The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027746	Pseudomonas chlororaphis subsp. aurantiaca strain DSM 19603 chromosome, complete genome	7109779	1317745	1407570	7109779	plate,tail,tRNA,protease	Pseudomonas_phage(41.18%)	93	NA	NA
AZD65095.1|1317745_1319098_+|protease	Intramembrane protease RasP/YluC, implicated in cell division based on FtsL cleavage	protease	NA	NA	NA	NA
AZD65096.1|1319172_1321560_+	Outer membrane protein assembly factor YaeT	NA	NA	NA	NA	NA
AZD65097.1|1321605_1322109_+	Outer membrane chaperone Skp, precursor	NA	NA	NA	NA	NA
AZD65098.1|1322112_1323168_+	UDP-3-O-[3-hydroxymyristoyl] glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AZD65099.1|1323277_1323718_+	3-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
AZD65100.1|1323714_1324491_+	Acyl-ADP--UDP-N- acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AZD65101.1|1324493_1325624_+	Lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AZD65102.1|1325635_1326268_+	Ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	38.9	1.7e-27
AZD65103.1|1326337_1329862_+	DNA polymerase III alpha subunit	NA	A0A2L1IZ23	Streptomyces_phage	38.0	4.7e-196
AZD65104.1|1330002_1330950_+	Acetyl-coenzyme A carboxyl transferase alpha chain	NA	NA	NA	NA	NA
AZD65105.1|1331069_1332398_+|tRNA	tRNA(Ile)-lysidine synthetase	tRNA	NA	NA	NA	NA
AZD65106.1|1332443_1332587_+	hypothetical protein	NA	NA	NA	NA	NA
AZD65107.1|1332672_1334304_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.5	6.9e-158
AZD65108.1|1334309_1335155_+	2-Keto-3-deoxy-D-manno-octulosonate-8-phosphate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.8	1.2e-49
AZD65109.1|1335312_1336602_+	Enolase	NA	A0A1X9I5Z8	Streptococcus_phage	59.2	9.0e-137
AZD65110.1|1336774_1337053_+	Cell division protein DivIC (FtsB), stabilizes FtsL against RasP cleavage	NA	NA	NA	NA	NA
AZD65111.1|1337049_1337757_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AZD65112.1|1337922_1338819_-	Transcriptional regulator, LysR family, in formaldehyde detoxification operon	NA	NA	NA	NA	NA
AZD65113.1|1338925_1340038_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.2	8.3e-30
AZD65114.1|1340127_1340973_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AZD65115.1|1341025_1341499_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
AZD65116.1|1341495_1342554_+|tRNA	tRNA pseudouridine(13) synthase	tRNA	NA	NA	NA	NA
AZD65117.1|1342541_1343291_+	5'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.6	1.4e-68
AZD65118.1|1343290_1343968_+	Protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.0	8.9e-43
AZD65119.1|1344177_1345011_+	Murein hydrolase activator NlpD	NA	A0A0S2SXL7	Bacillus_phage	33.3	6.3e-06
AZD65120.1|1345117_1346122_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	35.8	5.0e-34
AZD65121.1|1346622_1346946_-	4Fe-4S dicluster domain	NA	NA	NA	NA	NA
AZD65122.1|1347088_1349668_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	23.5	3.1e-27
AZD65123.1|1349864_1350590_+	Transcriptional regulator	NA	B5TK58	Pseudomonas_phage	90.6	3.8e-124
