The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027742	Pseudomonas chlororaphis subsp. aurantiaca strain 464 chromosome, complete genome	6964452	1328924	1418409	6964452	tRNA,plate,tail,protease	Pseudomonas_phage(42.0%)	93	NA	NA
AZD40302.1|1328924_1330277_+|protease	Intramembrane protease RasP/YluC, implicated in cell division based on FtsL cleavage	protease	NA	NA	NA	NA
AZD40303.1|1330351_1332739_+	Outer membrane protein assembly factor YaeT	NA	NA	NA	NA	NA
AZD40304.1|1332784_1333288_+	Outer membrane chaperone Skp, precursor	NA	NA	NA	NA	NA
AZD40305.1|1333291_1334347_+	UDP-3-O-[3-hydroxymyristoyl] glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AZD40306.1|1334456_1334897_+	3-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
AZD40307.1|1334893_1335670_+	Acyl-ADP--UDP-N- acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AZD40308.1|1335672_1336803_+	Lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AZD40309.1|1336814_1337447_+	Ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	38.9	1.7e-27
AZD40310.1|1337516_1341041_+	DNA polymerase III alpha subunit	NA	A0A2L1IZ23	Streptomyces_phage	38.0	6.2e-196
AZD40311.1|1341181_1342129_+	Acetyl-coenzyme A carboxyl transferase alpha chain	NA	NA	NA	NA	NA
AZD40312.1|1342248_1343577_+|tRNA	tRNA(Ile)-lysidine synthetase	tRNA	NA	NA	NA	NA
AZD40313.1|1343622_1343766_+	hypothetical protein	NA	NA	NA	NA	NA
AZD40314.1|1343851_1345483_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.5	6.9e-158
AZD40315.1|1345488_1346334_+	2-Keto-3-deoxy-D-manno-octulosonate-8-phosphate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.8	1.2e-49
AZD40316.1|1346491_1347781_+	Enolase	NA	A0A1X9I5Z8	Streptococcus_phage	59.2	9.0e-137
AZD40317.1|1347953_1348232_+	Cell division protein DivIC (FtsB), stabilizes FtsL against RasP cleavage	NA	NA	NA	NA	NA
AZD40318.1|1348228_1348936_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AZD40319.1|1349101_1349998_-	Transcriptional regulator, LysR family, in formaldehyde detoxification operon	NA	NA	NA	NA	NA
AZD40320.1|1350104_1351217_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.2	8.3e-30
AZD40321.1|1351305_1352151_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AZD40322.1|1352203_1352677_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
AZD40323.1|1352673_1353732_+|tRNA	tRNA pseudouridine(13) synthase	tRNA	NA	NA	NA	NA
AZD40324.1|1353719_1354469_+	5'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.6	1.4e-68
AZD40325.1|1354468_1355146_+	Protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.0	8.9e-43
AZD40326.1|1355355_1356189_+	Murein hydrolase activator NlpD	NA	A0A0S2SXL7	Bacillus_phage	33.3	6.3e-06
AZD40327.1|1356295_1357300_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	35.8	5.0e-34
AZD40328.1|1357801_1358125_-	4Fe-4S dicluster domain	NA	NA	NA	NA	NA
AZD40329.1|1358267_1360847_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	23.5	1.8e-27
AZD40330.1|1361043_1361769_+	Transcriptional regulator	NA	B5TK58	Pseudomonas_phage	90.6	3.8e-124
AZD40331.1|1362508_1363090_+	hypothetical protein	NA	NA	NA	NA	NA
AZD40332.1|1363192_1363540_+	Holin	NA	B5TK61	Pseudomonas_phage	87.7	7.7e-51
AZD40333.1|1363706_1364471_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	25.8	3.4e-06
AZD40334.1|1364693_1365218_+	hypothetical protein	NA	NA	NA	NA	NA
AZD40335.1|1365221_1365830_+|plate	Baseplate assembly protein V	plate	A0A2H4JBW8	uncultured_Caudovirales_phage	59.0	1.8e-47
