The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027761	Pseudomonas sp. R11-23-07 chromosome, complete genome	5689077	1301894	1340854	5689077	tail,tRNA,plate	uncultured_Caudovirales_phage(36.36%)	47	NA	NA
AZF57019.1|1301894_1302365_+|tRNA	Cys-tRNA(Pro) deacylase YbaK	tRNA	NA	NA	NA	NA
AZF57020.1|1302503_1303547_-	Ferric iron ABC transporter, ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.1	3.3e-20
AZF57021.1|1303543_1304467_-	Ornithine carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	27.4	1.2e-18
AZF57022.1|1304897_1307006_+	Formate dehydrogenase-O, major subunit	NA	NA	NA	NA	NA
AZF57023.1|1307105_1307444_+	Glutaredoxin-related protein	NA	NA	NA	NA	NA
AZF57024.1|1307635_1308106_-	Bacterioferritin	NA	NA	NA	NA	NA
AZF57025.1|1308306_1308525_-	Bacterioferritin-associated ferredoxin	NA	NA	NA	NA	NA
AZF57026.1|1308590_1308749_-	hypothetical protein	NA	NA	NA	NA	NA
AZF57027.1|1308770_1309373_+	Alkyl hydroperoxide reductase subunit C-like protein	NA	NA	NA	NA	NA
AZF57028.1|1309438_1310113_-	Ribonuclease T	NA	NA	NA	NA	NA
AZF57029.1|1310109_1311156_-	Dihydroorotase	NA	NA	NA	NA	NA
AZF57030.1|1311312_1312221_+	Sodium-type flagellar protein motY precursor	NA	NA	NA	NA	NA
AZF57031.1|1312350_1313568_+	Argininosuccinate synthase	NA	NA	NA	NA	NA
AZF57032.1|1314195_1314828_+	Two-component transcriptional response regulator, LuxR family	NA	NA	NA	NA	NA
AZF57033.1|1314915_1315098_-	hypothetical protein	NA	NA	NA	NA	NA
AZF57034.1|1315204_1315843_-	Endonuclease III	NA	NA	NA	NA	NA
AZF57035.1|1315912_1316887_-	Electron transport complex protein RnfB	NA	NA	NA	NA	NA
AZF57036.1|1316974_1319026_-|tRNA	Methionyl-tRNA synthetase	tRNA	NA	NA	NA	NA
AZF57037.1|1319198_1320293_+	[4Fe-4S] cluster assembly scaffold protein Mrp (ApbC)	NA	NA	NA	NA	NA
AZF57038.1|1320746_1321070_-	4Fe-4S dicluster domain	NA	NA	NA	NA	NA
AZF57039.1|1321212_1323804_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	21.5	2.1e-28
AZF57040.1|1323987_1324359_-	hypothetical protein	NA	NA	NA	NA	NA
AZF57041.1|1324351_1324840_-	GepA protein	NA	D0UIM3	Aggregatibacter_phage	44.5	6.4e-27
AZF57042.1|1325103_1325838_+	Transcriptional regulator	NA	B5TK58	Pseudomonas_phage	87.3	1.1e-118
AZF57043.1|1326025_1326145_+	hypothetical protein	NA	NA	NA	NA	NA
AZF57044.1|1326428_1326767_+	Holin	NA	B5TK61	Pseudomonas_phage	81.8	2.8e-45
AZF57045.1|1326786_1327302_+	hypothetical protein	NA	NA	NA	NA	NA
AZF57046.1|1327305_1327914_+|plate	Baseplate assembly protein V	plate	A0A2H4JBW8	uncultured_Caudovirales_phage	52.3	8.5e-45
AZF57047.1|1327926_1328259_+|plate	Baseplate assembly protein W	plate	A0A2H4JI46	uncultured_Caudovirales_phage	69.1	1.0e-36
AZF57048.1|1328255_1329251_+|plate	Phage-related baseplate assembly protein	plate	A0A2H4JC04	uncultured_Caudovirales_phage	64.7	7.0e-113
AZF57049.1|1329247_1329886_+|tail	Phage tail fiber	tail	A0A2H4JDK0	uncultured_Caudovirales_phage	53.8	7.3e-39
AZF57050.1|1329882_1330413_+|tail	Phage tail fiber protein	tail	B0ZSG1	Halomonas_phage	56.2	1.4e-48
AZF57051.1|1330461_1331244_+	hypothetical protein	NA	NA	NA	NA	NA
AZF57052.1|1331246_1331549_+	Phage protein	NA	Q8H9M8	Vibrio_phage	48.1	4.7e-12
