The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP034045	Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 chromosome, complete genome	5319653	1231632	1305421	5319653	head,portal,tail,lysis,plate,tRNA,capsid,integrase	Salmonella_phage(80.0%)	81	1229306:1229352	1264183:1264229
1229306:1229352	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AZG63907.1|1231632_1232646_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.5	8.5e-191
AZG63908.1|1232648_1233278_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	54.1	3.9e-61
AZG63909.1|1233400_1233643_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AZG63910.1|1233675_1234185_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
AZG63911.1|1234192_1234393_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	84.6	1.3e-26
AZG63912.1|1234356_1234698_+	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	86.7	8.4e-50
AZG63913.1|1234765_1234999_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	1.3e-30
AZG63914.1|1234998_1235226_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	89.3	1.2e-33
AZG63915.1|1235222_1236080_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	71.2	3.4e-116
AZG63916.1|1236076_1238491_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	88.4	0.0e+00
AZG67552.1|1238644_1238833_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	9.4e-27
AZG63917.1|1238771_1239077_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	88.3	2.4e-32
AZG63918.1|1239363_1239582_+	multidrug ABC transporter ATPase	NA	NA	NA	NA	NA
AZG63919.1|1239581_1240424_+	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	48.5	1.0e-59
AZG63920.1|1240433_1240643_+	hypothetical protein	NA	NA	NA	NA	NA
AZG63921.1|1240639_1242073_+	hypothetical protein	NA	NA	NA	NA	NA
AZG63922.1|1242107_1243142_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.9	2.7e-176
AZG63923.1|1243141_1244905_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	93.0	0.0e+00
AZG63924.1|1245045_1245879_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	76.5	1.5e-103
AZG63925.1|1245895_1246960_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	94.6	1.5e-185
AZG63926.1|1246963_1247614_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	86.1	3.6e-102
AZG63927.1|1247710_1248175_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	86.4	1.0e-74
AZG63928.1|1248174_1248378_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	88.1	1.7e-29
AZG63929.1|1248381_1248597_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	1.0e-29
AZG63930.1|1248577_1249087_+	lysozyme	NA	E5G6N1	Salmonella_phage	84.0	1.2e-81
AZG63931.1|1249091_1249475_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	44.5	1.2e-17
AZG63932.1|1249471_1249900_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	79.4	7.3e-51
AZG63933.1|1249995_1250427_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
AZG63934.1|1250419_1250866_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	73.0	2.5e-54
AZG63935.1|1250934_1251507_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.8	1.6e-77
AZG63936.1|1251503_1251866_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	83.9	2.9e-48
AZG63937.1|1251852_1252761_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	67.9	4.9e-105
AZG67553.1|1252750_1253347_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	61.3	4.3e-57
AZG63938.1|1253352_1255461_+	hypothetical protein	NA	A0A1J0MGQ6	Serratia_phage	39.6	7.4e-112
AZG63939.1|1255461_1255680_+	hypothetical protein	NA	NA	NA	NA	NA
AZG63940.1|1255707_1256871_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	54.3	2.6e-50
AZG63941.1|1257018_1258191_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.1	9.5e-210
AZG63942.1|1258200_1258716_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
AZG63943.1|1258768_1259068_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	2.8e-33
AZG63944.1|1259082_1259202_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AZG63945.1|1259194_1261822_+|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	38.4	3.9e-118
AZG63946.1|1261818_1262304_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	77.0	9.1e-58
AZG63947.1|1262300_1263398_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	84.7	1.6e-174
AZG63948.1|1263464_1263683_+	levansucrase regulator	NA	Q53ZE7	Salmonella_virus	72.2	1.1e-26
AZG63949.1|1263710_1264088_-	hypothetical protein	NA	NA	NA	NA	NA
AZG63950.1|1264691_1265174_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1264183:1264229	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AZG63951.1|1265284_1265761_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AZG63952.1|1265750_1266041_+	RnfH family protein	NA	NA	NA	NA	NA
AZG63953.1|1266107_1266449_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AZG63954.1|1266596_1268258_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AZG63955.1|1268344_1269223_-	NAD(+) kinase	NA	NA	NA	NA	NA
AZG63956.1|1269347_1269938_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AZG63957.1|1270057_1271344_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AZG63958.1|1271363_1272155_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AZG63959.1|1272318_1273683_+	signal recognition particle protein	NA	NA	NA	NA	NA
AZG63960.1|1273942_1274191_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AZG67554.1|1274209_1274758_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AZG63961.1|1274789_1275557_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AZG63962.1|1275596_1275944_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
AZG63963.1|1276063_1276522_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
AZG63964.1|1276578_1277949_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
AZG63965.1|1277957_1278440_-	OmpA family protein	NA	NA	NA	NA	NA