AZD40336.1|1365843_1366176_+|plate	Baseplate assembly protein W	plate	A0A2H4JI46	uncultured_Caudovirales_phage	69.1	2.1e-37
AZD40337.1|1366172_1367168_+|plate	Phage-related baseplate assembly protein	plate	A0A2H4JC04	uncultured_Caudovirales_phage	62.3	3.1e-108
AZD40338.1|1367164_1367899_+|tail	Phage tail fiber	tail	A0A2H4JDK0	uncultured_Caudovirales_phage	50.9	1.3e-39
AZD40339.1|1367895_1368426_+|tail	Phage tail fiber	tail	A2I2X8	Vibrio_virus	63.1	5.3e-51
AZD40340.1|1368578_1369196_+	hypothetical protein	NA	NA	NA	NA	NA
AZD40341.1|1369366_1369549_-	hypothetical protein	NA	NA	NA	NA	NA
AZD40342.1|1369541_1369763_+	hypothetical protein	NA	NA	NA	NA	NA
AZD40343.1|1369765_1370932_+|tail	Major tail sheath protein	tail	B0ZSG8	Halomonas_phage	57.5	1.4e-125
AZD40344.1|1370931_1371438_+	hypothetical protein	NA	Q6R4W3	Vibrio_virus	36.9	2.1e-25
AZD40345.1|1371565_1372147_+	hypothetical protein	NA	B0ZSH0	Halomonas_phage	39.4	9.1e-28
AZD40346.1|1372143_1372269_+	hypothetical protein	NA	NA	NA	NA	NA
AZD40347.1|1372275_1374546_+|tail	Phage tail length tape-measure protein	tail	A2I2Y1	Vibrio_virus	35.1	1.0e-34
AZD40348.1|1374545_1374929_+|tail	Unclassified tail protein	tail	A0A2H4JAC8	uncultured_Caudovirales_phage	53.5	4.7e-33
AZD40349.1|1374921_1375134_+|tail	P2-like prophage tail protein X	tail	A0A2H4JGD9	uncultured_Caudovirales_phage	68.6	3.9e-21
AZD40350.1|1375143_1376163_+|tail	Phage tail protein D	tail	A0A2H4JH05	uncultured_Caudovirales_phage	56.5	2.7e-104
AZD40351.1|1376344_1376929_+	hypothetical protein	NA	B5TK65	Pseudomonas_phage	72.5	3.1e-76
AZD40352.1|1376925_1377108_+	Mu-like prophage FluMu protein GP38	NA	B5TK66	Pseudomonas_phage	93.3	6.5e-25
AZD40353.1|1377107_1378604_+|tail	Bacteriophage tail sheath protein	tail	B5TK67	Pseudomonas_phage	90.8	7.8e-257
AZD40354.1|1378670_1379018_+|tail	Phage tail tube protein	tail	B5TK68	Pseudomonas_phage	93.9	2.9e-58
AZD40355.1|1379014_1379311_+|tail	Phage small tail protein E	tail	B5TK69	Pseudomonas_phage	94.9	2.3e-43
AZD40356.1|1379441_1381517_+|tail	Phage tail length tape-measure protein	tail	B5TK70	Pseudomonas_phage	47.9	1.7e-36
AZD40357.1|1381503_1382742_+|tail	Phage tail/DNA circulation protein	tail	B5TK71	Pseudomonas_phage	75.7	5.7e-181
AZD40358.1|1382745_1383786_+|tail	Prophage tail protein	tail	B5TK72	Pseudomonas_phage	82.7	1.9e-161
AZD40359.1|1383850_1384360_+|plate	Prophage baseplate assembly protein V	plate	B5TK73	Pseudomonas_phage	89.3	4.4e-79
AZD40360.1|1384359_1384758_+	Bacteriophage protein GP46	NA	B5TK74	Pseudomonas_phage	89.4	1.7e-65
AZD40361.1|1384747_1385788_+	Phage FluMu protein gp47	NA	B5TK75	Pseudomonas_phage	87.3	2.3e-167
AZD40362.1|1385775_1386375_+|tail	Prophage tail protein	tail	B5TK76	Pseudomonas_phage	91.5	8.5e-106
AZD40363.1|1386386_1387244_+|tail	Prophage tail fiber protein	tail	B5TK77	Pseudomonas_phage	76.4	1.5e-23
AZD40364.1|1387248_1387890_+	hypothetical protein	NA	B5TK78	Pseudomonas_phage	62.1	8.2e-38
AZD40365.1|1388088_1388220_-	hypothetical protein	NA	NA	NA	NA	NA
AZD40366.1|1388273_1389827_+|tail	Prophage tail fiber protein	tail	A4PE45	Ralstonia_virus	54.2	1.8e-38
AZD40367.1|1389828_1390299_+	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	35.0	4.2e-07
AZD40368.1|1390693_1391776_+|tail	Prophage tail fiber protein	tail	B5TK79	Pseudomonas_phage	56.6	4.2e-111