AZF57053.1|1331637_1331811_+	hypothetical protein	NA	NA	NA	NA	NA
AZF57054.1|1331813_1332980_+|tail	Major tail sheath protein	tail	B0ZSG8	Halomonas_phage	57.0	1.2e-124
AZF57055.1|1332979_1333486_+	hypothetical protein	NA	Q6R4W3	Vibrio_virus	35.1	3.8e-22
AZF57056.1|1333538_1334120_+	hypothetical protein	NA	B0ZSH0	Halomonas_phage	37.7	5.9e-27
AZF57057.1|1334116_1334242_+	hypothetical protein	NA	NA	NA	NA	NA
AZF57058.1|1334248_1336468_+|tail	Phage tail length tape-measure protein	tail	NA	NA	NA	NA
AZF57059.1|1336467_1336851_+|tail	Unclassified tail protein	tail	A0A2H4JAC8	uncultured_Caudovirales_phage	56.7	2.3e-35
AZF57060.1|1336843_1337056_+|tail	P2-like prophage tail protein X	tail	A0A2H4JGD9	uncultured_Caudovirales_phage	62.9	2.0e-17
AZF57061.1|1337065_1338067_+|tail	Phage tail protein D	tail	A0A2H4JH05	uncultured_Caudovirales_phage	56.0	3.6e-101
AZF57062.1|1338090_1338648_+	Lytic enzyme	NA	B5TK83	Pseudomonas_phage	71.0	6.8e-73
AZF57063.1|1338635_1339130_+	hypothetical protein	NA	A0A2H4IZW4	uncultured_Caudovirales_phage	59.5	2.6e-36
AZF57064.1|1339211_1339712_+	Nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	83.1	3.7e-70
AZF57065.1|1339795_1340854_+	RecA protein	NA	A0A0S2MVG1	Bacillus_phage	62.4	2.4e-111
>prophage 2
CP027761	Pseudomonas sp. R11-23-07 chromosome, complete genome	5689077	1365574	1375071	5689077	tRNA	Pseudomonas_phage(33.33%)	6	NA	NA
AZF57094.1|1365574_1367842_+	Sensor histidine kinase/response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	27.4	2.8e-08
AZF57095.1|1367838_1368849_+	Chemotaxis response regulator protein-glutamate methylesterase	NA	Q6XM27	Feldmannia_irregularis_virus	40.3	1.7e-05
AZF57096.1|1368901_1369903_+	Two-component transcriptional response regulator, LuxR family	NA	A0A127AWB9	Bacillus_phage	35.8	2.8e-16
AZF57097.1|1370365_1371733_-	Retron-type RNA-directed DNA polymerase	NA	A0A0U4J920	Pseudomonas_phage	32.5	3.4e-33
AZF57098.1|1372629_1373472_+	Peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	46.6	1.5e-07
AZF57099.1|1373568_1375071_+|tRNA	Lysyl-tRNA synthetase (class II)	tRNA	A0A2K9KZX5	Tupanvirus	39.4	1.6e-84
>prophage 3
CP027761	Pseudomonas sp. R11-23-07 chromosome, complete genome	5689077	1449719	1454707	5689077		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
AZF57172.1|1449719_1450469_+	5'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	49.4	2.1e-61
AZF57173.1|1450468_1451146_+	Protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	53.1	3.1e-43
AZF57174.1|1451355_1452192_+	Murein hydrolase activator NlpD	NA	A0A0S2SXL7	Bacillus_phage	33.3	8.2e-06
AZF57175.1|1452297_1453305_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	36.2	1.3e-34
AZF57176.1|1453543_1453753_-	Cold shock protein of CSP family	NA	Q9AZD3	Lactococcus_phage	66.7	2.2e-16
AZF57177.1|1454140_1454707_+	Deoxycytidine triphosphate deaminase	NA	S5VM63	Pseudomonas_phage	73.3	6.2e-74
>prophage 4
CP027761	Pseudomonas sp. R11-23-07 chromosome, complete genome	5689077	1669079	1735349	5689077	protease,tail,capsid,holin,plate,integrase,tRNA,head,terminase	Pseudomonas_virus(53.33%)	71	1659497:1659532	1743145:1743180
1659497:1659532	attL	TGCTATCGGGGGCAAGCCCCCTCCCACATTGGATCT	NA	NA	NA	NA