AZD65124.1|1351329_1351911_+	hypothetical protein	NA	NA	NA	NA	NA
AZD65125.1|1352013_1352361_+	Holin	NA	B5TK61	Pseudomonas_phage	87.7	7.7e-51
AZD65126.1|1352527_1353292_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	26.3	1.2e-06
AZD65127.1|1353514_1354039_+	hypothetical protein	NA	NA	NA	NA	NA
AZD65128.1|1354042_1354651_+|plate	Baseplate assembly protein V	plate	A0A2H4JBW8	uncultured_Caudovirales_phage	59.7	8.2e-48
AZD65129.1|1354664_1354997_+|plate	Baseplate assembly protein W	plate	A0A2H4JI46	uncultured_Caudovirales_phage	69.1	2.1e-37
AZD65130.1|1354993_1355989_+|plate	Phage-related baseplate assembly protein	plate	A0A2H4JC04	uncultured_Caudovirales_phage	62.9	1.8e-108
AZD65131.1|1355985_1356621_+	Tail protein I	NA	A0A2H4JDK0	uncultured_Caudovirales_phage	53.7	1.1e-42
AZD65132.1|1356621_1358133_+|tail	Prophage long tail fiber protein	tail	A0A1I9KF43	Aeromonas_phage	40.9	1.1e-29
AZD65133.1|1358181_1358607_+	hypothetical protein	NA	Q9ZXK5	Pseudomonas_virus	51.4	1.1e-22
AZD65134.1|1358706_1358928_+	hypothetical protein	NA	NA	NA	NA	NA
AZD65135.1|1358930_1360097_+|tail	Major tail sheath protein	tail	B0ZSG8	Halomonas_phage	57.5	1.1e-125
AZD65136.1|1360096_1360603_+	hypothetical protein	NA	Q6R4W3	Vibrio_virus	36.9	2.1e-25
AZD65137.1|1360730_1361312_+	hypothetical protein	NA	B0ZSH0	Halomonas_phage	39.4	9.1e-28
AZD65138.1|1361308_1361434_+	hypothetical protein	NA	NA	NA	NA	NA
AZD65139.1|1361440_1363711_+	Phage protein	NA	A0A2H4JAA5	uncultured_Caudovirales_phage	41.7	6.3e-08
AZD65140.1|1363710_1364094_+|tail	Unclassified tail protein	tail	A0A2H4JAC8	uncultured_Caudovirales_phage	53.5	4.7e-33
AZD65141.1|1364086_1364299_+|tail	P2-like prophage tail protein X	tail	A0A2H4JGD9	uncultured_Caudovirales_phage	68.6	3.9e-21
AZD65142.1|1364308_1365328_+|tail	Phage tail protein D	tail	A0A2H4JH05	uncultured_Caudovirales_phage	56.8	1.2e-104
AZD65143.1|1365508_1366093_+	hypothetical protein	NA	B5TK65	Pseudomonas_phage	71.5	9.0e-76
AZD65144.1|1366089_1366272_+	Mu-like prophage FluMu protein GP38	NA	B5TK66	Pseudomonas_phage	93.3	6.5e-25
AZD65145.1|1366271_1367768_+|tail	Bacteriophage tail sheath protein	tail	B5TK67	Pseudomonas_phage	90.8	7.8e-257
AZD65146.1|1367834_1368182_+|tail	Phage tail tube protein	tail	B5TK68	Pseudomonas_phage	93.9	2.9e-58
AZD65147.1|1368178_1368475_+|tail	Phage small tail protein E	tail	B5TK69	Pseudomonas_phage	94.9	2.3e-43
AZD65148.1|1368605_1370681_+|tail	Phage tail length tape-measure protein	tail	B5TK70	Pseudomonas_phage	47.9	1.0e-36
AZD65149.1|1370667_1371906_+|tail	Phage tail/DNA circulation protein	tail	B5TK71	Pseudomonas_phage	75.7	5.7e-181
AZD65150.1|1371909_1372950_+|tail	Prophage tail protein	tail	B5TK72	Pseudomonas_phage	82.7	3.8e-162
AZD65151.1|1373014_1373524_+|plate	Prophage baseplate assembly protein V	plate	B5TK73	Pseudomonas_phage	89.3	5.8e-79
AZD65152.1|1373523_1373922_+	Bacteriophage protein GP46	NA	B5TK74	Pseudomonas_phage	89.4	1.7e-65