AZG63966.1|1278453_1279677_-	diguanylate cyclase	NA	NA	NA	NA	NA
AZG63967.1|1279669_1280179_-	YfiR family protein	NA	NA	NA	NA	NA
AZG63968.1|1280521_1281592_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
AZG63969.1|1281601_1282723_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AZG63970.1|1282785_1283658_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
AZG63971.1|1283654_1284815_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AZG67555.1|1284915_1284963_-	hypothetical protein	NA	NA	NA	NA	NA
AZG63972.1|1285069_1285405_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AZG63973.1|1285675_1286413_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AZG63974.1|1286544_1287525_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AZG63975.1|1287521_1288253_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AZG63976.1|1288382_1290956_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
AZG63977.1|1297112_1298408_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	1.0e-42
AZG63978.1|1298411_1298735_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
AZG67556.1|1298776_1300132_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AZG63979.1|1300252_1302904_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AZG63980.1|1302938_1303637_-	DTW domain-containing protein	NA	NA	NA	NA	NA
AZG63981.1|1303706_1304132_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
AZG63982.1|1304335_1305421_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 2
CP034045	Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 chromosome, complete genome	5319653	2762193	2773080	5319653		Escherichia_phage(87.5%)	9	NA	NA
AZG65280.1|2762193_2765301_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AZG65281.1|2765355_2766621_+	MFS transporter	NA	NA	NA	NA	NA
AZG65282.1|2766651_2767740_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	99.7	3.0e-210
AZG65283.1|2767826_2768087_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
AZG67633.1|2768384_2769245_+	class A beta-lactamase SHV-28	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
AZG65284.1|2769265_2770027_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AZG65285.1|2770287_2771190_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	100.0	5.3e-160
AZG65286.1|2771201_2772467_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	1.1e-232
AZG65287.1|2772459_2773080_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 3
CP034045	Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 chromosome, complete genome	5319653	3178909	3225736	5319653	head,portal,tail,transposase,plate,tRNA,capsid,terminase,integrase	Enterobacteria_phage(52.78%)	57	3184133:3184154	3221998:3222019
AZG65647.1|3178909_3179410_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
AZG65648.1|3179526_3179973_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AZG67651.1|3179956_3180748_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZG65649.1|3180849_3182034_+	MFS transporter	NA	NA	NA	NA	NA
AZG65650.1|3182065_3182758_-	hypothetical protein	NA	NA	NA	NA	NA
AZG65651.1|3182903_3183413_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AZG67652.1|3183399_3183756_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AZG65652.1|3183745_3183985_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
3184133:3184154	attL	CGCCCCCGACGGGGCTTTTTTT	NA	NA	NA	NA
AZG67653.1|3184249_3184501_-	hypothetical protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
AZG65653.1|3184544_3185684_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	70.5	3.0e-144
AZG65654.1|3185838_3187011_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.5	1.1e-157
AZG65655.1|3187010_3187526_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.2	2.2e-57
AZG65656.1|3187571_3187889_+|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	54.8	1.0e-17
AZG67654.1|3187888_3188047_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
AZG65657.1|3188033_3191009_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.6	1.8e-220
AZG65658.1|3191024_3191516_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.7	2.1e-54
AZG65659.1|3191760_3193119_+	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	28.7	7.5e-49
AZG65660.1|3193318_3194350_-|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
AZG65661.1|3194433_3195525_-|tail	phage tail protein	tail	G4KKN6	Yersinia_phage	47.8	5.2e-08
AZG65662.1|3195524_3195737_-	hypothetical protein	NA	NA	NA	NA	NA
AZG65663.1|3195733_3198760_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
AZG65664.1|3198749_3199673_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	44.6	6.9e-54
AZG65665.1|3199674_3200025_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	54.8	9.3e-28
AZG65666.1|3200021_3200609_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.5	6.9e-60
AZG65667.1|3200605_3201241_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.9	4.6e-57
AZG65668.1|3201237_3201705_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.8	4.5e-46
AZG65669.1|3201705_3201969_-	peptidase	NA	B6SD31	Bacteriophage	34.5	3.7e-05
AZG65670.1|3201886_3202216_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AZG65671.1|3202227_3202773_-	lysozyme	NA	Q1I0Z1	Pasteurella_virus	44.1	9.7e-32
AZG65672.1|3202769_3203054_-|tail	phage tail protein	tail	NA	NA	NA	NA
AZG65673.1|3203044_3203245_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	1.6e-16
AZG65674.1|3203244_3203760_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	49.4	3.1e-40
AZG65675.1|3203864_3204731_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	57.3	8.4e-70
AZG65676.1|3204780_3205815_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	8.1e-96
AZG65677.1|3205825_3206665_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.9	1.6e-94