AZF57391.1|1669079_1669688_-|protease	SOS-response repressor and protease LexA	protease	A0A2H4JG58	uncultured_Caudovirales_phage	53.8	5.6e-12
AZF57392.1|1669951_1670659_+	putative transcriptional regulator for fatty acid degradation FadQ, TetR family	NA	NA	NA	NA	NA
AZF57393.1|1670794_1671805_+	beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
AZF57394.1|1671914_1675202_+	DNA/RNA helicase, SNF2 family	NA	V9XTV7	Choristoneura_murinana_nucleopolyhedrovirus	30.3	1.3e-46
AZF57395.1|1675413_1678104_-	DNA/RNA helicase, SNF2 family	NA	V9XTV7	Choristoneura_murinana_nucleopolyhedrovirus	31.3	5.1e-49
AZF57396.1|1678113_1678680_-	hypothetical protein	NA	NA	NA	NA	NA
AZF57397.1|1678691_1682141_-	Transcription-repair coupling factor	NA	NA	NA	NA	NA
AZF57398.1|1682481_1683945_+	NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AZF57399.1|1684883_1686278_+	Soluble pyridine nucleotide transhydrogenase	NA	NA	NA	NA	NA
AZF57400.1|1686320_1687043_-	Glycerophosphoryl diester phosphodiesterase	NA	A0A292GJA3	Xanthomonas_phage	30.9	1.9e-06
AZF57401.1|1687087_1687666_-	hypothetical protein	NA	NA	NA	NA	NA
AZF57402.1|1687649_1687823_-	hypothetical protein	NA	NA	NA	NA	NA
AZF57403.1|1687826_1689011_+	Lipoprotein releasing system transmembrane protein LolC	NA	NA	NA	NA	NA
AZF57404.1|1689003_1689702_+	Lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	42.3	1.4e-38
AZF57405.1|1689762_1691007_+	Lipoprotein releasing system transmembrane protein LolE	NA	NA	NA	NA	NA
AZF57406.1|1691106_1692453_-	Copper sensory histidine kinase CusS	NA	NA	NA	NA	NA
AZF57407.1|1692449_1693130_-	Copper-sensing two-component system response regulator CusR	NA	W8CYM9	Bacillus_phage	34.8	9.6e-29
AZF57408.1|1693285_1693798_+	Copper tolerance protein	NA	NA	NA	NA	NA
AZF57409.1|1693864_1694695_+	NADPH-dependent 7-cyano-7-deazaguanine reductase	NA	A0A2I7SAX1	Vibrio_phage	37.5	1.8e-37
AZF57410.1|1694833_1695100_-	Chromosome segregation ATPase	NA	NA	NA	NA	NA
AZF57411.1|1695210_1695819_-	Phosphonoacetaldehyde phosphonohydrolase-related protein	NA	NA	NA	NA	NA
AZF57412.1|1696015_1696705_+	Outer-membrane-phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AZF57413.1|1696767_1697064_-	hypothetical protein	NA	NA	NA	NA	NA
AZF57414.1|1697340_1698522_+	Serine phosphatase RsbU, regulator of sigma subunit	NA	NA	NA	NA	NA
AZF57415.1|1698521_1699004_+	Serine-protein kinase RsbW	NA	NA	NA	NA	NA
AZF57416.1|1699130_1700279_+	Mobile element protein	NA	NA	NA	NA	NA
AZF57417.1|1700479_1701406_-	Transaldolase	NA	A0A127KNC6	Cyanophage	34.8	5.3e-14
AZF57418.1|1701404_1701542_+	hypothetical protein	NA	NA	NA	NA	NA
AZF57419.1|1701687_1702626_-|tRNA	tRNA-dihydrouridine(20/20a) synthase	tRNA	NA	NA	NA	NA
AZF57420.1|1702783_1703953_+|integrase	integrase family protein	integrase	L7TP61	Pseudomonas_virus	62.5	9.4e-133
AZF57421.1|1704354_1704561_-	hypothetical protein	NA	NA	NA	NA	NA
AZF57422.1|1704557_1704905_-	Phage protein	NA	Q9ZXI7	Pseudomonas_virus	57.1	7.5e-30
AZF57423.1|1704930_1705749_-	hypothetical protein	NA	A0A077K8T2	Ralstonia_phage	34.2	1.7e-24
AZF57424.1|1705774_1708498_-	Phage protein	NA	A0A2H4J936	uncultured_Caudovirales_phage	51.3	1.6e-268