AZD40369.1|1391783_1392386_+	Tail fiber assembly protein	NA	B5TK80	Pseudomonas_phage	49.2	5.3e-47
AZD40370.1|1392407_1392971_+	Lytic enzyme	NA	B5TK83	Pseudomonas_phage	83.3	9.9e-88
AZD40371.1|1392952_1393489_+	hypothetical protein	NA	B5TK84	Pseudomonas_phage	71.9	3.4e-61
AZD40372.1|1393571_1394072_+	Nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	87.3	2.1e-73
AZD40373.1|1394155_1395208_+	RecA protein	NA	A0A0S2MVG1	Bacillus_phage	60.9	4.4e-113
AZD40374.1|1395216_1395684_+	Regulatory protein RecX	NA	NA	NA	NA	NA
AZD40375.1|1395729_1396845_-	Decarboxylase family protein	NA	NA	NA	NA	NA
AZD40376.1|1397327_1397522_+	hypothetical protein	NA	NA	NA	NA	NA
AZD40377.1|1397523_1397946_-	Putative NADPH-quinone reductase (modulator of drug activity B)	NA	NA	NA	NA	NA
AZD40378.1|1398135_1398846_+	putative conserved protein YfiP, contains DTW domain	NA	NA	NA	NA	NA
AZD40379.1|1399181_1399832_+	Transcriptional regulator, LuxR family	NA	NA	NA	NA	NA
AZD40380.1|1399907_1400270_+	Diacylglycerol kinase	NA	NA	NA	NA	NA
AZD40381.1|1400266_1401193_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZD40382.1|1401326_1402106_+	Ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AZD40383.1|1402178_1402907_-	S-adenosylmethionine-dependent methyltransferase YaeB	NA	NA	NA	NA	NA
AZD40384.1|1402995_1403766_-	Rhamnolipid biosynthesis 3-oxoacyl-ACP reductase RhlG	NA	NA	NA	NA	NA
AZD40385.1|1403899_1404361_-	Uncharacterized protein YehS	NA	Q9EYF4	Enterobacteria_phage	51.3	8.5e-37
AZD40386.1|1404427_1405138_-	Ribosomal large subunit pseudouridine synthase F	NA	NA	NA	NA	NA
AZD40387.1|1405220_1405694_-	Acetyltransferase	NA	NA	NA	NA	NA
AZD40388.1|1405799_1407137_-	Ribosomal protein S12p Asp88 methylthiotransferase	NA	NA	NA	NA	NA
AZD40389.1|1407469_1409371_+	Kup system potassium uptake protein	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	35.0	1.2e-76
AZD40390.1|1409574_1410870_-	Alanylphosphatidylglycerol hydrolase, periplasmic	NA	NA	NA	NA	NA
AZD40391.1|1410869_1413518_-	Alanylphosphatidylglycerol synthase	NA	NA	NA	NA	NA
AZD40392.1|1414456_1415521_+	DNA polymerase IV	NA	NA	NA	NA	NA
AZD40393.1|1415722_1416676_-	putative lipoprotein	NA	NA	NA	NA	NA
AZD40394.1|1416693_1418409_-|tRNA	Prolyl-tRNA synthetase, bacterial type	tRNA	NA	NA	NA	NA
>prophage 2
CP027742	Pseudomonas chlororaphis subsp. aurantiaca strain 464 chromosome, complete genome	6964452	2026104	2062770	6964452	integrase,tail,capsid,head,terminase,plate	Pseudomonas_virus(45.16%)	51	2025968:2025992	2064028:2064052
2025968:2025992	attL	TTCGAATCCCTCCTCAACCGCCATA	NA	NA	NA	NA
AZD40962.1|2026104_2027271_-|integrase	Phage integrase	integrase	A0A2H4JGM5	uncultured_Caudovirales_phage	60.9	6.7e-139
AZD40963.1|2027567_2027741_-	hypothetical protein	NA	NA	NA	NA	NA
AZD40964.1|2027733_2028993_-	hypothetical protein	NA	R9TRT5	Rhizobium_phage	72.6	2.8e-175
AZD40965.1|2028989_2029211_-	hypothetical protein	NA	NA	NA	NA	NA
AZD40966.1|2029207_2029858_-	Phage protein	NA	A0A0U1SZL2	Pseudomonas_phage	48.6	7.7e-44
AZD40967.1|2029873_2030131_-	hypothetical protein	NA	NA	NA	NA	NA
AZD40968.1|2030194_2030413_-	Phage protein	NA	Q9ZXI5	Pseudomonas_virus	71.4	3.3e-15
AZD40969.1|2030405_2031011_-	hypothetical protein	NA	NA	NA	NA	NA
AZD40970.1|2031013_2031277_-	hypothetical protein	NA	NA	NA	NA	NA
AZD40971.1|2031357_2031654_-	hypothetical protein	NA	NA	NA	NA	NA
AZD40972.1|2031675_2031816_-	hypothetical protein	NA	NA	NA	NA	NA
