The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034053	Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 chromosome, complete genome	5284191	2727610	2738497	5284191		Escherichia_phage(87.5%)	9	NA	NA
AZG59743.1|2727610_2730718_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AZG59744.1|2730772_2732038_+	MFS transporter	NA	NA	NA	NA	NA
AZG59745.1|2732068_2733157_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	99.7	3.0e-210
AZG59746.1|2733243_2733504_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
AZG62088.1|2733801_2734662_+	class A beta-lactamase SHV-28	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
AZG59747.1|2734682_2735444_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AZG59748.1|2735704_2736607_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AZG59749.1|2736618_2737884_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	1.1e-232
AZG59750.1|2737876_2738497_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 2
CP034053	Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 chromosome, complete genome	5284191	3145103	3191930	5284191	portal,tail,plate,capsid,terminase,tRNA,integrase,transposase,head	Enterobacteria_phage(52.78%)	57	3150327:3150348	3188192:3188213
AZG60110.1|3145103_3145604_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
AZG60111.1|3145720_3146167_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AZG62106.1|3146150_3146942_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZG60112.1|3147043_3148228_+	MFS transporter	NA	NA	NA	NA	NA
AZG60113.1|3148259_3148952_-	hypothetical protein	NA	NA	NA	NA	NA
AZG60114.1|3149097_3149607_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AZG62107.1|3149593_3149950_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AZG60115.1|3149939_3150179_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
3150327:3150348	attL	CGCCCCCGACGGGGCTTTTTTT	NA	NA	NA	NA
AZG62108.1|3150443_3150695_-	hypothetical protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
AZG60116.1|3150738_3151878_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	70.5	3.0e-144
AZG60117.1|3152032_3153205_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.5	1.1e-157
AZG60118.1|3153204_3153720_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
AZG60119.1|3153765_3154083_+|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	54.8	1.0e-17
AZG62109.1|3154082_3154241_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
AZG60120.1|3154227_3157203_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.6	1.8e-220
AZG60121.1|3157218_3157710_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.7	2.1e-54
AZG60122.1|3157954_3159313_+	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	28.7	7.5e-49
AZG60123.1|3159512_3160544_-|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
AZG60124.1|3160627_3161719_-|tail	phage tail protein	tail	G4KKN6	Yersinia_phage	47.8	5.2e-08
AZG60125.1|3161718_3161931_-	hypothetical protein	NA	NA	NA	NA	NA
AZG60126.1|3161927_3164954_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
AZG60127.1|3164943_3165867_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	44.6	6.9e-54
AZG60128.1|3165868_3166219_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	54.8	9.3e-28
AZG60129.1|3166215_3166803_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.5	6.9e-60
AZG60130.1|3166799_3167435_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.9	4.6e-57
AZG60131.1|3167431_3167899_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.8	4.5e-46
AZG60132.1|3167899_3168163_-	peptidase	NA	B6SD31	Bacteriophage	34.5	3.7e-05
AZG60133.1|3168080_3168410_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AZG60134.1|3168421_3168967_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	44.1	9.7e-32
AZG60135.1|3168963_3169248_-|tail	phage tail protein	tail	NA	NA	NA	NA
AZG60136.1|3169238_3169439_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
