The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027751	Pseudomonas chlororaphis subsp. aureofaciens strain ChPhzTR18 chromosome, complete genome	6873200	1310451	1401287	6873200	protease,plate,tail,tRNA	Pseudomonas_phage(42.31%)	96	NA	NA
AZE34249.1|1310451_1311804_+|protease	Intramembrane protease RasP/YluC, implicated in cell division based on FtsL cleavage	protease	NA	NA	NA	NA
AZE34250.1|1311878_1314266_+	Outer membrane protein assembly factor YaeT	NA	NA	NA	NA	NA
AZE34251.1|1314311_1314815_+	Outer membrane chaperone Skp, precursor	NA	NA	NA	NA	NA
AZE34252.1|1314818_1315874_+	UDP-3-O-[3-hydroxymyristoyl] glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AZE34253.1|1315983_1316424_+	3-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
AZE34254.1|1316420_1317197_+	Acyl-ADP--UDP-N- acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AZE34255.1|1317199_1318330_+	Lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AZE34256.1|1318341_1318974_+	Ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	38.9	1.7e-27
AZE34257.1|1319043_1322568_+	DNA polymerase III alpha subunit	NA	A0A2L1IZ23	Streptomyces_phage	38.0	1.4e-195
AZE34258.1|1322708_1323656_+	Acetyl-coenzyme A carboxyl transferase alpha chain	NA	NA	NA	NA	NA
AZE34259.1|1323775_1325104_+|tRNA	tRNA(Ile)-lysidine synthetase	tRNA	NA	NA	NA	NA
AZE34260.1|1325149_1325293_+	hypothetical protein	NA	NA	NA	NA	NA
AZE34261.1|1325378_1327010_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.5	6.9e-158
AZE34262.1|1327015_1327861_+	2-Keto-3-deoxy-D-manno-octulosonate-8-phosphate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.8	9.4e-50
AZE34263.1|1328018_1329308_+	Enolase	NA	A0A1X9I5Z8	Streptococcus_phage	59.2	9.0e-137
AZE34264.1|1329480_1329759_+	Cell division protein DivIC (FtsB), stabilizes FtsL against RasP cleavage	NA	NA	NA	NA	NA
AZE34265.1|1329755_1330463_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AZE34266.1|1330632_1331529_-	Transcriptional regulator, LysR family, in formaldehyde detoxification operon	NA	NA	NA	NA	NA
AZE34267.1|1331635_1332748_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.2	8.3e-30
AZE34268.1|1332836_1333682_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AZE34269.1|1333734_1334208_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
AZE34270.1|1334204_1335263_+|tRNA	tRNA pseudouridine(13) synthase	tRNA	NA	NA	NA	NA
AZE34271.1|1335250_1336000_+	5'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.6	1.4e-68
AZE34272.1|1335999_1336677_+	Protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.0	6.8e-43
AZE34273.1|1336886_1337720_+	Murein hydrolase activator NlpD	NA	A0A0S2SXL7	Bacillus_phage	33.3	6.3e-06
AZE34274.1|1337826_1338831_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	35.8	5.0e-34
AZE34275.1|1339331_1339655_-	4Fe-4S dicluster domain	NA	NA	NA	NA	NA