AZD40973.1|2031861_2034651_-	Phage protein	NA	A0A2H4J936	uncultured_Caudovirales_phage	65.4	0.0e+00
AZD40974.1|2034657_2034891_-	hypothetical protein	NA	NA	NA	NA	NA
AZD40975.1|2034965_2035334_-	hypothetical protein	NA	A0A2H4J947	uncultured_Caudovirales_phage	50.0	1.7e-08
AZD40976.1|2035330_2035621_-	hypothetical protein	NA	NA	NA	NA	NA
AZD40977.1|2035623_2035815_-	hypothetical protein	NA	NA	NA	NA	NA
AZD40978.1|2035813_2036032_+	hypothetical protein	NA	NA	NA	NA	NA
AZD40979.1|2036048_2036525_-	Phage protein	NA	A0A2H4JG61	uncultured_Caudovirales_phage	64.7	1.0e-53
AZD40980.1|2036565_2036817_-	hypothetical protein	NA	NA	NA	NA	NA
AZD40981.1|2037128_2037335_+	hypothetical protein	NA	NA	NA	NA	NA
AZD40982.1|2037670_2038570_+	hypothetical protein	NA	NA	NA	NA	NA
AZD40983.1|2038566_2039211_+	Permease of the drug/metabolite transporter (DMT) superfamily	NA	NA	NA	NA	NA
AZD40984.1|2039262_2039718_+	hypothetical protein	NA	NA	NA	NA	NA
AZD40985.1|2039723_2041028_-	hypothetical protein	NA	Q9ZXJ8	Pseudomonas_virus	78.3	1.3e-186
AZD40986.1|2041024_2041465_-	Phage tape measure	NA	A0A2H4JG54	uncultured_Caudovirales_phage	76.7	1.2e-59
AZD40987.1|2041471_2044207_-|tail	Phage tail length tape-measure protein	tail	A4PE52	Ralstonia_virus	45.0	1.1e-184
AZD40988.1|2044199_2044316_-|tail	Phage tail protein GpE, GpE'	tail	Q9ZXK1	Pseudomonas_virus	78.4	5.4e-09
AZD40989.1|2044324_2044654_-|tail	Phage tail fiber	tail	Q9ZXK2	Pseudomonas_virus	63.3	1.0e-28
AZD40990.1|2044713_2045229_-|tail	Phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	76.0	5.3e-72
AZD40991.1|2045285_2046455_-|tail	Phage tail sheath monomer	tail	Q9ZXK4	Pseudomonas_virus	73.3	5.5e-165
AZD40992.1|2046936_2048439_-|tail	Phage tail fiber protein	tail	A0A2H4JF09	uncultured_Caudovirales_phage	77.7	1.8e-83
AZD40993.1|2048435_2049053_-|tail	Phage tail fiber	tail	A0A2H4JAU2	uncultured_Caudovirales_phage	71.2	1.2e-81
AZD40994.1|2049052_2049964_-|plate	Baseplate assembly protein J	plate	Q9ZXK8	Pseudomonas_virus	72.1	4.3e-117
AZD40995.1|2049960_2050305_-|plate	Phage baseplate assembly protein	plate	Q9ZXK9	Pseudomonas_virus	65.5	4.1e-36
AZD40996.1|2050301_2050892_-|plate	Baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	65.8	1.2e-54
AZD40997.1|2051014_2051716_+	hypothetical protein	NA	NA	NA	NA	NA
AZD40998.1|2051718_2052177_-|tail	Phage tail completion protein	tail	Q9ZXL2	Pseudomonas_virus	64.0	2.2e-45
AZD40999.1|2052173_2052650_-|tail	Phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	64.4	1.8e-45
AZD41000.1|2052746_2053190_-	Phage spanin Rz LysB	NA	NA	NA	NA	NA
AZD41001.1|2053186_2053393_-	hypothetical protein	NA	NA	NA	NA	NA
AZD41002.1|2053389_2054235_-	Putative phage-encoded peptidoglycan binding protein	NA	Q9ZXL6	Pseudomonas_virus	69.6	6.4e-99
AZD41003.1|2054231_2054555_-	Holin, phage lambda	NA	A0A2H4JFM8	uncultured_Caudovirales_phage	54.8	6.1e-26
AZD41004.1|2054594_2054807_-|tail	Phage tail protein	tail	Q9ZXL9	Pseudomonas_virus	80.6	5.8e-25
AZD41005.1|2054806_2055286_-|head	Phage head completion-stabilization protein	head	Q9ZXM1	Pseudomonas_virus	62.3	1.4e-47
AZD41006.1|2055390_2056098_-|terminase	Phage terminase, endonuclease subunit	terminase	A0A2H4J948	uncultured_Caudovirales_phage	64.4	7.8e-74
AZD41007.1|2056109_2057117_-|capsid	Phage major capsid protein	capsid	A0A077KEQ8	Ralstonia_phage	63.6	3.2e-121
AZD41008.1|2057161_2058040_-|capsid	Phage capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	57.6	1.6e-76