AZG60137.1|3169438_3169954_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	49.4	3.1e-40
AZG60138.1|3170058_3170925_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	57.3	8.4e-70
AZG60139.1|3170974_3172009_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	8.1e-96
AZG60140.1|3172019_3172859_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.9	1.6e-94
AZG60141.1|3173015_3174743_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	68.1	6.9e-233
AZG60142.1|3174736_3175798_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.4	1.0e-141
AZG62110.1|3177949_3178957_-	hypothetical protein	NA	NA	NA	NA	NA
AZG60143.1|3178949_3180896_-	DUF3696 domain-containing protein	NA	Q2P9X8	Enterobacteria_phage	39.6	3.4e-18
AZG60144.1|3181153_3183301_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	63.6	2.4e-243
AZG60145.1|3183338_3184274_-	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	55.9	1.9e-83
AZG60146.1|3184270_3184498_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	41.0	1.9e-05
AZG60147.1|3184506_3185073_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	9.5e-14
AZG60148.1|3185069_3185294_-	hypothetical protein	NA	NA	NA	NA	NA
AZG60149.1|3185371_3185635_-	hypothetical protein	NA	NA	NA	NA	NA
AZG60150.1|3185650_3186028_-	hypothetical protein	NA	NA	NA	NA	NA
AZG60151.1|3186043_3186262_-	DUF4761 domain-containing protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
AZG60152.1|3186282_3186561_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
AZG60153.1|3186681_3186981_+	XRE family transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	6.5e-38
AZG60154.1|3187096_3188080_+|integrase	integrase	integrase	Q83VS6	Escherichia_phage	80.1	6.4e-151
AZG60155.1|3188344_3189358_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
3188192:3188213	attR	CGCCCCCGACGGGGCTTTTTTT	NA	NA	NA	NA
AZG60156.1|3189415_3189517_+	hypothetical protein	NA	NA	NA	NA	NA
AZG62111.1|3189516_3189591_+	protein YoaJ	NA	NA	NA	NA	NA
AZG60157.1|3189708_3189834_+	hypothetical protein	NA	NA	NA	NA	NA
AZG60158.1|3189893_3190157_-	DUF2534 family protein	NA	NA	NA	NA	NA
AZG60159.1|3190287_3190926_-	leucine efflux protein	NA	NA	NA	NA	NA
AZG60160.1|3191015_3191930_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.0	3.2e-72
>prophage 3
CP034053	Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 chromosome, complete genome	5284191	3471097	3480560	5284191	tRNA,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
AZG60395.1|3471097_3472819_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	2.0e-14
AZG60396.1|3472863_3473565_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AZG60397.1|3473918_3474137_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AZG60398.1|3474256_3476536_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AZG60399.1|3476566_3476884_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AZG60400.1|3477209_3477431_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AZG60401.1|3477507_3479448_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AZG60402.1|3479444_3480560_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 1
CP034054	Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed1, complete sequence	299188	130093	198043	299188	transposase	Salmonella_phage(16.67%)	73	NA	NA
AZG62331.1|130093_130414_+	hypothetical protein	NA	J9Q750	Salmonella_phage	50.9	2.2e-28
AZG62332.1|130494_130809_+	hypothetical protein	NA	NA	NA	NA	NA
AZG62333.1|130929_131181_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	76.7	1.9e-22
AZG62334.1|131346_131565_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	66.7	4.4e-20
AZG62335.1|131657_132155_+	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	67.1	2.0e-23
AZG62336.1|132151_132340_+	hypothetical protein	NA	NA	NA	NA	NA
AZG62337.1|132817_133045_+	hypothetical protein	NA	A9YWV3	Burkholderia_phage	48.1	2.5e-10
AZG62338.1|133041_133686_+	hypothetical protein	NA	A0A125RNQ8	Pseudomonas_phage	51.6	5.4e-05