AZE34276.1|1339797_1342377_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	23.5	3.1e-27
AZE34277.1|1342573_1343299_+	Transcriptional regulator	NA	B5TK58	Pseudomonas_phage	91.4	1.3e-124
AZE34278.1|1343854_1344283_+	hypothetical protein	NA	NA	NA	NA	NA
AZE34279.1|1344643_1345225_+	hypothetical protein	NA	NA	NA	NA	NA
AZE34280.1|1345327_1345675_+	Holin	NA	B5TK61	Pseudomonas_phage	87.7	1.0e-50
AZE34281.1|1345841_1346606_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	26.3	2.0e-06
AZE34282.1|1346831_1347356_+	hypothetical protein	NA	NA	NA	NA	NA
AZE34283.1|1347359_1347968_+|plate	Baseplate assembly protein V	plate	A0A2H4JBW8	uncultured_Caudovirales_phage	59.1	1.8e-47
AZE34284.1|1347981_1348314_+|plate	Baseplate assembly protein W	plate	A0A2H4JI46	uncultured_Caudovirales_phage	69.1	2.1e-37
AZE34285.1|1348310_1349306_+|plate	Phage-related baseplate assembly protein	plate	A0A2H4JC04	uncultured_Caudovirales_phage	62.3	8.9e-108
AZE34286.1|1349302_1350037_+|tail	Phage tail fiber	tail	A0A2H4JDK0	uncultured_Caudovirales_phage	51.4	3.4e-40
AZE34287.1|1350033_1350564_+|tail	Phage tail fiber	tail	A2I2X8	Vibrio_virus	61.9	3.4e-50
AZE34288.1|1351143_1351473_+	hypothetical protein	NA	NA	NA	NA	NA
AZE34289.1|1351475_1351778_+	Phage protein	NA	Q8H9M8	Vibrio_phage	64.6	1.8e-11
AZE34290.1|1351864_1352086_+	hypothetical protein	NA	NA	NA	NA	NA
AZE34291.1|1352088_1353255_+|tail	Major tail sheath protein	tail	B0ZSG8	Halomonas_phage	57.5	1.4e-125
AZE34292.1|1353254_1353761_+	hypothetical protein	NA	Q6R4W3	Vibrio_virus	35.7	2.6e-23
AZE34293.1|1353887_1354499_+	hypothetical protein	NA	B0ZSH0	Halomonas_phage	36.4	1.5e-25
AZE34294.1|1354495_1354621_+	hypothetical protein	NA	NA	NA	NA	NA
AZE34295.1|1354627_1356835_+	Phage protein	NA	A0A2H4JAA5	uncultured_Caudovirales_phage	49.3	7.2e-09
AZE34296.1|1356834_1357218_+|tail	Unclassified tail protein	tail	A0A2H4JAC8	uncultured_Caudovirales_phage	59.8	4.0e-40
AZE34297.1|1357210_1357423_+|tail	P2-like prophage tail protein X	tail	A0A2H4JGD9	uncultured_Caudovirales_phage	61.4	6.9e-18
AZE34298.1|1357432_1358449_+|tail	Phage tail protein D	tail	A0A2H4JH05	uncultured_Caudovirales_phage	56.6	1.0e-106
AZE34299.1|1358591_1359176_+	hypothetical protein	NA	B5TK65	Pseudomonas_phage	72.5	3.1e-76
AZE34300.1|1359172_1359355_+	Mu-like prophage FluMu protein GP38	NA	B5TK66	Pseudomonas_phage	93.3	6.5e-25
AZE34301.1|1359354_1360851_+|tail	Bacteriophage tail sheath protein	tail	B5TK67	Pseudomonas_phage	91.0	2.0e-257
AZE34302.1|1360917_1361265_+|tail	Phage tail tube protein	tail	B5TK68	Pseudomonas_phage	93.9	2.9e-58
AZE34303.1|1361261_1361558_+|tail	Phage small tail protein E	tail	B5TK69	Pseudomonas_phage	94.9	2.3e-43
AZE34304.1|1361688_1363764_+|tail	Phage tail length tape-measure protein	tail	B5TK70	Pseudomonas_phage	48.2	1.8e-38