AZD41009.1|2058191_2059952_+|terminase	Phage terminase, ATPase subunit	terminase	Q9ZXM5	Pseudomonas_virus	83.6	4.8e-298
AZD41010.1|2059951_2061004_+|capsid	Phage-related capsid packaging protein	capsid	A0A2H4J922	uncultured_Caudovirales_phage	83.4	4.6e-163
AZD41011.1|2061072_2061975_-	hypothetical protein	NA	NA	NA	NA	NA
AZD41012.1|2062071_2062770_-	Gifsy-2 prophage protein	NA	A0A2H4J991	uncultured_Caudovirales_phage	80.0	9.6e-109
2064028:2064052	attR	TTCGAATCCCTCCTCAACCGCCATA	NA	NA	NA	NA
>prophage 3
CP027742	Pseudomonas chlororaphis subsp. aurantiaca strain 464 chromosome, complete genome	6964452	2239275	2355163	6964452	integrase,plate,tail,portal,terminase,tRNA,protease	uncultured_Caudovirales_phage(59.09%)	113	2259837:2259853	2321319:2321335
AZD41152.1|2239275_2239884_-|protease	SOS-response repressor and protease LexA	protease	A0A2H4JG58	uncultured_Caudovirales_phage	55.4	1.1e-12
AZD41153.1|2240136_2240844_+	putative transcriptional regulator for fatty acid degradation FadQ, TetR family	NA	NA	NA	NA	NA
AZD41154.1|2241036_2242047_+	beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
AZD41155.1|2242058_2242802_+	S-methyl-5'-thioinosine phosphorylase	NA	NA	NA	NA	NA
AZD41156.1|2242908_2245602_-	DNA/RNA helicase, SNF2 family	NA	V9XTV7	Choristoneura_murinana_nucleopolyhedrovirus	30.8	6.0e-50
AZD41157.1|2245613_2246177_-	hypothetical protein	NA	NA	NA	NA	NA
AZD41158.1|2246187_2249637_-	Transcription-repair coupling factor	NA	NA	NA	NA	NA
AZD41159.1|2249987_2251451_+	NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AZD41160.1|2251577_2252876_-	putative MFS-type transporter	NA	Q6JIH2	Burkholderia_virus	37.9	3.1e-68
AZD41161.1|2253235_2254213_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
AZD41162.1|2254414_2255809_+	Soluble pyridine nucleotide transhydrogenase	NA	NA	NA	NA	NA
AZD41163.1|2255851_2256574_-	Glycerophosphoryl diester phosphodiesterase	NA	A0A292GJA3	Xanthomonas_phage	40.4	7.8e-05
AZD41164.1|2256635_2257223_-	hypothetical protein	NA	NA	NA	NA	NA
AZD41165.1|2257317_2258568_+	Lipoprotein releasing system transmembrane protein LolC	NA	NA	NA	NA	NA
AZD41166.1|2258560_2259259_+	Lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	41.1	1.3e-36
AZD41167.1|2259323_2260568_+	Lipoprotein releasing system transmembrane protein LolE	NA	NA	NA	NA	NA
2259837:2259853	attL	ATCAGCTCCGCGCCGGG	NA	NA	NA	NA
AZD41168.1|2260630_2261992_-	Copper sensory histidine kinase CusS	NA	B5LWN8	Feldmannia_species_virus	22.7	2.1e-06
AZD41169.1|2261991_2262672_-	Copper-sensing two-component system response regulator CusR	NA	NA	NA	NA	NA
AZD41170.1|2262827_2263382_+	Copper tolerance protein	NA	NA	NA	NA	NA
AZD41171.1|2263450_2264281_+	NADPH-dependent 7-cyano-7-deazaguanine reductase	NA	A0A2I7SAX1	Vibrio_phage	37.4	1.6e-38
AZD41172.1|2264329_2264593_-	Chromosome segregation ATPase	NA	NA	NA	NA	NA
AZD41173.1|2264706_2265327_-	Phosphonoacetaldehyde phosphonohydrolase-related protein	NA	NA	NA	NA	NA
AZD41174.1|2265529_2266213_+	Outer-membrane-phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AZD41175.1|2266272_2266572_-	hypothetical protein	NA	NA	NA	NA	NA
AZD41176.1|2266786_2268031_+	Serine phosphatase RsbU, regulator of sigma subunit	NA	NA	NA	NA	NA
AZD41177.1|2268030_2268513_+	Serine-protein kinase RsbW	NA	NA	NA	NA	NA
AZD41178.1|2268587_2269514_-	Transaldolase	NA	A0A127KNC6	Cyanophage	33.5	1.2e-13