AZG62339.1|133686_134010_+	hypothetical protein	NA	E5AGF3	Erwinia_phage	46.9	1.6e-13
AZG62340.1|134101_134488_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	85.1	3.7e-17
AZG62341.1|134814_135030_+	hypothetical protein	NA	NA	NA	NA	NA
AZG62342.1|135076_135580_+	hypothetical protein	NA	A0A1V0E5L6	Salmonella_phage	66.2	2.8e-25
AZG62494.1|135610_136126_+	DUF262 domain-containing protein	NA	A0A2H4FWH2	Salmonella_phage	68.2	2.4e-64
AZG62343.1|136532_136745_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
AZG62344.1|137945_138428_+	hypothetical protein	NA	A0A077SLK5	Escherichia_phage	58.3	4.4e-12
AZG62495.1|138511_139108_+	DUF551 domain-containing protein	NA	A0A0S1S1U7	Klebsiella_phage	94.1	2.4e-20
AZG62345.1|139110_139305_+	hypothetical protein	NA	NA	NA	NA	NA
AZG62346.1|139606_139813_+	hypothetical protein	NA	NA	NA	NA	NA
AZG62347.1|139896_140169_+	hypothetical protein	NA	I7B2L9	Escherichia_phage	48.9	1.5e-12
AZG62348.1|140449_140737_+	hypothetical protein	NA	NA	NA	NA	NA
AZG62349.1|141355_141595_+	DUF1819 family protein	NA	NA	NA	NA	NA
AZG62350.1|142826_143858_-|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
AZG62351.1|143870_145118_+	hypothetical protein	NA	NA	NA	NA	NA
AZG62352.1|145168_145474_-	hypothetical protein	NA	NA	NA	NA	NA
AZG62353.1|146362_146719_+	hypothetical protein	NA	NA	NA	NA	NA
AZG62354.1|146870_150212_+	viral (Super1) RNA helicase	NA	NA	NA	NA	NA
AZG62355.1|150960_152574_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	1.8e-182
AZG62356.1|152604_152955_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AZG62357.1|152951_153377_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
AZG62358.1|153767_154496_+	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AZG62359.1|154512_154824_+	hypothetical protein	NA	NA	NA	NA	NA
AZG62360.1|154837_155179_+	hypothetical protein	NA	NA	NA	NA	NA
AZG62361.1|155238_156195_+	thioredoxin	NA	NA	NA	NA	NA
AZG62362.1|156424_157381_+	hypothetical protein	NA	NA	NA	NA	NA
AZG62363.1|157498_158014_+	hypothetical protein	NA	NA	NA	NA	NA
AZG62364.1|158016_158619_+	hypothetical protein	NA	NA	NA	NA	NA
AZG62365.1|158892_159549_-	hypothetical protein	NA	NA	NA	NA	NA
AZG62496.1|159578_160019_-	hypothetical protein	NA	NA	NA	NA	NA
AZG62366.1|160008_160518_-	hypothetical protein	NA	NA	NA	NA	NA
AZG62367.1|160526_160841_-	hypothetical protein	NA	NA	NA	NA	NA
AZG62368.1|161047_162451_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
AZG62497.1|162479_163112_-	hypothetical protein	NA	NA	NA	NA	NA
AZG62369.1|165343_166366_-	porphobilinogen synthase	NA	NA	NA	NA	NA
AZG62370.1|166429_167776_-	dihydroorotase	NA	NA	NA	NA	NA
AZG62371.1|167772_168624_-	hypothetical protein	NA	NA	NA	NA	NA
AZG62372.1|168616_169618_-	TGS domain-containing protein	NA	A0A2K9L6B6	Tupanvirus	41.5	9.7e-54
AZG62373.1|170047_170872_+	DUF1460 domain-containing protein	NA	NA	NA	NA	NA
AZG62374.1|170888_171818_-	isocitrate dehydrogenase	NA	A0A140B3P3	Vibrio_phage	25.2	1.5e-11
AZG62375.1|171884_172445_-	carbonate dehydratase	NA	NA	NA	NA	NA
AZG62376.1|172434_173370_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
AZG62377.1|173433_173856_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
AZG62378.1|173926_175126_-	cobalamin biosynthesis protein CobW	NA	NA	NA	NA	NA
AZG62379.1|175223_175676_+	transcriptional repressor	NA	NA	NA	NA	NA
AZG62380.1|177207_178338_+	thioredoxin reductase	NA	NA	NA	NA	NA
AZG62381.1|178348_179998_+	ferrous iron transporter B	NA	NA	NA	NA	NA
AZG62382.1|180000_180207_+	hypothetical protein	NA	NA	NA	NA	NA
AZG62383.1|180266_181487_-	GTP-binding protein	NA	NA	NA	NA	NA
AZG62384.1|181523_181925_-	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
AZG62385.1|182069_182399_+	hypothetical protein	NA	NA	NA	NA	NA
AZG62386.1|183428_183899_-	RES domain-containing protein	NA	NA	NA	NA	NA
AZG62387.1|183895_184339_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
