The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027719	Pseudomonas chlororaphis subsp. aureofaciens strain P2 chromosome, complete genome	7203062	1309576	1399603	7203062	protease,tail,plate,tRNA	Pseudomonas_phage(41.18%)	94	NA	NA
AZD84033.1|1309576_1310929_+|protease	Intramembrane protease RasP/YluC, implicated in cell division based on FtsL cleavage	protease	NA	NA	NA	NA
AZD84034.1|1311003_1313391_+	Outer membrane protein assembly factor YaeT	NA	NA	NA	NA	NA
AZD84035.1|1313436_1313940_+	Outer membrane chaperone Skp, precursor	NA	NA	NA	NA	NA
AZD84036.1|1313943_1314999_+	UDP-3-O-[3-hydroxymyristoyl] glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AZD84037.1|1315108_1315549_+	3-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
AZD84038.1|1315545_1316322_+	Acyl-ADP--UDP-N- acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AZD84039.1|1316324_1317455_+	Lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AZD84040.1|1317466_1318099_+	Ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	38.9	1.7e-27
AZD84041.1|1318168_1321693_+	DNA polymerase III alpha subunit	NA	A0A2L1IZ23	Streptomyces_phage	38.0	1.8e-195
AZD84042.1|1321833_1322781_+	Acetyl-coenzyme A carboxyl transferase alpha chain	NA	NA	NA	NA	NA
AZD84043.1|1322900_1324229_+|tRNA	tRNA(Ile)-lysidine synthetase	tRNA	NA	NA	NA	NA
AZD84044.1|1324274_1324418_+	hypothetical protein	NA	NA	NA	NA	NA
AZD84045.1|1324503_1326135_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.5	6.9e-158
AZD84046.1|1326140_1326986_+	2-Keto-3-deoxy-D-manno-octulosonate-8-phosphate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.8	1.2e-49
AZD84047.1|1327143_1328433_+	Enolase	NA	A0A1X9I5Z8	Streptococcus_phage	59.2	9.0e-137
AZD84048.1|1328605_1328884_+	Cell division protein DivIC (FtsB), stabilizes FtsL against RasP cleavage	NA	NA	NA	NA	NA
AZD84049.1|1328880_1329588_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AZD84050.1|1329753_1330650_-	Transcriptional regulator, LysR family, in formaldehyde detoxification operon	NA	NA	NA	NA	NA
AZD84051.1|1330756_1331869_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.2	8.3e-30
AZD84052.1|1331957_1332803_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AZD84053.1|1332855_1333329_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
AZD84054.1|1333325_1334384_+|tRNA	tRNA pseudouridine(13) synthase	tRNA	NA	NA	NA	NA
AZD84055.1|1334371_1335121_+	5'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.6	1.4e-68
AZD84056.1|1335120_1335798_+	Protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.0	6.8e-43
AZD84057.1|1336088_1336841_+	Murein hydrolase activator NlpD	NA	A0A0S2SXL7	Bacillus_phage	33.3	5.7e-06
AZD84058.1|1336947_1337952_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	35.8	5.0e-34
AZD84059.1|1338453_1338777_-	4Fe-4S dicluster domain	NA	NA	NA	NA	NA
AZD84060.1|1338919_1341499_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.0	1.8e-27
AZD84061.1|1341635_1342421_+	Transcriptional regulator	NA	B5TK58	Pseudomonas_phage	90.7	4.2e-129
AZD84062.1|1343161_1343743_+	hypothetical protein	NA	NA	NA	NA	NA
AZD84063.1|1343845_1344193_+	Holin	NA	B5TK61	Pseudomonas_phage	87.7	1.0e-50
AZD84064.1|1344359_1345124_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	26.3	2.0e-06