AZD41179.1|2269703_2270723_-|tRNA	tRNA-dihydrouridine(20/20a) synthase	tRNA	NA	NA	NA	NA
AZD41180.1|2270825_2271923_+|integrase	Phage integrase family protein	integrase	L7TP61	Pseudomonas_virus	73.5	2.8e-155
AZD41181.1|2272698_2272971_-	hypothetical protein	NA	A0A2K8HN48	Pseudomonas_phage	60.7	5.9e-22
AZD41182.1|2272967_2274689_-	C-5 cytosine-specific DNA methylase family protein	NA	Q5QF27	Pseudomonas_virus	54.9	1.7e-215
AZD41183.1|2274685_2275705_-	hypothetical protein	NA	NA	NA	NA	NA
AZD41184.1|2275701_2276238_-	Phage hydrolase, HD superfamily	NA	A0A1W6JP41	Morganella_phage	38.6	6.0e-18
AZD41185.1|2276234_2276456_-	hypothetical protein	NA	NA	NA	NA	NA
AZD41186.1|2276452_2276872_-	hypothetical protein	NA	NA	NA	NA	NA
AZD41187.1|2276917_2277241_-	transcriptional regulator, putative	NA	NA	NA	NA	NA
AZD41188.1|2277396_2277681_-	DNA-binding protein Roi-related protein	NA	NA	NA	NA	NA
AZD41189.1|2277693_2278284_-	hypothetical protein	NA	NA	NA	NA	NA
AZD41190.1|2278280_2278457_-	hypothetical protein	NA	NA	NA	NA	NA
AZD41191.1|2278656_2279904_+	hypothetical protein	NA	NA	NA	NA	NA
AZD41192.1|2279890_2280622_-	repressor protein c2	NA	A5VW98	Enterobacteria_phage	38.7	1.9e-30
AZD41193.1|2281294_2281813_+	hypothetical protein	NA	NA	NA	NA	NA
AZD41194.1|2282022_2284242_+	DNA primase, phage associated	NA	A0A2D1GN57	Marinobacter_phage	47.4	7.6e-192
AZD41195.1|2284234_2284594_+	hypothetical protein	NA	NA	NA	NA	NA
AZD41196.1|2285133_2285478_+	Holin	NA	A0A2H4J893	uncultured_Caudovirales_phage	81.5	5.3e-44
AZD41197.1|2285623_2286223_+	hypothetical protein	NA	A0A2H4JG15	uncultured_Caudovirales_phage	67.9	7.6e-62
AZD41198.1|2286227_2288249_+|terminase	terminase, large subunit, putative	terminase	A0A2H4J898	uncultured_Caudovirales_phage	82.6	0.0e+00
AZD41199.1|2288250_2288457_+	hypothetical protein	NA	A0A2H4JA19	uncultured_Caudovirales_phage	73.5	7.6e-22
AZD41200.1|2288456_2289938_+|portal	phage portal protein, lambda family	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	84.6	5.7e-244
AZD41201.1|2289934_2291080_+|protease	Prophage Clp protease-like protein	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	70.3	1.1e-138
AZD41202.1|2291076_2291418_+	hypothetical protein	NA	A0A2H4JF15	uncultured_Caudovirales_phage	85.6	2.1e-45
AZD41203.1|2291582_2292578_+	Phage protein	NA	A0A2H4J890	uncultured_Caudovirales_phage	87.9	1.3e-167
AZD41204.1|2292580_2292901_+	hypothetical protein	NA	A0A2H4J879	uncultured_Caudovirales_phage	67.6	4.5e-37
AZD41205.1|2292897_2293563_+	hypothetical protein	NA	A0A2H4JBV1	uncultured_Caudovirales_phage	69.1	1.1e-82
AZD41206.1|2293555_2294086_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	57.1	6.7e-54
AZD41207.1|2294082_2294664_+|plate	Baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	69.8	2.3e-55
AZD41208.1|2294721_2294961_+	hypothetical protein	NA	NA	NA	NA	NA
AZD41209.1|2294965_2295292_+|plate	Phage baseplate assembly protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	60.4	4.1e-30
AZD41210.1|2295288_2296173_+|plate	Baseplate assembly protein J	plate	A0A2H4JFK9	uncultured_Caudovirales_phage	68.4	6.7e-107
AZD41211.1|2296174_2296780_+|tail	Phage tail fiber	tail	A0A2H4JDH5	uncultured_Caudovirales_phage	69.7	2.9e-77
AZD41212.1|2296776_2298279_+|tail	Phage tail fiber protein	tail	A0A2H4JF09	uncultured_Caudovirales_phage	77.7	2.3e-83
AZD41213.1|2298275_2298626_-	hypothetical protein	NA	NA	NA	NA	NA