AZG62388.1|184439_185711_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	58.3	3.9e-140
AZG62389.1|185710_186133_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.3	6.3e-31
AZG62390.1|187708_188131_+|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	56.8	4.7e-34
AZG62498.1|189075_189867_-	CRISPR-associated protein Csf2	NA	NA	NA	NA	NA
AZG62391.1|190111_190819_-	hypothetical protein	NA	NA	NA	NA	NA
AZG62392.1|190812_192687_-	DEAD/DEAH box helicase	NA	A0A127AW80	Bacillus_phage	25.6	1.5e-10
AZG62393.1|192689_193256_-	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
AZG62394.1|193258_194050_-	hypothetical protein	NA	NA	NA	NA	NA
AZG62395.1|194112_194526_-	NB-ARC domain protein	NA	NA	NA	NA	NA
AZG62396.1|195102_196107_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AZG62397.1|196477_196888_-	hypothetical protein	NA	NA	NA	NA	NA
AZG62398.1|197119_198043_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	92.8	1.7e-166
>prophage 1
CP034055	Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed2, complete sequence	113131	0	79423	113131	capsid,terminase,integrase,tail	Salmonella_phage(88.89%)	85	13485:13502	23703:23720
AZG62506.1|0_1098_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	52.9	1.9e-74
AZG62507.1|1549_1762_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	78.6	4.7e-27
AZG62508.1|1761_2097_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	66.7	8.0e-37
AZG62509.1|2093_2273_-	hypothetical protein	NA	NA	NA	NA	NA
AZG62510.1|2806_5149_-	recombinase RecA	NA	J9Q736	Salmonella_phage	83.8	3.3e-28
AZG62511.1|5151_5418_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	84.1	1.7e-34
AZG62512.1|5417_6362_-	exonuclease	NA	J9Q7S6	Salmonella_phage	93.3	1.1e-171
AZG62513.1|6422_7430_-	regulator	NA	J9Q7Z3	Salmonella_phage	88.0	6.0e-144
AZG62514.1|7549_7981_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	90.9	9.0e-65
AZG62515.1|8127_8427_-	hypothetical protein	NA	NA	NA	NA	NA
AZG62516.1|8437_8857_-	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	62.6	6.3e-47
AZG62517.1|9057_9501_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	83.0	7.6e-59
AZG62518.1|9497_10667_-	uracil-DNA glycosylase	NA	J9Q7Z2	Salmonella_phage	92.8	5.2e-208
AZG62519.1|10688_11390_-	hypothetical protein	NA	S5YLC4	Mycobacterium_phage	37.6	7.6e-21
AZG62520.1|11386_13750_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	87.0	0.0e+00
13485:13502	attL	AATGATTCCATACATCCA	NA	NA	NA	NA
AZG62521.1|13724_13928_-	hypothetical protein	NA	J9Q6I7	Salmonella_phage	80.6	7.2e-25
AZG62522.1|13930_15163_-	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	86.6	1.6e-212
AZG62523.1|15259_17545_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	62.9	8.8e-244
AZG62524.1|18146_18527_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZG62525.1|18521_19622_-|integrase	integrase	integrase	A0A1P8DTG6	Proteus_phage	28.4	1.6e-17
AZG62526.1|19971_20331_+	hypothetical protein	NA	NA	NA	NA	NA
AZG62527.1|20395_20806_-	toxin YafO	NA	NA	NA	NA	NA
AZG62528.1|20815_21433_-	hypothetical protein	NA	NA	NA	NA	NA
AZG62529.1|21527_21773_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	47.4	9.1e-14
AZG62530.1|21769_22156_-	hypothetical protein	NA	Q716B1	Shigella_phage	71.2	1.9e-45
AZG62531.1|22165_22978_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	66.1	8.1e-91
AZG62532.1|24268_24571_-	C-type natriuretic protein	NA	J9Q7S1	Salmonella_phage	63.5	7.5e-26
23703:23720	attR	TGGATGTATGGAATCATT	NA	NA	NA	NA
AZG62533.1|24567_24720_-	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	82.0	1.6e-16
AZG62534.1|24964_25432_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	63.9	3.4e-49
AZG62535.1|25511_26300_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	51.1	6.9e-71
AZG62536.1|26592_27759_+	hypothetical protein	NA	NA	NA	NA	NA
AZG62537.1|27798_28905_-	DNA primase	NA	J9Q720	Salmonella_phage	90.2	3.5e-198
AZG62538.1|29057_30398_-	DNA helicase	NA	J9Q7G4	Salmonella_phage	96.0	5.4e-241