AZG65678.1|3206821_3208549_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	68.1	6.9e-233
AZG65679.1|3208542_3209604_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.4	1.0e-141
AZG67655.1|3211755_3212763_-	hypothetical protein	NA	NA	NA	NA	NA
AZG65680.1|3212755_3214702_-	DUF3696 domain-containing protein	NA	Q2P9X8	Enterobacteria_phage	39.6	3.4e-18
AZG65681.1|3214959_3217107_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	63.6	2.4e-243
AZG65682.1|3217144_3218080_-	DNA adenine methylase	NA	A0A0M4QWR0	Salmonella_phage	55.9	1.9e-83
AZG65683.1|3218076_3218304_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	41.0	1.9e-05
AZG65684.1|3218312_3218879_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	9.5e-14
AZG65685.1|3218875_3219100_-	hypothetical protein	NA	NA	NA	NA	NA
AZG65686.1|3219177_3219441_-	hypothetical protein	NA	NA	NA	NA	NA
AZG65687.1|3219456_3219834_-	hypothetical protein	NA	NA	NA	NA	NA
AZG65688.1|3219849_3220068_-	DUF4761 domain-containing protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	3.6e-06
AZG65689.1|3220088_3220367_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	88.9	6.2e-43
AZG65690.1|3220487_3220787_+	XRE family transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	6.5e-38
AZG65691.1|3220902_3221886_+|integrase	integrase	integrase	Q83VS6	Escherichia_phage	80.1	6.4e-151
AZG65692.1|3222150_3223164_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.0	1.9e-12
3221998:3222019	attR	CGCCCCCGACGGGGCTTTTTTT	NA	NA	NA	NA
AZG65693.1|3223221_3223323_+	hypothetical protein	NA	NA	NA	NA	NA
AZG67656.1|3223322_3223397_+	protein YoaJ	NA	NA	NA	NA	NA
AZG65694.1|3223514_3223640_+	hypothetical protein	NA	NA	NA	NA	NA
AZG65695.1|3223699_3223963_-	DUF2534 family protein	NA	NA	NA	NA	NA
AZG65696.1|3224093_3224732_-	leucine efflux protein	NA	NA	NA	NA	NA
AZG65697.1|3224821_3225736_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.0	3.2e-72
>prophage 4
CP034045	Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 chromosome, complete genome	5319653	3505683	3515146	5319653	tRNA,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
AZG65932.1|3505683_3507405_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	2.0e-14
AZG65933.1|3507449_3508151_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AZG65934.1|3508504_3508723_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AZG65935.1|3508842_3511122_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AZG65936.1|3511152_3511470_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AZG65937.1|3511795_3512017_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AZG65938.1|3512093_3514034_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AZG65939.1|3514030_3515146_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 5
CP034045	Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 chromosome, complete genome	5319653	4190185	4198863	5319653	transposase	Salmonella_phage(33.33%)	7	NA	NA
AZG66545.1|4190185_4191061_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
AZG66546.1|4191316_4192579_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AZG66547.1|4193484_4194588_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
AZG66548.1|4194598_4195852_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	1.5e-88
AZG66549.1|4196351_4196552_+	DNA-binding protein	NA	NA	NA	NA	NA
AZG67703.1|4196788_4197097_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	52.0	6.9e-19
AZG66550.1|4197093_4198863_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	49.0	2.2e-125
>prophage 1
CP034046	Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence	345775	7626	62766	345775	transposase	Enterobacteria_phage(17.65%)	48	NA	NA
AZG67766.1|7626_8904_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	44.2	6.7e-84
AZG67767.1|8909_9338_-	peptidase S24	NA	A0A1W6JNS2	Morganella_phage	39.5	1.3e-15
AZG67768.1|9514_9706_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZG67769.1|9830_10590_+|transposase	IS5-like element ISKpn12 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	38.8	2.0e-11
AZG67770.1|10658_11210_+	hypothetical protein	NA	NA	NA	NA	NA
AZG67771.1|11482_11668_+	hypothetical protein	NA	NA	NA	NA	NA
AZG67772.1|11733_12893_-|transposase	IS3-like element ISKpn11 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	32.3	1.5e-18
AZG67773.1|12924_13218_-	hypothetical protein	NA	NA	NA	NA	NA
AZG67774.1|13230_14091_-	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
AZG67775.1|14232_15093_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AZG67776.1|15275_15833_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
AZG67777.1|16396_17659_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AZG67778.1|17914_18790_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
AZG67779.1|18836_19169_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AZG67780.1|22637_23453_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
AZG67781.1|23559_24264_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZG67782.1|27190_27442_+	hypothetical protein	NA	NA	NA	NA	NA
AZG68068.1|27441_28926_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AZG67783.1|29011_30148_+	recombinase	NA	NA	NA	NA	NA
AZG67784.1|30213_30531_-	hypothetical protein	NA	NA	NA	NA	NA
AZG67785.1|30682_31006_-	hypothetical protein	NA	NA	NA	NA	NA
AZG67786.1|31002_31761_-	hypothetical protein	NA	NA	NA	NA	NA
AZG67787.1|31757_32717_-	DNA replication protein	NA	NA	NA	NA	NA
AZG67788.1|32759_33167_-	hypothetical protein	NA	NA	NA	NA	NA
AZG67789.1|33176_33641_-	hypothetical protein	NA	NA	NA	NA	NA
AZG67790.1|33688_33931_-	hypothetical protein	NA	NA	NA	NA	NA
AZG68069.1|34518_34737_-	hypothetical protein	NA	NA	NA	NA	NA
AZG67791.1|34881_35421_-	hypothetical protein	NA	NA	NA	NA	NA