AZD41214.1|2298737_2299898_+|tail	Phage tail sheath monomer	tail	A0A2H4J869	uncultured_Caudovirales_phage	76.8	2.0e-167
AZD41215.1|2299909_2300419_+|tail	Phage major tail tube protein	tail	A0A2H4JBU0	uncultured_Caudovirales_phage	68.3	5.8e-63
AZD41216.1|2300434_2300755_+	hypothetical protein	NA	A0A2H4J873	uncultured_Caudovirales_phage	57.0	5.3e-22
AZD41217.1|2300904_2303391_+	Phage protein	NA	A0A2H4JG00	uncultured_Caudovirales_phage	41.0	4.4e-79
AZD41218.1|2303403_2304249_+	Phage protein U	NA	A0A2H4J875	uncultured_Caudovirales_phage	73.2	1.9e-114
AZD41219.1|2304223_2304430_+|tail	Phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	74.6	4.5e-22
AZD41220.1|2304915_2305965_+	Phage protein D	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	77.1	1.3e-146
AZD41221.1|2306017_2306572_+	Lytic enzyme	NA	B5TK83	Pseudomonas_phage	77.6	3.5e-77
AZD41222.1|2306562_2307099_+	hypothetical protein	NA	B5TK84	Pseudomonas_phage	61.8	3.2e-51
AZD41223.1|2307268_2308243_+	hypothetical protein	NA	NA	NA	NA	NA
AZD41224.1|2308271_2308958_-	Gifsy-2 prophage protein	NA	A0A2H4J991	uncultured_Caudovirales_phage	73.7	2.8e-100
AZD41225.1|2308986_2309358_-	hypothetical protein	NA	NA	NA	NA	NA
AZD41226.1|2309667_2310537_+	hypothetical protein	NA	A0A2H4JE36	uncultured_Caudovirales_phage	34.9	8.2e-33
AZD41227.1|2310682_2311267_+	hypothetical protein	NA	NA	NA	NA	NA
AZD41228.1|2311673_2312312_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AZD41229.1|2312406_2313261_+	Transcriptional regulator	NA	NA	NA	NA	NA
AZD41230.1|2313313_2313802_-	hypothetical protein	NA	NA	NA	NA	NA
AZD41231.1|2314059_2315622_+	Two-component transcriptional response regulator, LuxR family	NA	NA	NA	NA	NA
AZD41232.1|2315625_2316216_-	Acetyltransferase	NA	NA	NA	NA	NA
AZD41233.1|2316403_2317240_+	N-hydroxyarylamine O-acetyltransferase	NA	NA	NA	NA	NA
AZD41234.1|2317252_2317675_-	hypothetical protein	NA	NA	NA	NA	NA
AZD41235.1|2317736_2318156_-	hypothetical protein	NA	NA	NA	NA	NA
AZD41236.1|2318396_2319935_+	Xanthine/uracil permease family protein	NA	NA	NA	NA	NA
AZD41237.1|2319990_2321148_-	putative MFS-type transporter	NA	NA	NA	NA	NA
AZD41238.1|2321175_2321364_+	hypothetical protein	NA	NA	NA	NA	NA
2321319:2321335	attR	ATCAGCTCCGCGCCGGG	NA	NA	NA	NA
AZD41239.1|2322054_2322288_+	hypothetical protein	NA	NA	NA	NA	NA
AZD41240.1|2322294_2322489_-	hypothetical protein	NA	NA	NA	NA	NA
AZD41241.1|2322623_2323820_-	aromatic-amino-acid aminotransferase	NA	NA	NA	NA	NA
AZD41242.1|2324155_2326171_+	Excinuclease ABC subunit B	NA	NA	NA	NA	NA
AZD41243.1|2326303_2327854_-	Inner-membrane proton/drug antiporter (MSF type) of tripartite multidrug efflux system	NA	NA	NA	NA	NA
AZD41244.1|2327843_2328905_-	Membrane fusion component of MSF-type tripartite multidrug efflux system	NA	NA	NA	NA	NA
AZD41245.1|2329141_2330623_+|tRNA	Glutamyl-tRNA synthetase	tRNA	NA	NA	NA	NA
AZD41246.1|2331556_2332096_+	Transcriptional regulator, AcrR family	NA	NA	NA	NA	NA
AZD41247.1|2332125_2332959_+	Putative hydrolase	NA	NA	NA	NA	NA
AZD41248.1|2333007_2333445_+	4-hydroxybenzoyl-CoA thioesterase domain protein	NA	NA	NA	NA	NA
AZD41249.1|2333544_2334504_+|tRNA	tRNA-dihydrouridine(16) synthase	tRNA	NA	NA	NA	NA
AZD41250.1|2334625_2335072_+	Small heat shock protein	NA	A0A1D8KN82	Synechococcus_phage	37.0	2.2e-18
AZD41251.1|2335257_2335956_+|tRNA	putative tRNA ligase	tRNA	NA	NA	NA	NA
AZD41252.1|2335952_2338637_+	Putative molecular chaperone, DnaJ family	NA	NA	NA	NA	NA