AZG62539.1|30462_31188_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	88.4	9.6e-128
AZG62540.1|31432_32218_+	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	24.8	1.8e-07
AZG62541.1|32263_32626_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.5e-44
AZG62542.1|32625_33291_-	plasmid stability protein	NA	J9Q7R7	Salmonella_phage	83.7	2.9e-102
AZG62543.1|33475_34225_-	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	31.3	2.7e-16
AZG62544.1|34209_34602_-	hypothetical protein	NA	A0A077SLR3	Escherichia_phage	42.2	1.0e-14
AZG62545.1|34876_35068_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	66.7	2.3e-17
AZG62546.1|35018_35270_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	73.5	2.0e-24
AZG62547.1|35272_35965_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	89.1	4.6e-119
AZG62548.1|35978_36302_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	95.3	2.3e-49
AZG62549.1|36392_37838_-|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	38.6	1.0e-40
AZG62550.1|37960_50095_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	60.7	3.1e-29
AZG62551.1|50111_50723_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	73.9	4.5e-78
AZG62552.1|50710_51508_-|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	85.3	5.4e-140
AZG62553.1|51500_52199_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	87.4	1.2e-122
AZG62554.1|52285_52621_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	84.5	3.4e-51
AZG62555.1|52664_57209_-|tail	phage tail tape measure protein	tail	J9Q712	Salmonella_phage	68.8	0.0e+00
AZG62618.1|57216_57450_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.5	3.4e-34
AZG62556.1|57566_57884_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	92.4	2.4e-46
AZG62557.1|57945_58692_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	83.0	3.7e-106
AZG62558.1|58759_59152_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	67.5	1.0e-46
AZG62559.1|59153_59627_-	hypothetical protein	NA	J9Q711	Salmonella_phage	93.6	1.9e-76
AZG62560.1|59617_59962_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	92.1	2.2e-53
AZG62561.1|60059_60893_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	83.4	4.8e-131
AZG62562.1|60892_61327_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	84.0	2.9e-63
AZG62563.1|61374_61803_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	82.4	6.0e-29
AZG62564.1|61881_62760_-|capsid	phage major capsid protein	capsid	J9Q710	Salmonella_phage	94.2	4.7e-153
AZG62565.1|62786_63686_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	82.6	1.0e-123
AZG62566.1|63708_65298_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	88.5	1.1e-274
AZG62567.1|65315_66572_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	97.4	9.4e-248
AZG62568.1|66574_67216_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	88.2	5.0e-96
AZG62569.1|67391_67658_-	hypothetical protein	NA	J9Q757	Salmonella_phage	90.9	1.3e-37
AZG62570.1|67667_68567_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	97.0	4.2e-165
AZG62571.1|68563_68818_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	95.2	7.7e-40
AZG62572.1|68810_69449_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	97.6	1.4e-109
AZG62573.1|69445_70114_-	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	91.4	1.9e-106
AZG62619.1|70113_70794_-	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	88.8	1.8e-107
AZG62574.1|70877_72437_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.9	1.2e-279
AZG62575.1|72439_72718_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	70.3	6.2e-27
AZG62576.1|72779_73319_+	hypothetical protein	NA	NA	NA	NA	NA
AZG62577.1|73465_74065_+	hypothetical protein	NA	NA	NA	NA	NA
AZG62578.1|74089_74446_+	hypothetical protein	NA	NA	NA	NA	NA
AZG62579.1|74495_75026_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	69.6	2.5e-56
AZG62580.1|75342_75993_+	hypothetical protein	NA	J9Q754	Salmonella_phage	91.7	1.9e-106