AZG67792.1|35488_36733_-	topoisomerase	NA	A0A0H5AWB1	Pseudomonas_phage	25.5	1.8e-09
AZG67793.1|36843_37074_-	hypothetical protein	NA	NA	NA	NA	NA
AZG68070.1|37145_37922_-	VWA domain-containing protein	NA	NA	NA	NA	NA
AZG67794.1|39155_40232_-	DUF3150 domain-containing protein	NA	NA	NA	NA	NA
AZG67795.1|40324_41377_-	ATP-binding protein	NA	NA	NA	NA	NA
AZG67796.1|41404_42226_-	hypothetical protein	NA	NA	NA	NA	NA
AZG67797.1|42287_42641_-	hypothetical protein	NA	NA	NA	NA	NA
AZG67798.1|42785_43772_-	hypothetical protein	NA	NA	NA	NA	NA
AZG67799.1|44105_45905_-	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	23.3	8.2e-27
AZG67800.1|46195_46444_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AZG67801.1|46433_46718_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	59.1	4.7e-22
AZG67802.1|46871_48095_+|transposase	transposase	transposase	O80301	Enterobacteria_phage	78.0	2.0e-154
AZG68071.1|48485_49673_-|transposase	transposase	transposase	A0A077SLN2	Escherichia_phage	65.6	1.6e-140
AZG67803.1|50338_50806_+	hypothetical protein	NA	NA	NA	NA	NA
AZG67804.1|50850_51057_-	hypothetical protein	NA	NA	NA	NA	NA
AZG67805.1|51504_55446_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AZG67806.1|55920_56772_+	hypothetical protein	NA	NA	NA	NA	NA
AZG67807.1|56801_59984_-	conjugal transfer protein TraN	NA	NA	NA	NA	NA
AZG67808.1|59993_61031_-	plasmid transfer protein	NA	NA	NA	NA	NA
AZG67809.1|61557_62766_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	83.3	7.5e-194
>prophage 2
CP034046	Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence	345775	127460	167844	345775	transposase,tail	Salmonella_phage(33.33%)	49	NA	NA
AZG67870.1|127460_128384_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.3	8.4e-177
AZG67871.1|128565_128919_+	hypothetical protein	NA	NA	NA	NA	NA
AZG67872.1|129239_130031_+	NgrC	NA	A0A219UQS0	Bacillus_phage	32.5	1.4e-10
AZG67873.1|131283_132288_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AZG67874.1|132340_133420_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	41.4	4.4e-60
AZG67875.1|135445_135976_+	hypothetical protein	NA	NA	NA	NA	NA
AZG67876.1|136053_136260_+	hypothetical protein	NA	NA	NA	NA	NA
AZG67877.1|136343_136823_+	hypothetical protein	NA	NA	NA	NA	NA
AZG67878.1|137301_137883_+	hypothetical protein	NA	NA	NA	NA	NA
AZG67879.1|137899_138193_+	hypothetical protein	NA	NA	NA	NA	NA
AZG67880.1|138231_138813_+	hypothetical protein	NA	NA	NA	NA	NA
AZG67881.1|139192_140062_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AZG67882.1|140115_140436_+	hypothetical protein	NA	J9Q750	Salmonella_phage	50.9	2.2e-28
AZG67883.1|140516_140831_+	hypothetical protein	NA	NA	NA	NA	NA
AZG67884.1|140951_141203_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	76.7	1.9e-22
AZG67885.1|141368_141587_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	66.7	4.4e-20
AZG67886.1|141679_142177_+	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	67.1	2.0e-23
AZG67887.1|142173_142362_+	hypothetical protein	NA	NA	NA	NA	NA
AZG67888.1|142839_143067_+	hypothetical protein	NA	A9YWV3	Burkholderia_phage	48.1	2.5e-10
AZG67889.1|143063_143708_+	hypothetical protein	NA	A0A125RNQ8	Pseudomonas_phage	51.6	5.4e-05
AZG67890.1|143708_144032_+	hypothetical protein	NA	E5AGF3	Erwinia_phage	46.9	1.6e-13
AZG67891.1|144123_144510_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	85.1	3.7e-17
AZG67892.1|144836_145052_+	hypothetical protein	NA	NA	NA	NA	NA
AZG67893.1|145098_145602_+	hypothetical protein	NA	A0A1V0E5L6	Salmonella_phage	66.2	2.8e-25
AZG68077.1|145632_146148_+	DUF262 domain-containing protein	NA	A0A2H4FWH2	Salmonella_phage	68.2	2.4e-64
AZG67894.1|146554_146767_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
AZG67895.1|147967_148450_+	hypothetical protein	NA	A0A077SLK5	Escherichia_phage	58.3	4.4e-12
AZG68078.1|148533_149130_+	DUF551 domain-containing protein	NA	A0A0S1S1U7	Klebsiella_phage	94.1	2.4e-20
AZG67896.1|149132_149327_+	hypothetical protein	NA	NA	NA	NA	NA
AZG67897.1|149628_149835_+	hypothetical protein	NA	NA	NA	NA	NA
AZG67898.1|149918_150191_+	hypothetical protein	NA	I7B2L9	Escherichia_phage	48.9	1.5e-12
AZG67899.1|150471_150759_+	hypothetical protein	NA	NA	NA	NA	NA
AZG67900.1|151377_151617_+	DUF1819 family protein	NA	NA	NA	NA	NA
AZG67901.1|152848_153880_-|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
AZG67902.1|154268_154742_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	G3MBI7	Bacillus_virus	32.1	3.7e-19
AZG67903.1|154836_155361_+	streptothricin N-acetyltransferase Sat2	NA	NA	NA	NA	NA
AZG67904.1|155429_155927_+	hypothetical protein	NA	NA	NA	NA	NA
AZG67905.1|155987_156359_+	hypothetical protein	NA	NA	NA	NA	NA
AZG67906.1|156391_156715_+	hypothetical protein	NA	NA	NA	NA	NA
AZG67907.1|156768_157146_+	hypothetical protein	NA	NA	NA	NA	NA
AZG67908.1|157376_158993_-	transcriptional antiterminator	NA	NA	NA	NA	NA
AZG67909.1|158993_160520_-	transcriptional antiterminator	NA	NA	NA	NA	NA
AZG67910.1|160522_162190_-	AAA family ATPase	NA	NA	NA	NA	NA
AZG67911.1|162186_164295_-|transposase	transposase	transposase	NA	NA	NA	NA
AZG67912.1|164281_165103_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
AZG67913.1|165587_166112_+	hypothetical protein	NA	NA	NA	NA	NA
AZG67914.1|166175_166943_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	62.7	3.5e-43
AZG67915.1|167199_167385_+	hypothetical protein	NA	A0A1V0E5M0	Salmonella_phage	65.2	6.0e-10
AZG67916.1|167394_167844_+|tail	phage tail protein	tail	A0A1I9KFG8	Aeromonas_phage	40.0	2.3e-18
>prophage 3
CP034046	Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed1, complete sequence	345775	174234	227894	345775	transposase,integrase	Escherichia_phage(58.82%)	47	171603:171620	214063:214080
171603:171620	attL	TATCATTCAGGAAGCGTT	NA	NA	NA	NA