AZF57425.1|1708504_1708738_-	hypothetical protein	NA	NA	NA	NA	NA
AZF57426.1|1708814_1709186_-	hypothetical protein	NA	A0A2H4J947	uncultured_Caudovirales_phage	47.1	6.6e-16
AZF57427.1|1709185_1709482_-	hypothetical protein	NA	Q9ZXJ1	Pseudomonas_virus	71.3	4.3e-34
AZF57428.1|1709481_1709913_-	Phage protein	NA	A0A2H4JG61	uncultured_Caudovirales_phage	54.7	4.3e-35
AZF57429.1|1709981_1710194_-	hypothetical protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	49.2	3.4e-09
AZF57430.1|1711091_1711250_+	hypothetical protein	NA	NA	NA	NA	NA
AZF57431.1|1711302_1712571_-	hypothetical protein	NA	Q9ZXJ8	Pseudomonas_virus	79.5	1.2e-189
AZF57432.1|1712567_1713008_-|tail	Phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	74.7	7.0e-57
AZF57433.1|1713013_1716700_-|tail	Phage tail length tape-measure protein	tail	E5FFG5	Burkholderia_phage	30.6	9.6e-107
AZF57434.1|1716689_1716809_-|tail	Phage tail protein GpE, GpE'	tail	Q9ZXK1	Pseudomonas_virus	76.9	6.5e-10
AZF57435.1|1716817_1717153_-|tail	Phage tail fiber	tail	Q9ZXK2	Pseudomonas_virus	59.5	6.0e-24
AZF57436.1|1717202_1717718_-|tail	Phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	78.4	1.9e-74
AZF57437.1|1717775_1718945_-|tail	Phage tail sheath monomer	tail	Q9ZXK4	Pseudomonas_virus	73.8	3.8e-166
AZF57438.1|1719050_1719440_-	phage protein	NA	Q9ZXK5	Pseudomonas_virus	49.3	3.0e-11
AZF57439.1|1719450_1721337_-|tail	Phage tail fiber protein	tail	A4PE45	Ralstonia_virus	53.4	2.5e-71
AZF57440.1|1721333_1722035_-|tail	Phage tail fiber	tail	A0A2H4JAU2	uncultured_Caudovirales_phage	71.8	1.0e-70
AZF57441.1|1722034_1722946_-|plate	Baseplate assembly protein J	plate	Q9ZXK8	Pseudomonas_virus	76.1	1.3e-124
AZF57442.1|1722942_1723287_-|plate	Phage baseplate assembly protein	plate	Q9ZXK9	Pseudomonas_virus	66.4	1.3e-37
AZF57443.1|1723283_1723862_-|plate	Baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	58.2	6.0e-56
AZF57444.1|1723923_1724382_-|tail	Phage tail completion protein	tail	Q9ZXL2	Pseudomonas_virus	62.0	1.5e-46
AZF57445.1|1724371_1724854_-|tail	Phage tail protein	tail	Q9ZXL3	Pseudomonas_virus	63.2	1.6e-41
AZF57446.1|1724850_1724991_-	hypothetical protein	NA	NA	NA	NA	NA
AZF57447.1|1724950_1725394_-	Phage spanin Rz LysB	NA	Q9ZXL5	Pseudomonas_virus	54.3	1.1e-28
AZF57448.1|1725390_1725594_-	hypothetical protein	NA	NA	NA	NA	NA
AZF57449.1|1725590_1726436_-	Putative phage-encoded peptidoglycan binding protein	NA	Q9ZXL6	Pseudomonas_virus	70.8	5.1e-104
AZF57450.1|1726432_1726711_-|holin	Putative holin	holin	Q9ZXL7	Pseudomonas_virus	68.6	2.1e-22
AZF57451.1|1726712_1727066_-|holin	Phage holin or membrane protein	holin	Q9ZXL8	Pseudomonas_virus	58.1	2.9e-29
AZF57452.1|1727093_1727306_-|tail	Unclassified tail protein	tail	Q9ZXL9	Pseudomonas_virus	74.2	9.3e-23
AZF57453.1|1727305_1727767_-|head	Phage head completion protein	head	Q9ZXM1	Pseudomonas_virus	60.8	1.6e-48
AZF57454.1|1727763_1728060_-	hypothetical protein	NA	E5FFG0	Burkholderia_phage	52.6	3.8e-06
AZF57455.1|1728158_1728860_-|terminase	Phage terminase, endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	71.6	4.7e-87