AZG62581.1|76040_76271_+	hypothetical protein	NA	NA	NA	NA	NA
AZG62582.1|76908_77391_-	hypothetical protein	NA	J9Q805	Salmonella_phage	70.0	1.4e-63
AZG62620.1|77403_77601_-	hypothetical protein	NA	NA	NA	NA	NA
AZG62583.1|77596_77878_-	ABC transporter	NA	J9Q753	Salmonella_phage	83.9	9.1e-42
AZG62584.1|78004_78412_-	hypothetical protein	NA	NA	NA	NA	NA
AZG62585.1|78531_78843_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	66.0	4.0e-30
AZG62586.1|78979_79192_-	hypothetical protein	NA	J9Q804	Salmonella_phage	74.3	7.6e-25
AZG62587.1|79204_79423_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	81.9	2.9e-27
>prophage 2
CP034055	Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed2, complete sequence	113131	83347	112810	113131		Salmonella_phage(80.77%)	29	NA	NA
AZG62589.1|83347_84904_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	3.1e-107
AZG62590.1|84900_86130_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AZG62622.1|86246_89363_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	23.8	7.8e-25
AZG62591.1|89424_89640_-	DNA modification methylase	NA	J9Q747	Salmonella_phage	69.8	1.2e-14
AZG62592.1|89768_90347_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	56.5	1.1e-54
AZG62593.1|90474_90630_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	61.2	1.7e-05
AZG62594.1|90629_91055_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	80.9	9.8e-56
AZG62595.1|91157_91346_-	hypothetical protein	NA	J9Q800	Salmonella_phage	52.5	3.3e-08
AZG62596.1|91342_91621_-	hypothetical protein	NA	NA	NA	NA	NA
AZG62597.1|91991_92642_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	79.6	4.2e-90
AZG62598.1|93215_93449_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	82.9	3.9e-30
AZG62599.1|94425_95343_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	90.7	8.5e-105
AZG62600.1|95480_96587_+	DUF697 domain-containing protein	NA	NA	NA	NA	NA
AZG62601.1|96625_97168_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	96.6	8.6e-97
AZG62602.1|97177_97597_-	hypothetical protein	NA	J9Q743	Salmonella_phage	97.8	1.9e-67
AZG62603.1|97660_98305_-	hypothetical protein	NA	J9Q7H4	Salmonella_phage	100.0	5.2e-117
AZG62604.1|98304_98781_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	99.4	2.6e-89
AZG62605.1|98777_99191_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	76.6	2.3e-54
AZG62606.1|99192_100296_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	80.1	6.7e-181
AZG62607.1|100489_101365_-	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	85.1	1.2e-140
AZG62608.1|101442_102585_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	95.8	9.0e-213
AZG62609.1|102715_105019_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	90.8	0.0e+00
AZG62610.1|105094_105664_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	91.0	2.9e-95
AZG62611.1|105673_106420_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	61.7	1.3e-79
AZG62612.1|106409_108326_-	exonuclease	NA	J9Q741	Salmonella_phage	84.5	3.6e-299
AZG62613.1|108322_108556_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	66.1	4.4e-18
AZG62614.1|108555_109641_-	exonuclease SbcCD subunit D	NA	J9Q7S9	Salmonella_phage	84.5	3.2e-183
AZG62615.1|110293_111853_+	DUF4041 domain-containing protein	NA	X5JAC1	Clostridium_phage	52.3	6.6e-57
AZG62616.1|112165_112810_-	hypothetical protein	NA	J9Q739	Salmonella_phage	80.7	4.9e-99
>prophage 1
CP034056	Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed3, complete sequence	89709	1796	48300	89709	protease,transposase	Escherichia_phage(31.25%)	46	NA	NA
AZG62625.1|1796_2450_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AZG62626.1|2542_2800_+	antitoxin PemI	NA	NA	NA	NA	NA
AZG62627.1|2801_3134_+	mRNA interferase PemK	NA	NA	NA	NA	NA
AZG62628.1|3270_6168_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
AZG62629.1|6262_6868_+	DNA resolvase	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
AZG62630.1|7644_8037_+	cysteine hydrolase	NA	NA	NA	NA	NA