AZG67923.1|174234_175239_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AZG67924.1|175815_176229_+	NB-ARC domain protein	NA	NA	NA	NA	NA
AZG67925.1|176291_177083_+	hypothetical protein	NA	NA	NA	NA	NA
AZG67926.1|177085_177652_+	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
AZG67927.1|180267_180921_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AZG68079.1|184513_185008_+	nuclease	NA	A0A0R6PHV6	Moraxella_phage	38.6	5.9e-20
AZG67928.1|185344_185743_+	DNA-binding protein H-NS-like protein	NA	NA	NA	NA	NA
AZG67929.1|186189_187194_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AZG67930.1|187272_187707_-	mercuric resistance operon regulatory protein	NA	NA	NA	NA	NA
AZG67931.1|187778_188129_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
AZG67932.1|188142_188418_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
AZG68080.1|188453_188876_+	mercury transporter MerC	NA	NA	NA	NA	NA
AZG67933.1|188927_190622_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AZG67934.1|190639_191002_+	transcriptional regulator	NA	NA	NA	NA	NA
AZG67935.1|190998_191235_+	mercury resistance protein	NA	NA	NA	NA	NA
AZG67936.1|191231_191939_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AZG67937.1|191977_193282_+|integrase	integrase	integrase	NA	NA	NA	NA
AZG67938.1|193328_194033_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AZG67939.1|194744_195365_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
AZG67940.1|195357_196623_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	100.0	2.7e-234
AZG67941.1|196634_197537_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	100.0	5.3e-160
AZG67942.1|197797_198559_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AZG67943.1|198579_199440_-	class A extended-spectrum beta-lactamase SHV-5	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
AZG67944.1|199737_199998_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	100.0	1.9e-41
AZG67945.1|200084_201173_+	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AZG67946.1|202145_202850_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AZG68081.1|203596_204379_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
AZG67947.1|204554_205055_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZG67948.1|205073_205253_+	hypothetical protein	NA	NA	NA	NA	NA
AZG67949.1|205182_206022_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AZG67950.1|206015_206363_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AZG68082.1|206526_207318_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AZG67951.1|207466_208480_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AZG68083.1|208682_209033_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AZG67952.1|209158_209719_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AZG67953.1|209721_212688_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AZG67954.1|212766_213771_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AZG67955.1|214081_214459_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
214063:214080	attR	TATCATTCAGGAAGCGTT	NA	NA	NA	NA
AZG67956.1|214659_214950_-	chloramphenicol acetyltransferase CAT	NA	A0A1I9LJQ7	Stx_converting_phage	99.0	5.3e-53
AZG67957.1|217347_218136_-	hypothetical protein	NA	NA	NA	NA	NA
AZG68084.1|218135_218600_-	hypothetical protein	NA	NA	NA	NA	NA
AZG67958.1|219537_219951_+	hypothetical protein	NA	NA	NA	NA	NA
AZG67959.1|220143_220668_+	hypothetical protein	NA	NA	NA	NA	NA
AZG67960.1|220684_221227_+	hypothetical protein	NA	NA	NA	NA	NA
AZG67961.1|221592_222630_+	thioredoxin family protein	NA	NA	NA	NA	NA
AZG68085.1|222673_224029_+	conjugal transfer protein	NA	NA	NA	NA	NA
AZG67962.1|226862_227894_-|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
>prophage 1
CP034047	Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed2, complete sequence	113143	0	79435	113143	capsid,tail,terminase,integrase	Salmonella_phage(88.89%)	85	13485:13502	23703:23720
AZG68094.1|0_1098_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	52.9	1.9e-74
AZG68095.1|1549_1762_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	78.6	4.7e-27
AZG68096.1|1761_2097_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	66.7	8.0e-37
AZG68097.1|2093_2273_-	hypothetical protein	NA	NA	NA	NA	NA
AZG68098.1|2806_5149_-	recombinase RecA	NA	J9Q736	Salmonella_phage	83.8	3.3e-28
AZG68099.1|5151_5418_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	84.1	1.7e-34
AZG68100.1|5417_6362_-	exonuclease	NA	J9Q7S6	Salmonella_phage	93.3	1.1e-171
AZG68101.1|6422_7430_-	regulator	NA	J9Q7Z3	Salmonella_phage	88.0	6.0e-144
AZG68102.1|7549_7981_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	90.9	9.0e-65
AZG68103.1|8127_8427_-	hypothetical protein	NA	NA	NA	NA	NA
AZG68104.1|8437_8857_-	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	62.6	6.3e-47
AZG68105.1|9057_9501_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	82.3	3.7e-58
AZG68106.1|9497_10667_-	uracil-DNA glycosylase	NA	J9Q7Z2	Salmonella_phage	92.8	5.2e-208
AZG68107.1|10688_11390_-	hypothetical protein	NA	S5YLC4	Mycobacterium_phage	37.6	7.6e-21
AZG68108.1|11386_13750_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	87.0	0.0e+00
13485:13502	attL	AATGATTCCATACATCCA	NA	NA	NA	NA
AZG68109.1|13724_13928_-	hypothetical protein	NA	J9Q6I7	Salmonella_phage	80.6	7.2e-25
AZG68110.1|13930_15163_-	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	86.6	1.6e-212
AZG68111.1|15259_17545_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	62.9	8.8e-244
AZG68112.1|18146_18527_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZG68113.1|18521_19622_-|integrase	integrase	integrase	A0A1P8DTG6	Proteus_phage	28.4	1.6e-17
AZG68114.1|19971_20331_+	hypothetical protein	NA	NA	NA	NA	NA
AZG68115.1|20395_20806_-	toxin YafO	NA	NA	NA	NA	NA
AZG68116.1|20815_21433_-	hypothetical protein	NA	NA	NA	NA	NA