AZF57456.1|1728864_1729887_-|capsid	Phage major capsid protein	capsid	Q9ZXM3	Pseudomonas_virus	61.8	1.9e-121
AZF57457.1|1729927_1730758_-|capsid	Phage capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	54.7	1.7e-72
AZF57458.1|1730913_1732671_+|terminase	Phage terminase, ATPase subunit	terminase	Q9ZXM5	Pseudomonas_virus	80.9	1.1e-286
AZF57459.1|1732670_1733720_+|capsid	Phage-related capsid packaging protein	capsid	A0A2H4J922	uncultured_Caudovirales_phage	76.4	1.4e-143
AZF57460.1|1733877_1734672_+	Dam modification methylase	NA	C7BGE1	Burkholderia_phage	66.5	1.3e-101
AZF57461.1|1734668_1735349_-	Gifsy-2 prophage protein	NA	A0A2H4J991	uncultured_Caudovirales_phage	89.3	3.3e-122
1743145:1743180	attR	TGCTATCGGGGGCAAGCCCCCTCCCACATTGGATCT	NA	NA	NA	NA
>prophage 5
CP027761	Pseudomonas sp. R11-23-07 chromosome, complete genome	5689077	3267520	3277521	5689077	tRNA	uncultured_Caudovirales_phage(71.43%)	12	NA	NA
AZF58835.1|3267520_3268345_-|tRNA	tRNA(Cytosine32)-2-thiocytidine synthetase	tRNA	A0A0U2S5Z2	Escherichia_phage	71.6	2.0e-105
AZF58836.1|3268640_3269243_+	Inner membrane protein YohC	NA	NA	NA	NA	NA
AZF58837.1|3269371_3269866_+	Protein SprT	NA	NA	NA	NA	NA
AZF58838.1|3269959_3271135_-	Alpha-methylacyl-CoA racemase	NA	NA	NA	NA	NA
AZF58839.1|3271294_3271687_+|tRNA	tRNA 5-methylaminomethyl-2-thiouridine synthase subunit TusD	tRNA	A0A2H4JA39	uncultured_Caudovirales_phage	83.7	2.6e-55
AZF58840.1|3271688_3272039_+|tRNA	tRNA 5-methylaminomethyl-2-thiouridine synthase subunit TusC	tRNA	A0A2H4J8C0	uncultured_Caudovirales_phage	71.1	6.9e-39
AZF58841.1|3272038_3272317_+|tRNA	tRNA 5-methylaminomethyl-2-thiouridine synthase TusB	tRNA	A0A2H4JG28	uncultured_Caudovirales_phage	59.6	1.7e-24
AZF58842.1|3272313_3272649_+|tRNA	tRNA 2-thiouridine synthesis protein TusE	tRNA	A0A2H4J8B6	uncultured_Caudovirales_phage	73.0	4.4e-43
AZF58843.1|3272645_3273647_+	Anthranilate phosphoribosyltransferase like	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	86.6	9.1e-169
AZF58844.1|3273735_3274731_+	Glutathione S-transferase, omega	NA	NA	NA	NA	NA
AZF58845.1|3274845_3276240_-	Precorrin-2 oxidase	NA	NA	NA	NA	NA
AZF58846.1|3276240_3277521_-|tRNA	Seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	53.3	8.2e-98
>prophage 6
CP027761	Pseudomonas sp. R11-23-07 chromosome, complete genome	5689077	5291488	5302666	5689077		Mannheimia_phage(33.33%)	9	NA	NA
AZF60661.1|5291488_5291767_+	HigB toxin protein	NA	A0A0M3LQB1	Mannheimia_phage	39.1	7.1e-15
AZF60662.1|5291781_5292069_+	Antitoxin HigA	NA	A0A0M3LPV0	Mannheimia_phage	51.7	8.4e-19
AZF60663.1|5292257_5292662_-	hypothetical protein	NA	NA	NA	NA	NA
AZF60664.1|5292639_5292990_-	hypothetical protein	NA	NA	NA	NA	NA
AZF60665.1|5293354_5293810_-	chemotaxis protein, putative	NA	NA	NA	NA	NA
AZF60666.1|5293802_5299616_-	Signal transduction histidine kinase CheA	NA	W8CYM9	Bacillus_phage	35.9	3.7e-12
AZF60667.1|5299715_5301767_-	Methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.5	2.1e-18
AZF60668.1|5301763_5302288_-	type IV pili signal transduction protein PilI	NA	Q56AR1	Bacillus_thuringiensis_phage	35.6	2.0e-05
AZF60669.1|5302300_5302666_-	twitching motility protein PilH	NA	W8CYM9	Bacillus_phage	34.2	4.4e-12