AZG62631.1|8174_9059_+	EamA family transporter	NA	NA	NA	NA	NA
AZG62632.1|9090_10290_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AZG62633.1|10368_11046_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AZG62712.1|11077_11320_-	relaxase	NA	NA	NA	NA	NA
AZG62634.1|12941_13646_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZG62713.1|13789_14344_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AZG62714.1|14474_15305_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
AZG62635.1|15936_16641_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZG62636.1|16677_17217_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	4.0e-86
AZG62637.1|20075_20951_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
AZG62638.1|20997_21330_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AZG62639.1|23651_24356_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZG62640.1|24643_25504_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AZG62641.1|28264_28969_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AZG62642.1|28959_29100_+	hypothetical protein	NA	NA	NA	NA	NA
AZG62643.1|30910_31192_+	hypothetical protein	NA	NA	NA	NA	NA
AZG62715.1|31314_31665_-	protein stbB	NA	NA	NA	NA	NA
AZG62644.1|31667_32630_-	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
AZG62716.1|32776_33070_+	hypothetical protein	NA	NA	NA	NA	NA
AZG62645.1|33010_33190_-	hypothetical protein	NA	NA	NA	NA	NA
AZG62646.1|33146_33830_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	5.6e-29
AZG62647.1|33830_34052_+	hypothetical protein	NA	NA	NA	NA	NA
AZG62648.1|34065_34500_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AZG62649.1|35199_35772_+	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
AZG62650.1|35744_36170_+	antirestriction protein	NA	NA	NA	NA	NA
AZG62651.1|36216_36639_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AZG62652.1|36635_36827_+	hypothetical protein	NA	NA	NA	NA	NA
AZG62653.1|37864_38095_+	hypothetical protein	NA	NA	NA	NA	NA
AZG62654.1|38146_39508_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
AZG62655.1|39554_40118_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	4.7e-21
AZG62656.1|40028_40223_-	hypothetical protein	NA	NA	NA	NA	NA
AZG62657.1|40203_40665_-	hypothetical protein	NA	NA	NA	NA	NA
AZG62717.1|40821_40941_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AZG62658.1|40966_41494_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	6.0e-47
AZG62659.1|41551_41785_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AZG62660.1|43937_44372_+	protein PsiB	NA	NA	NA	NA	NA
AZG62661.1|44368_45088_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AZG62662.1|45883_46309_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
AZG62663.1|46305_46656_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AZG62664.1|46686_48300_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	1.8e-182
>prophage 1
CP034057	Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed4, complete sequence	54880	0	45756	54880	capsid,head,portal,terminase,tail	Klebsiella_phage(86.27%)	54	NA	NA
AZG62723.1|3669_4263_-|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	80.7	3.7e-85
AZG62724.1|4279_5107_-	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	44.0	2.3e-08
AZG62725.1|5153_5864_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	89.8	6.7e-134
AZG62726.1|5865_6621_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.1	6.7e-124
AZG62727.1|6617_6956_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	2.4e-57
AZG62728.1|6955_10312_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	87.2	0.0e+00
AZG62766.1|10311_10524_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	87.5	1.4e-31
AZG62729.1|10544_10910_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
AZG62730.1|10967_11429_-|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
AZG62731.1|11460_11862_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	1.7e-62