AZD41253.1|2338633_2340325_-	Chaperone protein HscC	NA	M4R062	Micromonas_pusilla_virus	38.5	1.8e-76
AZD41254.1|2340433_2343712_-	Sensory box/GGDEF family protein	NA	A0A127AWB9	Bacillus_phage	31.2	3.8e-14
AZD41255.1|2343793_2344684_-	Cys regulon transcriptional activator CysB	NA	NA	NA	NA	NA
AZD41256.1|2344829_2346248_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
AZD41257.1|2346258_2346903_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
AZD41258.1|2346982_2347132_-	hypothetical protein	NA	NA	NA	NA	NA
AZD41259.1|2347130_2348213_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
AZD41260.1|2348267_2349380_+	Aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AZD41261.1|2349563_2350574_+	Aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AZD41262.1|2350776_2353368_+	putative type IV pilus assembly FimV-related transmembrane protein	NA	NA	NA	NA	NA
AZD41263.1|2353448_2354108_-	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
AZD41264.1|2354308_2355163_+|tRNA	tRNA pseudouridine(38-40) synthase	tRNA	NA	NA	NA	NA
>prophage 4
CP027742	Pseudomonas chlororaphis subsp. aurantiaca strain 464 chromosome, complete genome	6964452	2391596	2397555	6964452	integrase	Pseudomonas_phage(50.0%)	9	2390918:2390931	2398539:2398552
2390918:2390931	attL	TCTGTTCGAGAGCG	NA	NA	NA	NA
AZD41306.1|2391596_2391899_+	Integration host factor alpha subunit	NA	A0A0H3UZA0	Geobacillus_virus	38.9	1.8e-11
AZD41307.1|2391879_2392236_+	Transcriptional regulator, MerR family	NA	NA	NA	NA	NA
AZD41308.1|2392473_2393355_-|integrase	Phage integrase family protein	integrase	A0A059VF45	Pseudomonas_phage	68.5	1.3e-115
AZD41309.1|2393522_2393924_-	hypothetical protein	NA	A0A059VFY6	Pseudomonas_phage	69.3	1.3e-44
AZD41310.1|2393962_2394541_-	hypothetical protein	NA	NA	NA	NA	NA
AZD41311.1|2394576_2394930_+	hypothetical protein	NA	J7HXL1	Pseudomonas_phage	45.8	5.7e-17
AZD41312.1|2395242_2395557_-	hypothetical protein	NA	NA	NA	NA	NA
AZD41313.1|2395810_2396017_-	Gifsy-2 prophage protein	NA	A0A2H4J991	uncultured_Caudovirales_phage	72.7	1.3e-21
AZD41314.1|2396334_2397555_-	hypothetical protein	NA	A0A2H4JA46	uncultured_Caudovirales_phage	38.9	7.9e-50
2398539:2398552	attR	TCTGTTCGAGAGCG	NA	NA	NA	NA
>prophage 5
CP027742	Pseudomonas chlororaphis subsp. aurantiaca strain 464 chromosome, complete genome	6964452	4408524	4414782	6964452	tRNA	uncultured_Caudovirales_phage(83.33%)	8	NA	NA
AZD43087.1|4408524_4408917_+|tRNA	tRNA 5-methylaminomethyl-2-thiouridine synthase subunit TusD	tRNA	A0A2H4JA39	uncultured_Caudovirales_phage	84.6	6.7e-59
AZD43088.1|4408920_4409283_+|tRNA	tRNA 5-methylaminomethyl-2-thiouridine synthase subunit TusC	tRNA	A0A2H4J8C0	uncultured_Caudovirales_phage	74.2	5.6e-44
AZD43089.1|4409282_4409582_+|tRNA	tRNA 5-methylaminomethyl-2-thiouridine synthase subunit TusB	tRNA	A0A2H4JG28	uncultured_Caudovirales_phage	69.7	2.4e-32
AZD43090.1|4409578_4409914_+|tRNA	tRNA 2-thiouridine synthesis protein TusE	tRNA	A0A2H4J8B6	uncultured_Caudovirales_phage	82.0	1.9e-46
AZD43091.1|4409910_4410912_+	Anthranilate phosphoribosyltransferase like	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	85.1	3.2e-166
AZD43092.1|4411000_4412008_+	Glutathione S-transferase, omega	NA	NA	NA	NA	NA
AZD43093.1|4412106_4413501_-	Precorrin-2 oxidase	NA	NA	NA	NA	NA
AZD43094.1|4413501_4414782_-|tRNA	Seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	54.8	3.6e-101