AZE34305.1|1363750_1364989_+|tail	Phage tail/DNA circulation protein	tail	B5TK71	Pseudomonas_phage	75.7	5.7e-181
AZE34306.1|1364992_1366033_+|tail	Prophage tail protein	tail	B5TK72	Pseudomonas_phage	82.7	3.8e-162
AZE34307.1|1366149_1366659_+|plate	Prophage baseplate assembly protein V	plate	B5TK73	Pseudomonas_phage	88.8	2.2e-78
AZE34308.1|1366658_1367057_+	Bacteriophage protein GP46	NA	B5TK74	Pseudomonas_phage	89.4	1.7e-65
AZE34309.1|1367046_1368087_+	Phage FluMu protein gp47	NA	B5TK75	Pseudomonas_phage	87.3	3.0e-167
AZE34310.1|1368074_1368674_+|tail	Prophage tail protein	tail	B5TK76	Pseudomonas_phage	91.0	2.5e-105
AZE34311.1|1368685_1369540_+|tail	Prophage tail fiber protein	tail	B5TK77	Pseudomonas_phage	76.4	1.5e-23
AZE34312.1|1369544_1370186_+|tail	putative tail fiber assembly-like protein	tail	B5TK78	Pseudomonas_phage	51.9	1.4e-37
AZE34313.1|1370317_1371238_+|tail	Prophage tail fiber protein	tail	B5TK77	Pseudomonas_phage	61.1	7.4e-24
AZE34314.1|1371237_1371717_+	hypothetical protein	NA	A0A291LAV4	Bordetella_phage	52.1	1.3e-11
AZE34315.1|1371876_1372779_+|tail	Prophage tail fiber protein	tail	B5TK81	Pseudomonas_phage	37.6	1.8e-35
AZE34316.1|1373330_1374071_+|tail	Prophage tail fiber protein	tail	B5TK77	Pseudomonas_phage	65.8	2.1e-21
AZE34317.1|1374073_1374505_+	hypothetical protein	NA	Q9ZXK5	Pseudomonas_virus	38.4	2.2e-23
AZE34318.1|1374550_1375114_+	Lytic enzyme	NA	B5TK83	Pseudomonas_phage	83.3	3.7e-87
AZE34319.1|1375095_1375632_+	hypothetical protein	NA	B5TK84	Pseudomonas_phage	71.3	6.3e-60
AZE34320.1|1375714_1376215_+	Nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	86.1	1.0e-72
AZE34321.1|1376298_1377351_+	RecA protein	NA	A0A0S2MVG1	Bacillus_phage	60.9	4.4e-113
AZE34322.1|1377359_1377827_+	Regulatory protein RecX	NA	NA	NA	NA	NA
AZE34323.1|1377872_1378988_-	Decarboxylase family protein	NA	NA	NA	NA	NA
AZE34324.1|1379471_1379666_+	hypothetical protein	NA	NA	NA	NA	NA
AZE34325.1|1379667_1380090_-	Putative NADPH-quinone reductase (modulator of drug activity B)	NA	NA	NA	NA	NA
AZE34326.1|1380279_1380990_+	putative conserved protein YfiP, contains DTW domain	NA	NA	NA	NA	NA
AZE34327.1|1381324_1381975_+	Transcriptional regulator, LuxR family	NA	NA	NA	NA	NA
AZE34328.1|1382051_1382414_+	Diacylglycerol kinase	NA	NA	NA	NA	NA
AZE34329.1|1382410_1383337_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZE34330.1|1383470_1384250_+	Ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AZE34331.1|1384322_1385018_-	S-adenosylmethionine-dependent methyltransferase YaeB	NA	NA	NA	NA	NA
AZE34332.1|1385104_1385875_-	Rhamnolipid biosynthesis 3-oxoacyl-ACP reductase RhlG	NA	NA	NA	NA	NA
AZE34333.1|1386008_1386470_-	Uncharacterized protein YehS	NA	Q9EYF4	Enterobacteria_phage	51.3	8.5e-37
AZE34334.1|1386536_1387247_-	Ribosomal large subunit pseudouridine synthase F	NA	NA	NA	NA	NA
AZE34335.1|1387329_1387803_-	Acetyltransferase	NA	NA	NA	NA	NA