AZG62732.1|11858_12248_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
AZG62733.1|12228_12567_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
AZG62734.1|12563_12881_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
AZG62767.1|12861_13059_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	78.0	1.8e-20
AZG62735.1|13315_14602_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	84.8	5.4e-206
AZG62736.1|14679_15600_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	1.6e-148
AZG62737.1|15636_16896_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.0	2.1e-223
AZG62738.1|16895_17075_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	80.7	2.4e-16
AZG62739.1|17068_18778_-|terminase	terminase large subunit	terminase	Q6UAY0	Klebsiella_phage	95.1	0.0e+00
AZG62740.1|18812_19247_-|terminase	terminase	terminase	Q6UAY1	Klebsiella_phage	95.8	2.4e-73
AZG62768.1|19462_19663_-	hypothetical protein	NA	Q6UAR8	Klebsiella_phage	90.9	1.0e-10
AZG62741.1|19748_20180_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	60.6	2.6e-40
AZG62742.1|20176_20461_-	hypothetical protein	NA	Q6UAS1	Klebsiella_phage	37.5	3.1e-05
AZG62743.1|20457_20820_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	93.3	2.0e-62
AZG62769.1|20819_21590_-	hypothetical protein	NA	Q6UAS3	Klebsiella_phage	53.0	2.5e-65
AZG62744.1|21897_22197_-	DUF4406 domain-containing protein	NA	Q6UAS4	Klebsiella_phage	96.0	3.0e-51
AZG62745.1|22308_22503_-	hypothetical protein	NA	Q6UAS6	Klebsiella_phage	89.5	1.5e-19
AZG62746.1|22450_22927_-	hypothetical protein	NA	Q6UAS7	Klebsiella_phage	79.7	2.3e-61
AZG62747.1|22943_23435_-	hypothetical protein	NA	Q6UAS8	Klebsiella_phage	90.2	1.4e-82
AZG62748.1|23431_23743_-	hypothetical protein	NA	Q6UAS9	Klebsiella_phage	89.1	6.3e-44
AZG62770.1|23801_24863_-	site-specific DNA-methyltransferase	NA	Q6UAT0	Klebsiella_phage	93.2	1.6e-171
AZG62771.1|25180_25408_-	hypothetical protein	NA	Q6UAT1	Klebsiella_phage	84.0	1.6e-28
AZG62772.1|25419_25641_-	hypothetical protein	NA	O64358	Escherichia_phage	90.4	3.0e-32
AZG62749.1|25811_26120_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	94.2	3.9e-46
AZG62750.1|26119_26407_+	XRE family transcriptional regulator	NA	Q6UAT4	Klebsiella_phage	96.8	1.7e-43
AZG62773.1|26451_26655_-	hypothetical protein	NA	Q6UAT5	Klebsiella_phage	76.6	3.5e-19
AZG62751.1|26758_26986_-	hypothetical protein	NA	O64355	Escherichia_phage	80.3	2.8e-25
AZG62752.1|27006_27333_-	hypothetical protein	NA	Q6UAT7	Klebsiella_phage	94.4	3.9e-52
AZG62753.1|27325_27571_-	hypothetical protein	NA	G8C7U9	Escherichia_phage	83.1	5.1e-25
AZG62774.1|28171_28780_-	3'-5' exonuclease	NA	Q6UAU3	Klebsiella_phage	88.0	8.7e-98
AZG62754.1|29191_29929_-	phage antitermination protein	NA	Q6UAU4	Klebsiella_phage	84.5	2.2e-119
AZG62775.1|29918_30128_-	hypothetical protein	NA	Q6UAU5	Klebsiella_phage	92.8	7.7e-30
AZG62755.1|30208_30817_+	XRE family transcriptional regulator	NA	Q6UAU6	Klebsiella_phage	92.1	2.8e-104
AZG62776.1|31068_35073_+	origin of replication binding family protein	NA	A0A2I6TD01	Escherichia_phage	81.3	0.0e+00
AZG62756.1|35065_35362_+	hypothetical protein	NA	NA	NA	NA	NA
AZG62757.1|35358_35709_+	hypothetical protein	NA	O64343	Escherichia_phage	77.6	5.1e-50
AZG62758.1|36043_37036_+	hypothetical protein	NA	A0A2H5BFZ4	Vibrio_phage	40.8	1.4e-23
AZG62759.1|37174_37600_-	hypothetical protein	NA	NA	NA	NA	NA
AZG62760.1|38175_38340_+	host cell division inhibitor Icd-like protein	NA	Q6UAV3	Klebsiella_phage	92.6	3.1e-18
AZG62761.1|38336_38567_+	hypothetical protein	NA	NA	NA	NA	NA
AZG62762.1|39416_41339_-	protelomerase	NA	Q6UAV6	Klebsiella_phage	93.6	0.0e+00
AZG62763.1|42046_43210_+	plasmid-partitioning protein SopA	NA	Q6UAV7	Klebsiella_phage	98.4	2.1e-225
AZG62764.1|43212_44178_+	ParB/RepB/Spo0J family plasmid partition protein	NA	Q6UAV8	Klebsiella_phage	86.9	1.5e-155
AZG62765.1|44256_45756_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	73.8	1.7e-147