AZG68117.1|21527_21773_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	47.4	9.1e-14
AZG68118.1|21769_22156_-	hypothetical protein	NA	Q716B1	Shigella_phage	71.2	1.9e-45
AZG68119.1|22165_22978_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	66.1	8.1e-91
AZG68120.1|24268_24571_-	C-type natriuretic protein	NA	J9Q7S1	Salmonella_phage	63.5	7.5e-26
23703:23720	attR	TGGATGTATGGAATCATT	NA	NA	NA	NA
AZG68121.1|24567_24720_-	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	82.0	1.6e-16
AZG68122.1|24964_25432_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	63.9	3.4e-49
AZG68123.1|25511_26300_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	51.1	6.9e-71
AZG68124.1|26592_27759_+	hypothetical protein	NA	NA	NA	NA	NA
AZG68125.1|27798_28917_-	DNA primase	NA	J9Q720	Salmonella_phage	91.3	1.4e-202
AZG68126.1|29069_30410_-	DNA helicase	NA	J9Q7G4	Salmonella_phage	96.0	5.4e-241
AZG68127.1|30474_31200_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	88.4	9.6e-128
AZG68128.1|31444_32230_+	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	24.8	1.8e-07
AZG68129.1|32275_32638_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.5e-44
AZG68130.1|32637_33303_-	plasmid stability protein	NA	J9Q7R7	Salmonella_phage	83.7	2.9e-102
AZG68131.1|33487_34237_-	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	31.3	2.7e-16
AZG68132.1|34221_34614_-	hypothetical protein	NA	A0A077SLR3	Escherichia_phage	42.2	1.0e-14
AZG68133.1|34888_35080_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	66.7	2.3e-17
AZG68134.1|35030_35282_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	73.5	2.0e-24
AZG68135.1|35284_35977_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	89.1	4.6e-119
AZG68136.1|35990_36314_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	95.3	2.3e-49
AZG68137.1|36404_37850_-|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	38.6	1.0e-40
AZG68138.1|37972_50107_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	60.7	3.1e-29
AZG68139.1|50123_50735_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	73.9	4.5e-78
AZG68140.1|50722_51520_-|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	85.3	5.4e-140
AZG68141.1|51512_52211_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	87.4	1.2e-122
AZG68142.1|52297_52633_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	84.5	3.4e-51
AZG68143.1|52676_57221_-|tail	phage tail tape measure protein	tail	J9Q712	Salmonella_phage	68.8	0.0e+00
AZG68206.1|57228_57462_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.5	3.4e-34
AZG68144.1|57578_57896_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	92.4	2.4e-46
AZG68145.1|57957_58704_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	83.0	3.7e-106
AZG68146.1|58771_59164_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	67.5	1.0e-46
AZG68147.1|59165_59639_-	hypothetical protein	NA	J9Q711	Salmonella_phage	93.6	1.9e-76
AZG68148.1|59629_59974_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	92.1	2.2e-53
AZG68149.1|60071_60905_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	83.4	4.8e-131
AZG68150.1|60904_61339_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	84.0	2.9e-63
AZG68151.1|61386_61815_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	82.4	6.0e-29
AZG68152.1|61893_62772_-|capsid	phage major capsid protein	capsid	J9Q710	Salmonella_phage	94.2	4.7e-153
AZG68153.1|62798_63698_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	82.6	1.0e-123
AZG68154.1|63720_65310_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	88.5	1.1e-274
AZG68155.1|65327_66584_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	97.4	9.4e-248
AZG68156.1|66586_67228_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	88.2	5.0e-96
AZG68157.1|67403_67670_-	hypothetical protein	NA	J9Q757	Salmonella_phage	90.9	1.3e-37
AZG68158.1|67679_68579_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	97.0	4.2e-165
AZG68159.1|68575_68830_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	95.2	7.7e-40
AZG68160.1|68822_69461_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	97.6	1.4e-109
AZG68161.1|69457_70126_-	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	91.4	1.9e-106
AZG68207.1|70125_70806_-	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	88.8	1.8e-107
AZG68162.1|70889_72449_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.9	1.2e-279
AZG68163.1|72451_72730_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	70.3	6.2e-27
AZG68164.1|72791_73331_+	hypothetical protein	NA	NA	NA	NA	NA
AZG68165.1|73477_74077_+	hypothetical protein	NA	NA	NA	NA	NA
AZG68166.1|74101_74458_+	hypothetical protein	NA	NA	NA	NA	NA
AZG68167.1|74507_75038_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	69.6	2.5e-56
AZG68168.1|75354_76005_+	hypothetical protein	NA	J9Q754	Salmonella_phage	91.7	1.9e-106
AZG68169.1|76052_76283_+	hypothetical protein	NA	NA	NA	NA	NA
AZG68170.1|76920_77403_-	hypothetical protein	NA	J9Q805	Salmonella_phage	70.0	1.4e-63
AZG68208.1|77415_77613_-	hypothetical protein	NA	NA	NA	NA	NA
AZG68171.1|77608_77890_-	ABC transporter	NA	J9Q753	Salmonella_phage	83.9	9.1e-42
AZG68172.1|78016_78424_-	hypothetical protein	NA	NA	NA	NA	NA
AZG68173.1|78543_78855_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	66.0	4.0e-30
AZG68174.1|78991_79204_-	hypothetical protein	NA	J9Q804	Salmonella_phage	74.3	7.6e-25
AZG68175.1|79216_79435_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	81.9	2.9e-27
>prophage 2
CP034047	Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed2, complete sequence	113143	83359	112822	113143		Salmonella_phage(80.77%)	29	NA	NA
AZG68177.1|83359_84916_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	3.1e-107