AZE34336.1|1387909_1389247_-	Ribosomal protein S12p Asp88 methylthiotransferase	NA	NA	NA	NA	NA
AZE34337.1|1389347_1389617_-	hypothetical protein	NA	NA	NA	NA	NA
AZE34338.1|1389638_1391480_+	Kup system potassium uptake protein	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	35.0	8.0e-78
AZE34339.1|1391679_1391955_-	hypothetical protein	NA	NA	NA	NA	NA
AZE34340.1|1392452_1393748_-	Alanylphosphatidylglycerol hydrolase, periplasmic	NA	NA	NA	NA	NA
AZE34341.1|1393747_1396396_-	Alanylphosphatidylglycerol synthase	NA	NA	NA	NA	NA
AZE34342.1|1397334_1398399_+	DNA polymerase IV	NA	NA	NA	NA	NA
AZE34343.1|1398600_1399554_-	putative lipoprotein	NA	NA	NA	NA	NA
AZE34344.1|1399571_1401287_-|tRNA	Prolyl-tRNA synthetase, bacterial type	tRNA	NA	NA	NA	NA
>prophage 2
CP027751	Pseudomonas chlororaphis subsp. aureofaciens strain ChPhzTR18 chromosome, complete genome	6873200	2261502	2269565	6873200		Pseudomonas_phage(50.0%)	8	NA	NA
AZE35117.1|2261502_2262459_-	hypothetical protein	NA	W6MYA3	Pseudomonas_phage	31.2	1.9e-27
AZE35118.1|2262668_2263538_-	Integrase	NA	A0A2H4J1K3	uncultured_Caudovirales_phage	91.3	2.0e-151
AZE35119.1|2264105_2264744_+	hypothetical protein	NA	A0A059VFX9	Pseudomonas_phage	60.1	4.0e-61
AZE35120.1|2264923_2266021_+	hypothetical protein	NA	W6MVL2	Pseudomonas_phage	29.5	2.9e-27
AZE35121.1|2266204_2266543_+	Cell wall hydrolase	NA	A0A2D1GNI1	Pseudomonas_phage	71.4	1.9e-46
AZE35122.1|2266542_2267061_+	hypothetical protein	NA	A0A2H4IZW4	uncultured_Caudovirales_phage	64.5	4.2e-53
AZE35123.1|2267064_2267772_-	Gifsy-2 prophage protein	NA	A0A2H4J991	uncultured_Caudovirales_phage	70.0	8.3e-92
AZE35124.1|2268167_2269565_-	Transposase	NA	W5R8L2	Staphylococcus_phage	32.5	2.2e-40
>prophage 3
CP027751	Pseudomonas chlororaphis subsp. aureofaciens strain ChPhzTR18 chromosome, complete genome	6873200	2352157	2390790	6873200	transposase,capsid,terminase,tail,plate	Pseudomonas_phage(35.14%)	53	NA	NA
AZE35211.1|2352157_2352448_-	putative antitoxin	NA	A4JWV1	Burkholderia_virus	42.4	1.9e-10
AZE35212.1|2352449_2352743_-	putative toxin	NA	A0A141GEX6	Brucella_phage	55.9	6.4e-22
AZE35213.1|2352977_2354372_-	Uncharacterized protein YdcJ	NA	NA	NA	NA	NA
AZE35214.1|2354636_2355761_+	Two-component response regulator	NA	A0A127AWB9	Bacillus_phage	39.7	1.9e-18
AZE35215.1|2355854_2355953_+	hypothetical protein	NA	NA	NA	NA	NA
AZE35216.1|2356472_2357540_-|tail	Prophage tail fiber protein	tail	A4JWL8	Burkholderia_virus	28.7	1.2e-22
AZE35217.1|2357539_2358121_-	hypothetical protein	NA	Q6QI98	Burkholderia_phage	54.6	1.0e-47
AZE35218.1|2358113_2359235_-|plate	Phage baseplate	plate	A4JWL6	Burkholderia_virus	48.0	3.4e-87
AZE35219.1|2359218_2359596_-|plate	putative bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	56.0	1.5e-31
AZE35220.1|2359702_2360446_+	hypothetical protein	NA	NA	NA	NA	NA