AZD65153.1|1373911_1374952_+	Phage FluMu protein gp47	NA	B5TK75	Pseudomonas_phage	87.3	3.0e-167
AZD65154.1|1374939_1375539_+|tail	Prophage tail protein	tail	B5TK76	Pseudomonas_phage	91.5	8.5e-106
AZD65155.1|1375550_1376408_+|tail	Prophage tail fiber protein	tail	B5TK77	Pseudomonas_phage	76.4	1.5e-23
AZD65156.1|1376412_1377054_+	hypothetical protein	NA	B5TK78	Pseudomonas_phage	61.9	2.5e-39
AZD65157.1|1377252_1377384_-	hypothetical protein	NA	NA	NA	NA	NA
AZD65158.1|1377437_1378991_+|tail	Prophage tail fiber protein	tail	A4PE45	Ralstonia_virus	54.8	1.0e-38
AZD65159.1|1378992_1379463_+	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	35.0	4.2e-07
AZD65160.1|1379855_1380938_+|tail	Prophage tail fiber protein	tail	B5TK79	Pseudomonas_phage	56.6	4.2e-111
AZD65161.1|1380945_1381548_+	Tail fiber assembly protein	NA	B5TK80	Pseudomonas_phage	49.7	1.4e-47
AZD65162.1|1381569_1382133_+	Lytic enzyme	NA	B5TK83	Pseudomonas_phage	83.9	2.6e-88
AZD65163.1|1382114_1382651_+	hypothetical protein	NA	B5TK84	Pseudomonas_phage	70.8	2.4e-59
AZD65164.1|1382733_1383234_+	Nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	86.7	3.6e-73
AZD65165.1|1383317_1384370_+	RecA protein	NA	A0A0S2MVG1	Bacillus_phage	60.9	4.4e-113
AZD65166.1|1384378_1384846_+	Regulatory protein RecX	NA	NA	NA	NA	NA
AZD65167.1|1384891_1386007_-	Decarboxylase family protein	NA	NA	NA	NA	NA
AZD65168.1|1386489_1386684_+	hypothetical protein	NA	NA	NA	NA	NA
AZD65169.1|1386685_1387108_-	Putative NADPH-quinone reductase (modulator of drug activity B)	NA	NA	NA	NA	NA
AZD65170.1|1387297_1388008_+	putative conserved protein YfiP, contains DTW domain	NA	NA	NA	NA	NA
AZD65171.1|1388343_1388994_+	Transcriptional regulator, LuxR family	NA	NA	NA	NA	NA
AZD65172.1|1389069_1389432_+	Diacylglycerol kinase	NA	NA	NA	NA	NA
AZD65173.1|1389428_1390355_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZD65174.1|1390488_1391268_+	Ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AZD65175.1|1391340_1392069_-	S-adenosylmethionine-dependent methyltransferase YaeB	NA	NA	NA	NA	NA
AZD65176.1|1392157_1392928_-	Rhamnolipid biosynthesis 3-oxoacyl-ACP reductase RhlG	NA	NA	NA	NA	NA
AZD65177.1|1393061_1393523_-	Uncharacterized protein YehS	NA	Q9EYF4	Enterobacteria_phage	51.3	8.5e-37
AZD65178.1|1393589_1394300_-	Ribosomal large subunit pseudouridine synthase F	NA	NA	NA	NA	NA
AZD65179.1|1394382_1394856_-	Acetyltransferase	NA	NA	NA	NA	NA
AZD65180.1|1394962_1396300_-	Ribosomal protein S12p Asp88 methylthiotransferase	NA	NA	NA	NA	NA
AZD65181.1|1396494_1396671_-	hypothetical protein	NA	NA	NA	NA	NA
AZD65182.1|1396692_1398534_+	Kup system potassium uptake protein	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	35.3	2.6e-76
AZD65183.1|1398736_1400032_-	Alanylphosphatidylglycerol hydrolase, periplasmic	NA	NA	NA	NA	NA
AZD65184.1|1400031_1402680_-	Alanylphosphatidylglycerol synthase	NA	NA	NA	NA	NA
AZD65185.1|1403617_1404682_+	DNA polymerase IV	NA	NA	NA	NA	NA
AZD65186.1|1404883_1405837_-	putative lipoprotein	NA	NA	NA	NA	NA