AZG68178.1|84912_86142_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AZG68210.1|86258_89375_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	23.8	7.8e-25
AZG68179.1|89436_89652_-	DNA modification methylase	NA	J9Q747	Salmonella_phage	69.8	1.2e-14
AZG68180.1|89780_90359_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	56.5	1.1e-54
AZG68181.1|90486_90642_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	61.2	1.7e-05
AZG68182.1|90641_91067_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	80.9	9.8e-56
AZG68183.1|91169_91358_-	hypothetical protein	NA	J9Q800	Salmonella_phage	52.5	3.3e-08
AZG68184.1|91354_91633_-	hypothetical protein	NA	NA	NA	NA	NA
AZG68185.1|92003_92654_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	79.6	4.2e-90
AZG68186.1|93227_93461_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	82.9	3.9e-30
AZG68187.1|94437_95355_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	90.7	8.5e-105
AZG68188.1|95492_96599_+	DUF697 domain-containing protein	NA	NA	NA	NA	NA
AZG68189.1|96637_97180_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	96.6	8.6e-97
AZG68190.1|97189_97609_-	hypothetical protein	NA	J9Q743	Salmonella_phage	97.8	1.9e-67
AZG68191.1|97672_98317_-	hypothetical protein	NA	J9Q7H4	Salmonella_phage	100.0	5.2e-117
AZG68192.1|98316_98793_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	99.4	2.6e-89
AZG68193.1|98789_99203_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	76.6	2.3e-54
AZG68194.1|99204_100308_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	80.1	6.7e-181
AZG68195.1|100501_101377_-	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	85.1	1.2e-140
AZG68196.1|101454_102597_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	95.8	9.0e-213
AZG68197.1|102727_105031_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	90.8	0.0e+00
AZG68198.1|105106_105676_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	91.0	2.9e-95
AZG68199.1|105685_106432_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	61.7	1.3e-79
AZG68200.1|106421_108338_-	exonuclease	NA	J9Q741	Salmonella_phage	84.5	3.6e-299
AZG68201.1|108334_108568_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	66.1	4.4e-18
AZG68202.1|108567_109653_-	exonuclease SbcCD subunit D	NA	J9Q7S9	Salmonella_phage	84.5	3.2e-183
AZG68203.1|110305_111865_+	DUF4041 domain-containing protein	NA	X5JAC1	Clostridium_phage	52.3	6.6e-57
AZG68204.1|112177_112822_-	hypothetical protein	NA	J9Q739	Salmonella_phage	80.7	4.9e-99
>prophage 1
CP034048	Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed3, complete sequence	76757	1796	46048	76757	protease,transposase	Escherichia_phage(31.25%)	56	NA	NA
AZG68213.1|1796_2450_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AZG68214.1|2542_2800_+	antitoxin PemI	NA	NA	NA	NA	NA
AZG68215.1|2801_3134_+	mRNA interferase PemK	NA	NA	NA	NA	NA
AZG68216.1|3270_6168_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
AZG68217.1|6523_7228_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZG68218.1|7490_8312_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	3.4e-44
AZG68219.1|8608_9199_-	lytic transglycosylase	NA	NA	NA	NA	NA
AZG68220.1|9533_9917_+	conjugal transfer protein TraM	NA	NA	NA	NA	NA
AZG68221.1|10110_10782_+	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
AZG68222.1|10918_11146_+	relaxosome protein TraY	NA	NA	NA	NA	NA
AZG68223.1|11178_11538_+	pilin	NA	NA	NA	NA	NA
AZG68224.1|11552_11864_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
AZG68225.1|11885_12452_+	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
AZG68226.1|12438_13167_+	conjugal transfer protein TraK	NA	NA	NA	NA	NA
AZG68227.1|13166_14618_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
AZG68228.1|14586_15174_+	conjugal transfer protein TraP	NA	NA	NA	NA	NA
AZG68229.1|15112_15481_+	DUF2689 domain-containing protein	NA	NA	NA	NA	NA
AZG68230.1|15477_15993_+	type IV conjugative transfer system protein TraV	NA	NA	NA	NA	NA
AZG68231.1|16127_16349_+	conjugal transfer protein TraR	NA	A2I309	Vibrio_virus	40.8	5.7e-07
AZG68232.1|16341_16818_+	hypothetical protein	NA	NA	NA	NA	NA
AZG68233.1|16897_17116_+	hypothetical protein	NA	NA	NA	NA	NA
AZG68234.1|17143_17491_+	hypothetical protein	NA	NA	NA	NA	NA
AZG68235.1|18899_19604_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AZG68236.1|19650_19872_-	hypothetical protein	NA	NA	NA	NA	NA
AZG68237.1|19934_20171_+	hypothetical protein	NA	NA	NA	NA	NA
AZG68293.1|20345_20507_-	transporter	NA	NA	NA	NA	NA
AZG68238.1|20552_22166_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	1.8e-182
AZG68239.1|22196_22547_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AZG68240.1|22543_22969_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
AZG68241.1|23764_24484_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AZG68242.1|24480_24915_-	protein PsiB	NA	NA	NA	NA	NA
AZG68243.1|27012_27246_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AZG68244.1|27303_27831_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	6.0e-47
AZG68245.1|27895_28132_+	hypothetical protein	NA	NA	NA	NA	NA
AZG68246.1|28132_28594_+	hypothetical protein	NA	NA	NA	NA	NA
AZG68247.1|28574_28769_+	hypothetical protein	NA	NA	NA	NA	NA
AZG68248.1|28679_29243_-	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	4.7e-21
AZG68249.1|29289_30651_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
AZG68250.1|30702_30933_-	hypothetical protein	NA	NA	NA	NA	NA
AZG68251.1|31970_32162_-	hypothetical protein	NA	NA	NA	NA	NA
AZG68252.1|32158_32581_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AZG68253.1|32627_33053_-	antirestriction protein	NA	NA	NA	NA	NA
AZG68254.1|33025_33598_-	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
AZG68255.1|34297_34732_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AZG68256.1|34745_34967_-	hypothetical protein	NA	NA	NA	NA	NA
