothetical protein	NA	NA	NA	NA	NA
AZG74155.1|3746867_3747194_+	hypothetical protein	NA	NA	NA	NA	NA
AZG74156.1|3748269_3749583_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
AZG74157.1|3749582_3749864_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
3750111:3750126	attL	TGGTGACTAAATGTAT	NA	NA	NA	NA
AZG75220.1|3750374_3750566_+	hypothetical protein	NA	NA	NA	NA	NA
AZG74158.1|3750770_3751061_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZG74159.1|3751063_3752392_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
AZG74160.1|3752874_3753144_-	hypothetical protein	NA	NA	NA	NA	NA
AZG74161.1|3754038_3754515_+	hypothetical protein	NA	NA	NA	NA	NA
AZG74162.1|3754514_3756113_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AZG74163.1|3756105_3758997_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AZG74164.1|3759003_3760251_+	hypothetical protein	NA	NA	NA	NA	NA
AZG74165.1|3760606_3761773_+|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	27.9	1.5e-29
AZG74166.1|3761899_3763081_-	J domain-containing protein	NA	NA	NA	NA	NA
AZG74167.1|3763819_3764368_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.2	3.2e-51
3763168:3763183	attR	TGGTGACTAAATGTAT	NA	NA	NA	NA
AZG74168.1|3764364_3765243_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.6	7.5e-34
AZG74169.1|3765245_3766124_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.3	6.6e-107
AZG74170.1|3766207_3767287_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	51.2	6.1e-94
AZG74171.1|3767707_3769057_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AZG74172.1|3769508_3770396_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.8	2.4e-56
AZG74173.1|3770445_3771519_-	undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
AZG74174.1|3771666_3772746_-	undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
AZG74175.1|3772978_3774145_-	nucleotide sugar dehydrogenase	NA	O41091	Paramecium_bursaria_Chlorella_virus	55.8	2.6e-114
AZG74176.1|3774166_3774622_-	glycosyltransferase	NA	NA	NA	NA	NA
AZG74177.1|3774618_3775101_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AZG74178.1|3775290_3775503_-	hypothetical protein	NA	NA	NA	NA	NA
AZG74179.1|3775725_3776802_-	glycosyltransferase	NA	NA	NA	NA	NA
AZG74180.1|3776779_3778069_-	hypothetical protein	NA	NA	NA	NA	NA
AZG74181.1|3778139_3779201_-	glycosyltransferase	NA	NA	NA	NA	NA
AZG74182.1|3779227_3780832_-	hypothetical protein	NA	A0A1V0SKD7	Klosneuvirus	34.5	4.3e-19
AZG74183.1|3780990_3782430_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AZG74184.1|3782419_3783367_-	glycosyltransferase	NA	NA	NA	NA	NA
AZG74185.1|3783373_3783931_-	acyltransferase	NA	NA	NA	NA	NA
AZG74186.1|3783962_3785393_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 5
CP034015	Shewanella livingstonensis strain LMG 19866 chromosome, complete genome	4839879	4497897	4559878	4839879	tRNA,transposase,protease,integrase	Leptospira_phage(50.0%)	49	4521804:4521819	4566702:4566717
AZG74764.1|4497897_4498476_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AZG74765.1|4498699_4499755_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZG74766.1|4499861_4500323_+	DUF386 domain-containing protein	NA	NA	NA	NA	NA
AZG74767.1|4500727_4501651_+	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
AZG74768.1|4501733_4502138_-	DUF1850 domain-containing protein	NA	NA	NA	NA	NA
AZG75259.1|4502137_4504165_-	TRAP transporter permease	NA	NA	NA	NA	NA
AZG74769.1|4504297_4505251_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
AZG74770.1|4505592_4506870_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
AZG74771.1|4507099_4507744_+	DsbA family protein	NA	NA	NA	NA	NA
AZG74772.1|4507938_4508616_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AZG74773.1|4508858_4510793_+	radical SAM protein	NA	NA	NA	NA	NA
AZG74774.1|4511350_4511914_-	hypothetical protein	NA	NA	NA	NA	NA
AZG74775.1|4512019_4513150_-	hypothetical protein	NA	U5N3F3	Enterobacteria_phage	46.1	4.6e-84
AZG74776.1|4513941_4514508_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
AZG74777.1|4514924_4515359_+	cell division protein DedD	NA	A0MN56	Thermus_phage	45.1	1.3e-26
AZG74778.1|4515605_4516466_+	NAD(P)-dependent oxidoreductase	NA	A0A0P0C6S9	Ostreococcus_lucimarinus_virus	28.6	2.2e-06
AZG74779.1|4516539_4516980_+	hypothetical protein	NA	NA	NA	NA	NA
AZG74780.1|4517256_4518264_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AZG74781.1|4518689_4519151_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
AZG74782.1|4519672_4520140_-	hypothetical protein	NA	NA	NA	NA	NA
AZG74783.1|4520536_4521115_+	hypothetical protein	NA	NA	NA	NA	NA
AZG74784.1|4521211_4521886_+	hypothetical protein	NA	NA	NA	NA	NA
4521804:4521819	attL	TTGAAGGTGAAAATGG	NA	NA	NA	NA
AZG74785.1|4522027_4522996_-	hypothetical protein	NA	NA	NA	NA	NA
AZG74786.1|4523125_4523626_-	hypothetical protein	NA	NA	NA	NA	NA
AZG74787.1|4523622_4523928_-	hypothetical protein	NA	NA	NA	NA	NA
AZG74788.1|4524108_4525649_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AZG74789.1|4525977_4528662_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AZG74790.1|4528746_4531581_-	hypothetical protein	NA	NA	NA	NA	NA
AZG74791.1|4531989_4532196_-	hypothetical protein	NA	NA	NA	NA	NA
AZG74792.1|4532501_4533710_+	potassium/proton antiporter	NA	NA	NA	NA	NA
AZG74793.1|4533771_4534989_-	M56 family peptidase	NA	NA	NA	NA	NA
AZG74794.1|4534988_4535363_-	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
AZG74795.1|4535783_4536041_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZG74796.1|4536040_4537267_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
AZG74797.1|4537431_4540620_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	24.4	2.8e-70
AZG75260.1|4540636_4541602_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AZG75261.1|4542051_4542462_-	hypothetical protein	NA	NA	NA	NA	NA
AZG74798.1|4542506_4542683_-	DUF3012 domain-containing protein	NA	NA	NA	NA	NA
AZG74799.1|4542847_4543213_-	STAS/SEC14 domain-containing protein	NA	NA	NA	NA	NA
AZG74800.1|4544129_4544543_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AZG74801.1|4545740_4546454_-	hypothetical protein	NA	NA	NA	NA	NA
AZG74802.1|4546440_4546953_-	hypothetical protein	NA	NA	NA	NA	NA
AZG74803.1|4549612_4550122_+	hypothetical protein	NA	NA	NA	NA	NA
AZG74804.1|4550173_4551460_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AZG74805.1|4552478_4552778_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZG74806.1|4552774_4553119_+|transposase	transposase	transposase	S5VXZ8	Leptospira_phage	45.2	3.1e-20
AZG74807.1|4553209_4554712_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	38.6	1.9e-77
AZG74808.1|4554715_4557511_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
AZG74809.1|4558483_4559878_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
4566702:4566717	attR	TTGAAGGTGAAAATGG	NA	NA	NA	NA