AZD65187.1|1405854_1407570_-|tRNA	Prolyl-tRNA synthetase, bacterial type	tRNA	NA	NA	NA	NA
>prophage 2
CP027746	Pseudomonas chlororaphis subsp. aurantiaca strain DSM 19603 chromosome, complete genome	7109779	4000745	4058555	7109779	integrase,tail,terminase	Pseudomonas_phage(53.33%)	78	4002238:4002297	4058633:4058694
AZD67551.1|4000745_4002068_-	Integrase	NA	B7SYF8	Stenotrophomonas_phage	39.7	3.7e-69
4002238:4002297	attL	AGATGGTGCCCGAAGCCGGAATCGAACCGGCACGCCCTTACGAGCGGGGGATTTTAAGTC	NA	NA	NA	NA
AZD67552.1|4002458_4002755_-	hypothetical protein	NA	A0A2H4JER5	uncultured_Caudovirales_phage	37.8	1.3e-11
AZD67553.1|4002884_4003559_+	Gifsy-2 prophage protein	NA	A0A2H4J991	uncultured_Caudovirales_phage	71.6	2.5e-93
AZD67554.1|4004391_4004913_-	hypothetical protein	NA	B5TK84	Pseudomonas_phage	64.1	2.2e-49
AZD67555.1|4004909_4005335_-	structural protein P5, putative	NA	A0A2H4J6R1	uncultured_Caudovirales_phage	88.7	1.6e-66
AZD67556.1|4005394_4006102_-	hypothetical protein	NA	A0A059VFX9	Pseudomonas_phage	50.4	3.2e-51
AZD67557.1|4006101_4006860_-	hypothetical protein	NA	A0A0S2SY45	Pseudomonas_phage	44.6	1.0e-34
AZD67558.1|4006923_4007604_-	hypothetical protein	NA	A0A2D1GNS6	Pseudomonas_phage	40.2	9.9e-42
AZD67559.1|4007603_4007927_-	hypothetical protein	NA	NA	NA	NA	NA
AZD67560.1|4007923_4011382_-|tail	Phage tail fiber protein	tail	A0A2H4J8Z6	uncultured_Caudovirales_phage	62.4	0.0e+00
AZD67561.1|4011439_4012048_-|tail	Phage tail assembly protein I	tail	A0A2H4J1H0	uncultured_Caudovirales_phage	65.0	1.3e-61
AZD67562.1|4012515_4013364_-	hypothetical protein	NA	NA	NA	NA	NA
AZD67563.1|4013828_4013966_-	hypothetical protein	NA	NA	NA	NA	NA
AZD67564.1|4013991_4014756_-|tail	Phage tail assembly protein	tail	A0A2H4J1J7	uncultured_Caudovirales_phage	84.9	6.1e-133
AZD67565.1|4014758_4015508_-|tail	Phage minor tail protein	tail	A0A2H4J4Q5	uncultured_Caudovirales_phage	83.1	1.6e-125
AZD67566.1|4015517_4015856_-	Phage protein	NA	A0A2H4JI07	uncultured_Caudovirales_phage	77.7	2.1e-48
AZD67567.1|4015855_4018852_-|tail	Phage tail length tape-measure protein 1	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	44.3	2.0e-163
AZD67568.1|4018879_4019140_-	hypothetical protein	NA	A0A1B0VMG9	Pseudomonas_phage	51.2	1.8e-15
AZD67569.1|4019202_4019586_-	hypothetical protein	NA	A0A2H4IYQ5	uncultured_Caudovirales_phage	54.3	3.4e-31
AZD67570.1|4019595_4020249_-	putative phage protein	NA	A0A2H4J6K6	uncultured_Caudovirales_phage	78.2	1.6e-89
AZD67571.1|4020319_4020736_-	hypothetical protein	NA	A0A1B0VMI0	Pseudomonas_phage	63.8	5.8e-45
AZD67572.1|4020732_4021329_-	hypothetical protein	NA	A0A2H4J0Q3	uncultured_Caudovirales_phage	51.8	1.2e-51
AZD67573.1|4021325_4021694_-	phage-related conserved hypothetical protein	NA	A0A1B0VRJ4	Pseudomonas_phage	79.2	6.5e-48
AZD67574.1|4021710_4022214_-	phage-related conserved hypothetical protein	NA	A0A1B0VND3	Pseudomonas_phage	89.8	1.8e-80
AZD67575.1|4022270_4022864_-	hypothetical protein	NA	A0A1B0VMF7	Pseudomonas_phage	39.9	3.3e-25