AZG68257.1|34967_35651_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	5.6e-29
AZG68258.1|35607_35787_+	hypothetical protein	NA	NA	NA	NA	NA
AZG68294.1|35727_36021_-	hypothetical protein	NA	NA	NA	NA	NA
AZG68259.1|36167_37130_+	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
AZG68295.1|37132_37483_+	protein stbB	NA	NA	NA	NA	NA
AZG68260.1|37605_37887_-	hypothetical protein	NA	NA	NA	NA	NA
AZG68261.1|39697_39838_-	hypothetical protein	NA	NA	NA	NA	NA
AZG68262.1|39828_40533_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AZG68263.1|43293_44154_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AZG68264.1|44336_44894_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
AZG68265.1|45343_46048_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
CP034049	Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed4, complete sequence	54880	0	54266	54880	capsid,terminase,tail,head,portal	Klebsiella_phage(88.24%)	54	NA	NA
AZG68300.1|276_987_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	89.8	6.7e-134
AZG68301.1|988_1744_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.1	6.7e-124
AZG68302.1|1740_2079_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	2.4e-57
AZG68303.1|2078_5435_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	87.2	0.0e+00
AZG68345.1|5434_5647_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	87.5	1.4e-31
AZG68304.1|5667_6033_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
AZG68305.1|6090_6552_-|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
AZG68306.1|6583_6985_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	1.7e-62
AZG68307.1|6981_7371_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
AZG68308.1|7351_7690_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
AZG68309.1|7686_8004_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
AZG68346.1|7984_8182_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	78.0	1.8e-20
AZG68310.1|8438_9725_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	84.8	5.4e-206
AZG68311.1|9802_10723_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	1.6e-148
AZG68312.1|10759_12019_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.0	2.1e-223
AZG68313.1|12018_12198_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	80.7	2.4e-16
AZG68314.1|12191_13901_-|terminase	terminase large subunit	terminase	Q6UAY0	Klebsiella_phage	95.1	0.0e+00
AZG68315.1|13935_14370_-|terminase	terminase	terminase	Q6UAY1	Klebsiella_phage	95.8	2.4e-73
AZG68347.1|14585_14786_-	hypothetical protein	NA	Q6UAR8	Klebsiella_phage	90.9	1.0e-10
AZG68316.1|14871_15303_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	60.6	2.6e-40
AZG68317.1|15299_15584_-	hypothetical protein	NA	Q6UAS1	Klebsiella_phage	37.5	3.1e-05
AZG68318.1|15580_15943_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	93.3	2.0e-62
AZG68348.1|15942_16713_-	hypothetical protein	NA	Q6UAS3	Klebsiella_phage	53.0	2.5e-65
AZG68319.1|17020_17320_-	DUF4406 domain-containing protein	NA	Q6UAS4	Klebsiella_phage	96.0	3.0e-51
AZG68320.1|17431_17626_-	hypothetical protein	NA	Q6UAS6	Klebsiella_phage	89.5	1.5e-19
AZG68321.1|17573_18050_-	hypothetical protein	NA	Q6UAS7	Klebsiella_phage	79.7	2.3e-61
AZG68322.1|18066_18558_-	hypothetical protein	NA	Q6UAS8	Klebsiella_phage	90.2	1.4e-82
AZG68323.1|18554_18866_-	hypothetical protein	NA	Q6UAS9	Klebsiella_phage	89.1	6.3e-44
AZG68349.1|18924_19986_-	site-specific DNA-methyltransferase	NA	Q6UAT0	Klebsiella_phage	93.2	1.6e-171
AZG68350.1|20303_20531_-	hypothetical protein	NA	Q6UAT1	Klebsiella_phage	84.0	1.6e-28
AZG68351.1|20542_20764_-	hypothetical protein	NA	O64358	Escherichia_phage	90.4	3.0e-32
AZG68324.1|20934_21243_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	94.2	3.9e-46
AZG68325.1|21242_21530_+	XRE family transcriptional regulator	NA	Q6UAT4	Klebsiella_phage	96.8	1.7e-43
AZG68352.1|21574_21778_-	hypothetical protein	NA	Q6UAT5	Klebsiella_phage	76.6	3.5e-19
AZG68326.1|21881_22109_-	hypothetical protein	NA	O64355	Escherichia_phage	80.3	2.8e-25
AZG68327.1|22129_22456_-	hypothetical protein	NA	Q6UAT7	Klebsiella_phage	94.4	3.9e-52
AZG68328.1|22448_22694_-	hypothetical protein	NA	G8C7U9	Escherichia_phage	83.1	5.1e-25
AZG68329.1|23294_23903_-	3'-5' exonuclease	NA	Q6UAU3	Klebsiella_phage	88.0	8.7e-98
AZG68330.1|24314_25052_-	phage antitermination protein	NA	Q6UAU4	Klebsiella_phage	84.5	2.2e-119
AZG68353.1|25041_25251_-	hypothetical protein	NA	Q6UAU5	Klebsiella_phage	92.8	7.7e-30
AZG68331.1|25331_25940_+	XRE family transcriptional regulator	NA	Q6UAU6	Klebsiella_phage	92.1	2.8e-104
AZG68354.1|26191_30196_+	origin of replication binding family protein	NA	A0A2I6TD01	Escherichia_phage	81.3	0.0e+00
AZG68332.1|30188_30485_+	hypothetical protein	NA	NA	NA	NA	NA
AZG68333.1|30481_30832_+	hypothetical protein	NA	O64343	Escherichia_phage	77.6	5.1e-50
AZG68334.1|31166_32159_+	hypothetical protein	NA	A0A2H5BFZ4	Vibrio_phage	40.8	1.4e-23
AZG68335.1|32297_32723_-	hypothetical protein	NA	NA	NA	NA	NA
AZG68336.1|33298_33463_+	host cell division inhibitor Icd-like protein	NA	Q6UAV3	Klebsiella_phage	92.6	3.1e-18
AZG68337.1|33459_33690_+	hypothetical protein	NA	NA	NA	NA	NA
AZG68338.1|34539_36462_-	protelomerase	NA	Q6UAV6	Klebsiella_phage	93.6	0.0e+00
AZG68339.1|37169_38333_+	plasmid-partitioning protein SopA	NA	Q6UAV7	Klebsiella_phage	98.4	2.1e-225
AZG68340.1|38335_39301_+	ParB/RepB/Spo0J family plasmid partition protein	NA	Q6UAV8	Klebsiella_phage	86.9	1.5e-155
AZG68341.1|39379_40879_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	73.8	1.7e-147
AZG68342.1|40947_53610_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	45.4	0.0e+00
AZG68343.1|53672_54266_-|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	80.7	3.7e-85