AZE35221.1|2360433_2360985_-|plate	Phage baseplate protein	plate	NA	NA	NA	NA
AZE35222.1|2360984_2362100_-|tail	Putative tail protein D	tail	Q6QIA2	Burkholderia_phage	38.1	2.4e-61
AZE35223.1|2362087_2362294_-|tail	Phage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	61.4	2.1e-16
AZE35224.1|2362293_2363175_-	hypothetical protein	NA	A0A067ZI88	Vibrio_phage	34.1	3.5e-07
AZE35225.1|2363174_2365571_-|tail	Phage tail length tape-measure protein	tail	A4JWL0	Burkholderia_virus	38.3	2.3e-133
AZE35226.1|2365847_2365961_-	hypothetical protein	NA	NA	NA	NA	NA
AZE35227.1|2365947_2366262_-	hypothetical protein	NA	NA	NA	NA	NA
AZE35228.1|2366403_2367108_+	hypothetical protein	NA	NA	NA	NA	NA
AZE35229.1|2367149_2367674_-|tail	Phage tail connector protein	tail	Q6QIA9	Burkholderia_phage	49.4	6.6e-46
AZE35230.1|2367674_2369099_-|tail	Phage tail sheath monomer	tail	A4JWK5	Burkholderia_virus	64.5	2.2e-176
AZE35231.1|2369105_2369339_-	hypothetical protein	NA	NA	NA	NA	NA
AZE35232.1|2369335_2369818_-	hypothetical protein	NA	NA	NA	NA	NA
AZE35233.1|2369817_2370252_-	Mu-like prophage FluMu protein gp36	NA	Q6QIB3	Burkholderia_phage	57.3	4.4e-43
AZE35234.1|2370254_2371235_-	phage-related protein, putative	NA	A0A2H4J890	uncultured_Caudovirales_phage	39.8	9.8e-59
AZE35235.1|2371248_2371617_-	hypothetical protein	NA	NA	NA	NA	NA
AZE35236.1|2371625_2372648_-	Phage protein	NA	A4JWJ9	Burkholderia_virus	47.2	1.1e-76
AZE35237.1|2373280_2373757_-|capsid	Phage capsid and scaffold	capsid	Q6QIB8	Burkholderia_phage	40.1	6.7e-21
AZE35238.1|2373758_2374598_-	Phage (Mu-like) virion morphogenesis protein	NA	A0A1C6ZDL9	Pseudomonas_phage	59.4	8.1e-86
AZE35239.1|2374597_2376094_-	Mu-like prophage FluMu protein gp29	NA	Q6QIC0	Burkholderia_phage	57.3	7.7e-156
AZE35240.1|2376090_2377419_-	Mu-like prophage FluMu protein gp28	NA	A0A2P9JZI8	Alteromonadaceae_phage	65.0	4.9e-154
AZE35241.1|2377415_2377925_-|terminase	Phage terminase, small subunit	terminase	J9SH37	Pseudomonas_phage	43.5	7.7e-23
AZE35242.1|2377962_2378256_-	hypothetical protein	NA	J9SNG3	Pseudomonas_phage	62.2	2.6e-23
AZE35243.1|2378252_2378558_-	hypothetical protein	NA	J9STR5	Pseudomonas_phage	41.7	5.1e-14
AZE35244.1|2378779_2379379_-	Phage lipoprotein	NA	A0A0S4L1H0	Pseudomonas_phage	49.5	5.8e-38
AZE35245.1|2379368_2379569_-	hypothetical protein	NA	NA	NA	NA	NA
AZE35246.1|2379565_2379805_-	hypothetical protein	NA	NA	NA	NA	NA
AZE35247.1|2379801_2380269_-|capsid	Phage capsid and scaffold	capsid	J9Q7Y7	Salmonella_phage	54.0	7.0e-39
AZE35248.1|2380680_2380812_+	hypothetical protein	NA	NA	NA	NA	NA
AZE35249.1|2381215_2381806_-	hypothetical protein	NA	NA	NA	NA	NA
AZE35250.1|2382311_2382524_+	Phage DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	76.8	4.2e-23
AZE35251.1|2382915_2383395_+	Phage protein	NA	Q6QID6	Burkholderia_phage	65.2	8.5e-56