AZD67576.1|4022909_4023872_-	putative phage protein	NA	A0A1B0VMF8	Pseudomonas_phage	90.0	5.5e-163
AZD67577.1|4023884_4024613_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	93.0	4.8e-119
AZD67578.1|4024701_4024944_-	hypothetical protein	NA	NA	NA	NA	NA
AZD67579.1|4025020_4026106_-	Phage protein	NA	A0A1B0VMF3	Pseudomonas_phage	92.0	3.7e-184
AZD67580.1|4026080_4027499_-	structural protein	NA	A0A1B0VMH0	Pseudomonas_phage	93.0	1.0e-266
AZD67581.1|4027495_4028797_-|terminase	Phage terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.7	4.4e-147
AZD67582.1|4028783_4029245_-	Phage protein	NA	A0A1B0VMH2	Pseudomonas_phage	75.0	1.3e-48
AZD67583.1|4029276_4029891_-	hypothetical protein	NA	A0A1B0VRJ1	Pseudomonas_phage	87.4	2.0e-102
AZD67584.1|4030211_4030403_-	hypothetical protein	NA	NA	NA	NA	NA
AZD67585.1|4030399_4030687_-	hypothetical protein	NA	NA	NA	NA	NA
AZD67586.1|4030747_4031044_-	hypothetical protein	NA	V5K3F8	Pseudomonas_phage	37.9	8.7e-11
AZD67587.1|4031048_4031321_-	hypothetical protein	NA	A0A1B0VME7	Pseudomonas_phage	76.4	7.4e-33
AZD67588.1|4031322_4031646_-	hypothetical protein	NA	A0A1B0VME9	Pseudomonas_phage	83.2	1.7e-39
AZD67589.1|4032056_4032743_-	hypothetical protein	NA	NA	NA	NA	NA
AZD67590.1|4032827_4033460_-	hypothetical protein	NA	A0A2I7RQG7	Vibrio_phage	46.9	5.4e-50
AZD67591.1|4033444_4034053_-	Protein NinG	NA	A0A2H4JA27	uncultured_Caudovirales_phage	71.4	1.8e-71
AZD67592.1|4034052_4034385_-	hypothetical protein	NA	NA	NA	NA	NA
AZD67593.1|4034381_4034969_-	Gifsy-2 prophage protein	NA	Q9MC49	Pseudomonas_phage	81.0	4.0e-92
AZD67594.1|4034961_4035342_-	hypothetical protein	NA	NA	NA	NA	NA
AZD67595.1|4035338_4036121_-	hypothetical protein	NA	A0A1B0VMD9	Pseudomonas_phage	71.9	2.3e-98
AZD67596.1|4036125_4037097_-	Primosomal protein I	NA	A0A1B0VME0	Pseudomonas_phage	70.7	3.3e-115
AZD67597.1|4037098_4037950_-	Phage antirepressor protein	NA	A0A2H4J111	uncultured_Caudovirales_phage	69.6	4.8e-54
AZD67598.1|4038100_4038523_-	hypothetical protein	NA	A0A2D1GNM7	Pseudomonas_phage	49.3	1.5e-32
AZD67599.1|4038605_4038821_-	Phage repressor	NA	A0A125RNS7	Pseudomonas_phage	71.8	1.4e-23
AZD67600.1|4039106_4039574_+	Putative cI prophage repressor protein	NA	K7PH71	Enterobacterial_phage	55.2	4.5e-38
AZD67601.1|4039895_4040540_+	hypothetical protein	NA	A0A0U4J8W4	Pseudomonas_phage	62.0	3.2e-74
AZD67602.1|4040834_4041749_+	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	40.9	1.8e-51
AZD67603.1|4041888_4042461_+	hypothetical protein	NA	I6PDJ9	Cronobacter_phage	37.1	4.3e-14
AZD67604.1|4042632_4042884_+	hypothetical protein	NA	NA	NA	NA	NA
AZD67605.1|4043280_4043847_+	hypothetical protein	NA	J7HXB1	Pseudomonas_phage	61.7	1.8e-57
AZD67606.1|4043916_4044696_+	hypothetical protein	NA	A0A1B0YZY3	Pseudomonas_phage	66.3	6.8e-95
AZD67607.1|4045195_4045690_+	Phage HNH homing endonuclease	NA	A0A1W6DXY0	Salmonella_phage	44.5	1.5e-26
AZD67608.1|4045711_4046143_+	hypothetical protein	NA	A0A1B0VMC3	Pseudomonas_phage	38.4	8.8e-12
AZD67609.1|4046139_4046331_+	hypothetical protein	NA	A0A1B0VMB8	Pseudomonas_phage	48.4	1.2e-08