AZE35252.1|2383391_2383694_+	Transcriptional regulator, IclR family	NA	Q5ZR02	Pseudomonas_phage	64.9	1.7e-25
AZE35253.1|2383704_2384640_+	DNA repair ATPase	NA	J9SND0	Pseudomonas_phage	48.7	1.3e-65
AZE35254.1|2384643_2386419_+|transposase	Phage transposase	transposase	A0A0S4L2U5	Pseudomonas_phage	59.3	3.2e-193
AZE35255.1|2386418_2387600_+	Eha	NA	Q6QIE1	Burkholderia_phage	61.9	4.9e-129
AZE35256.1|2387601_2387922_+	hypothetical protein	NA	J9SNT1	Pseudomonas_phage	41.6	9.4e-11
AZE35257.1|2387914_2388199_+	hypothetical protein	NA	J9STZ0	Pseudomonas_phage	39.6	9.2e-10
AZE35258.1|2388198_2388678_+	hypothetical protein	NA	NA	NA	NA	NA
AZE35259.1|2388670_2389288_+	hypothetical protein	NA	Q5ZR10	Pseudomonas_phage	38.1	1.5e-41
AZE35260.1|2389289_2389679_+	hypothetical protein	NA	A0A1I9LJN3	Stx_converting_phage	32.5	1.5e-07
AZE35261.1|2389680_2390121_+	hypothetical protein	NA	A0A076FX15	Pseudomonas_phage	53.1	4.3e-38
AZE35262.1|2390122_2390341_+	hypothetical protein	NA	NA	NA	NA	NA
AZE35263.1|2390337_2390790_+	hypothetical protein	NA	Q6QIE7	Burkholderia_phage	55.1	3.7e-29
>prophage 4
CP027751	Pseudomonas chlororaphis subsp. aureofaciens strain ChPhzTR18 chromosome, complete genome	6873200	3857043	3890035	6873200	protease,integrase,terminase,tail,plate	uncultured_Caudovirales_phage(70.37%)	46	3877648:3877669	3898046:3898067
AZE36608.1|3857043_3857595_-	Phage endolysin	NA	A0A2H4JHX4	uncultured_Caudovirales_phage	68.7	5.5e-67
AZE36609.1|3857618_3858671_-|tail	Phage tail protein D	tail	A0A2H4JBF6	uncultured_Caudovirales_phage	74.9	9.3e-148
AZE36610.1|3858728_3858935_-|tail	Phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	68.7	7.1e-20
AZE36611.1|3858909_3859755_-	Phage protein U	NA	A0A2H4J875	uncultured_Caudovirales_phage	58.2	6.6e-88
AZE36612.1|3859764_3862302_-	Phage protein	NA	A0A2H4JG00	uncultured_Caudovirales_phage	37.3	6.9e-80
AZE36613.1|3862433_3862730_-	hypothetical protein	NA	A0A2H4J873	uncultured_Caudovirales_phage	57.4	2.7e-20
AZE36614.1|3862757_3863267_-|tail	Phage major tail tube protein	tail	A0A2H4JBU0	uncultured_Caudovirales_phage	73.1	4.3e-66
AZE36615.1|3863279_3864446_-|tail	Phage tail sheath monomer	tail	A0A2H4J869	uncultured_Caudovirales_phage	81.8	2.9e-182
AZE36616.1|3864986_3866546_-|tail	Phage tail fiber protein	tail	A0A077K818	Ralstonia_phage	53.7	4.4e-69
AZE36617.1|3866538_3867147_-|tail	Phage tail fiber	tail	A0A2H4JDH5	uncultured_Caudovirales_phage	72.2	1.4e-79
AZE36618.1|3867148_3868030_-|plate	Baseplate assembly protein J	plate	A0A2H4JFK9	uncultured_Caudovirales_phage	70.0	5.8e-111
AZE36619.1|3868026_3868353_-|plate	Phage baseplate assembly protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	65.1	6.2e-34
AZE36620.1|3868355_3868571_-	hypothetical protein	NA	NA	NA	NA	NA
AZE36621.1|3868614_3869196_-|plate	Baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	64.6	1.8e-55
AZE36622.1|3869192_3869726_-	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	41.8	1.4e-35
AZE36623.1|3869718_3870381_-	hypothetical protein	NA	A0A2H4JBV1	uncultured_Caudovirales_phage	59.6	1.7e-70
AZE36624.1|3870377_3870698_-	hypothetical protein	NA	NA	NA	NA	NA
AZE36625.1|3870700_3870880_-	hypothetical protein	NA	NA	NA	NA	NA
AZE36626.1|3870881_3871913_-	hypothetical protein	NA	A0A0C5ABI0	Bacteriophage	40.9	2.7e-67
AZE36627.1|3871924_3872275_-	hypothetical protein	NA	NA	NA	NA	NA
AZE36628.1|3872287_3873508_-|protease	Periplasmic serine protease (ClpP class)	protease	A0A219YB02	Aeromonas_phage	42.3	1.5e-48
AZE36629.1|3873510_3875118_-	hypothetical protein	NA	A0A067ZJA4	Vibrio_phage	42.0	2.0e-93
AZE36630.1|3875120_3875336_-	hypothetical protein	NA	NA	NA	NA	NA
AZE36631.1|3875348_3877274_-|terminase	Phage terminase, large subunit	terminase	A0A2D1GMT1	Marinobacter_phage	48.4	6.9e-165
AZE36632.1|3877278_3877800_-|terminase	Phage DNA packaging protein, Nu1 subunit of terminase	terminase	NA	NA	NA	NA
3877648:3877669	attL	TTCGATCACCGCCTGGGTGTCG	NA	NA	NA	NA
AZE36633.1|3877993_3878299_-	hypothetical protein	NA	A0A2H4JBW4	uncultured_Caudovirales_phage	52.9	3.6e-20
AZE36634.1|3878418_3878667_+	hypothetical protein	NA	A0A2H4J888	uncultured_Caudovirales_phage	56.1	2.0e-16
AZE36635.1|3878714_3879062_-	Holin	NA	A0A2H4J893	uncultured_Caudovirales_phage	84.1	3.7e-45
AZE36636.1|3879198_3879495_+	hypothetical protein	NA	NA	NA	NA	NA
AZE36637.1|3879992_3880355_-	hypothetical protein	NA	NA	NA	NA	NA
AZE36638.1|3880347_3882564_-	DNA primase, phage associated	NA	A0A2D1GN57	Marinobacter_phage	47.1	1.9e-190
AZE36639.1|3882553_3882781_-	hypothetical protein	NA	A0A218M4I6	Erwinia_phage	44.0	7.6e-07
AZE36640.1|3882773_3883292_-	hypothetical protein	NA	NA	NA	NA	NA
AZE36641.1|3883964_3884696_+	repressor protein c2	NA	A5VW98	Enterobacteria_phage	38.7	2.9e-31
AZE36642.1|3884710_3885355_-	hypothetical protein	NA	NA	NA	NA	NA
AZE36643.1|3885347_3885902_-	hypothetical protein	NA	NA	NA	NA	NA
AZE36644.1|3886131_3886308_+	hypothetical protein	NA	NA	NA	NA	NA
AZE36645.1|3886304_3886895_+	hypothetical protein	NA	NA	NA	NA	NA
AZE36646.1|3886905_3887196_+	DNA-binding protein Roi-related protein	NA	NA	NA	NA	NA
AZE36647.1|3887354_3887672_+	transcriptional regulator, putative	NA	NA	NA	NA	NA
AZE36648.1|3887720_3888140_+	hypothetical protein	NA	NA	NA	NA	NA
AZE36649.1|3888136_3888358_+	hypothetical protein	NA	NA	NA	NA	NA
AZE36650.1|3888354_3888444_+	hypothetical protein	NA	NA	NA	NA	NA
AZE36651.1|3888440_3888731_+	C-5 cytosine-specific DNA methylase	NA	NA	NA	NA	NA
AZE36652.1|3888730_3888967_+	Phage protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	71.4	1.3e-25
AZE36653.1|3888970_3890035_+|integrase	Phage-related integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	61.1	2.8e-115
3898046:3898067	attR	CGACACCCAGGCGGTGATCGAA	NA	NA	NA	NA