AZD67610.1|4046327_4046516_+	hypothetical protein	NA	NA	NA	NA	NA
AZD67611.1|4046631_4046748_+	hypothetical protein	NA	NA	NA	NA	NA
AZD67612.1|4046792_4047896_+	TolA protein	NA	A0A1B0VN89	Pseudomonas_phage	76.1	9.0e-77
AZD67613.1|4047906_4048665_+	Putative recombinase	NA	K4NWX3	Pseudomonas_phage	55.5	1.1e-49
AZD67614.1|4048661_4049429_+	Phage related protein	NA	A0A088C3C8	Flavobacterium_sp._phage	32.6	1.2e-08
AZD67615.1|4049664_4050135_+	hypothetical protein	NA	A0A2H4J101	uncultured_Caudovirales_phage	85.4	1.4e-71
AZD67616.1|4050204_4050528_+	hypothetical protein	NA	A0A2H4J0R5	uncultured_Caudovirales_phage	32.0	7.1e-06
AZD67617.1|4050878_4051073_+	hypothetical protein	NA	A0A2H4JAQ1	uncultured_Caudovirales_phage	70.3	1.8e-20
AZD67618.1|4051082_4051583_-	hypothetical protein	NA	NA	NA	NA	NA
AZD67619.1|4051698_4052109_+	hypothetical protein	NA	A0A0U4JNY7	Pseudomonas_phage	59.7	1.6e-39
AZD67620.1|4052463_4052682_-	hypothetical protein	NA	NA	NA	NA	NA
AZD67621.1|4052963_4055126_+	C-5 cytosine-specific DNA methylase family protein	NA	Q5QF27	Pseudomonas_virus	62.5	6.8e-262
AZD67622.1|4055122_4055353_-	hypothetical protein	NA	A0A1B0VP27	Pseudomonas_phage	84.0	4.5e-31
AZD67623.1|4055392_4055563_+	hypothetical protein	NA	NA	NA	NA	NA
AZD67624.1|4055624_4055936_+	hypothetical protein	NA	NA	NA	NA	NA
AZD67625.1|4055932_4056325_+	hypothetical protein	NA	A0A291AUQ6	Sinorhizobium_phage	40.7	2.8e-25
AZD67626.1|4056604_4056721_+	hypothetical protein	NA	NA	NA	NA	NA
AZD67627.1|4056786_4057173_-	hypothetical protein	NA	NA	NA	NA	NA
AZD67628.1|4057529_4058555_+|integrase	Phage integrase:Phage integrase, N-terminal SAM-like	integrase	C8CLF4	Xylella_phage	54.5	2.9e-93
4058633:4058694	attR	AGATGGTGCCCGAAGCCGGAATCGAACCGGCACGCCCTTACGAGCGGGGGATTTTAAGTCCC	NA	NA	NA	NA
>prophage 3
CP027746	Pseudomonas chlororaphis subsp. aurantiaca strain DSM 19603 chromosome, complete genome	7109779	4613227	4619485	7109779	tRNA	uncultured_Caudovirales_phage(83.33%)	8	NA	NA
AZD68082.1|4613227_4613620_+|tRNA	tRNA 5-methylaminomethyl-2-thiouridine synthase subunit TusD	tRNA	A0A2H4JA39	uncultured_Caudovirales_phage	84.6	6.7e-59
AZD68083.1|4613623_4613986_+|tRNA	tRNA 5-methylaminomethyl-2-thiouridine synthase subunit TusC	tRNA	A0A2H4J8C0	uncultured_Caudovirales_phage	74.2	2.5e-44
AZD68084.1|4613985_4614285_+|tRNA	tRNA 5-methylaminomethyl-2-thiouridine synthase subunit TusB	tRNA	A0A2H4JG28	uncultured_Caudovirales_phage	69.7	2.4e-32
AZD68085.1|4614281_4614617_+|tRNA	tRNA 2-thiouridine synthesis protein TusE	tRNA	A0A2H4J8B6	uncultured_Caudovirales_phage	82.0	1.9e-46
AZD68086.1|4614613_4615615_+	Anthranilate phosphoribosyltransferase like	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	85.4	5.0e-167
AZD68087.1|4615703_4616711_+	Glutathione S-transferase, omega	NA	NA	NA	NA	NA
AZD68088.1|4616809_4618204_-	Precorrin-2 oxidase	NA	NA	NA	NA	NA
AZD68089.1|4618204_4619485_-|tRNA	Seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	55.1	2.1e-101