>prophage 5
CP027751	Pseudomonas chlororaphis subsp. aureofaciens strain ChPhzTR18 chromosome, complete genome	6873200	4317364	4323623	6873200	tRNA	uncultured_Caudovirales_phage(83.33%)	8	NA	NA
AZE37020.1|4317364_4317757_+|tRNA	tRNA 5-methylaminomethyl-2-thiouridine synthase subunit TusD	tRNA	A0A2H4JA39	uncultured_Caudovirales_phage	84.6	6.7e-59
AZE37021.1|4317760_4318123_+|tRNA	tRNA 5-methylaminomethyl-2-thiouridine synthase subunit TusC	tRNA	A0A2H4J8C0	uncultured_Caudovirales_phage	75.0	2.5e-44
AZE37022.1|4318122_4318422_+|tRNA	tRNA 5-methylaminomethyl-2-thiouridine synthase subunit TusB	tRNA	A0A2H4JG28	uncultured_Caudovirales_phage	69.7	1.1e-32
AZE37023.1|4318418_4318754_+|tRNA	tRNA 2-thiouridine synthesis protein TusE	tRNA	A0A2H4J8B6	uncultured_Caudovirales_phage	82.0	1.9e-46
AZE37024.1|4318750_4319752_+	Anthranilate phosphoribosyltransferase like	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	84.1	1.8e-164
AZE37025.1|4319841_4320849_+	Glutathione S-transferase, omega	NA	NA	NA	NA	NA
AZE37026.1|4320947_4322342_-	Precorrin-2 oxidase	NA	NA	NA	NA	NA
AZE37027.1|4322342_4323623_-|tRNA	Seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	55.1	2.1e-101
>prophage 6
CP027751	Pseudomonas chlororaphis subsp. aureofaciens strain ChPhzTR18 chromosome, complete genome	6873200	5732863	5743467	6873200	tail	Pseudomonas_phage(100.0%)	17	NA	NA
AZE38310.1|5732863_5734105_+	Integrase	NA	A0A1B0VMI6	Pseudomonas_phage	38.2	8.9e-65
AZE38311.1|5734186_5735086_+	hypothetical protein	NA	NA	NA	NA	NA
AZE38312.1|5735184_5735454_+	putative transcriptional regulator	NA	NA	NA	NA	NA
AZE38313.1|5735454_5735823_+	hypothetical protein	NA	A0A1B0VRK7	Pseudomonas_phage	65.8	5.3e-34
AZE38314.1|5736134_5736296_+	hypothetical protein	NA	A0A1B0VP73	Pseudomonas_phage	71.4	1.8e-10
AZE38315.1|5736292_5736607_+	hypothetical protein	NA	NA	NA	NA	NA
AZE38316.1|5736603_5736864_+	hypothetical protein	NA	NA	NA	NA	NA
AZE38317.1|5736860_5737076_+	hypothetical protein	NA	NA	NA	NA	NA
AZE38318.1|5737072_5737570_+	hypothetical protein	NA	NA	NA	NA	NA
AZE38319.1|5737574_5737850_+	hypothetical protein	NA	A0A1B0VMJ4	Pseudomonas_phage	84.6	1.1e-39
AZE38320.1|5737842_5738064_+	hypothetical protein	NA	NA	NA	NA	NA
AZE38321.1|5738060_5738942_+	DNA primase, phage associated	NA	A0A1B0VML8	Pseudomonas_phage	84.0	1.5e-138
AZE38322.1|5738928_5740731_+	DNA primase, phage-associated	NA	A0A1B0VP75	Pseudomonas_phage	95.3	0.0e+00
AZE38323.1|5741374_5741980_+	hypothetical protein	NA	A0A1B0VMK2	Pseudomonas_phage	50.2	5.1e-50
AZE38324.1|5742091_5742442_+	hypothetical protein	NA	A0A1B0VML3	Pseudomonas_phage	63.8	2.3e-34
AZE38325.1|5742445_5743045_+|tail	Phage tail assembly protein I	tail	A0A1B0VMI5	Pseudomonas_phage	59.4	1.7e-53
AZE38326.1|5743113_5743467_+	hypothetical protein	NA	A0A1B0VMC6	Pseudomonas_phage	48.4	9.1e-15