AZD84065.1|1345346_1345871_+	hypothetical protein	NA	NA	NA	NA	NA
AZD84066.1|1345874_1346483_+|plate	Baseplate assembly protein V	plate	A0A2H4JBW8	uncultured_Caudovirales_phage	59.1	1.8e-47
AZD84067.1|1346496_1346829_+|plate	Baseplate assembly protein W	plate	A0A2H4JI46	uncultured_Caudovirales_phage	69.1	2.1e-37
AZD84068.1|1346825_1347821_+|plate	Phage-related baseplate assembly protein	plate	A0A2H4JC04	uncultured_Caudovirales_phage	62.0	1.2e-107
AZD84069.1|1347817_1348552_+|tail	Phage tail fiber	tail	A0A2H4JDK0	uncultured_Caudovirales_phage	52.0	9.0e-41
AZD84070.1|1348548_1349085_+|tail	Phage tail fiber	tail	A2I2X8	Vibrio_virus	62.1	1.0e-49
AZD84071.1|1349188_1349941_+	hypothetical protein	NA	NA	NA	NA	NA
AZD84072.1|1349952_1350189_+	hypothetical protein	NA	M4NK32	Synechococcus_phage	40.0	9.7e-05
AZD84073.1|1350276_1350498_+	hypothetical protein	NA	NA	NA	NA	NA
AZD84074.1|1350500_1351667_+|tail	Major tail sheath protein	tail	B0ZSG8	Halomonas_phage	57.5	8.5e-126
AZD84075.1|1351666_1352173_+	hypothetical protein	NA	Q6R4W3	Vibrio_virus	37.5	2.1e-25
AZD84076.1|1352299_1352881_+	hypothetical protein	NA	B0ZSH0	Halomonas_phage	39.1	9.1e-28
AZD84077.1|1352877_1353003_+	hypothetical protein	NA	NA	NA	NA	NA
AZD84078.1|1353009_1355274_+	Phage protein	NA	A0A2H4JAA5	uncultured_Caudovirales_phage	40.5	1.8e-07
AZD84079.1|1355273_1355657_+|tail	Unclassified tail protein	tail	A0A2H4JAC8	uncultured_Caudovirales_phage	53.5	4.7e-33
AZD84080.1|1355649_1355862_+|tail	P2-like prophage tail protein X	tail	A0A2H4JGD9	uncultured_Caudovirales_phage	68.6	3.9e-21
AZD84081.1|1355871_1356891_+|tail	Phage tail protein D	tail	A0A2H4JH05	uncultured_Caudovirales_phage	56.8	9.4e-105
AZD84082.1|1357071_1357656_+	hypothetical protein	NA	B5TK65	Pseudomonas_phage	71.5	3.4e-75
AZD84083.1|1357652_1357835_+	Mu-like prophage FluMu protein GP38	NA	B5TK66	Pseudomonas_phage	93.3	6.5e-25
AZD84084.1|1357834_1359331_+|tail	Bacteriophage tail sheath protein	tail	B5TK67	Pseudomonas_phage	90.6	3.0e-256
AZD84085.1|1359397_1359745_+|tail	Phage tail tube protein	tail	B5TK68	Pseudomonas_phage	93.9	2.9e-58
AZD84086.1|1359741_1360038_+|tail	Phage small tail protein E	tail	B5TK69	Pseudomonas_phage	94.9	2.3e-43
AZD84087.1|1360168_1361923_+|tail	Phage tail length tape-measure protein	tail	B5TK70	Pseudomonas_phage	54.4	3.2e-44
AZD84088.1|1361909_1363148_+|tail	Phage tail/DNA circulation protein	tail	B5TK71	Pseudomonas_phage	75.5	2.2e-180
AZD84089.1|1363151_1364192_+|tail	Prophage tail protein	tail	B5TK72	Pseudomonas_phage	82.4	8.6e-162
AZD84090.1|1364225_1364819_+|plate	Prophage baseplate assembly protein V	plate	B5TK73	Pseudomonas_phage	88.2	2.6e-78
AZD84091.1|1364818_1365217_+	Bacteriophage protein GP46	NA	B5TK74	Pseudomonas_phage	88.6	4.8e-65
AZD84092.1|1365206_1366247_+	Phage FluMu protein gp47	NA	B5TK75	Pseudomonas_phage	87.3	1.4e-167
AZD84093.1|1366234_1366834_+|tail	Prophage tail protein	tail	B5TK76	Pseudomonas_phage	91.0	1.9e-105
AZD84094.1|1366845_1367703_+|tail	Prophage tail fiber protein	tail	B5TK77	Pseudomonas_phage	76.4	1.5e-23
AZD84095.1|1367707_1368349_+	hypothetical protein	NA	B5TK78	Pseudomonas_phage	62.1	4.8e-38
AZD84096.1|1368732_1370286_+|tail	Prophage tail fiber protein	tail	A4PE45	Ralstonia_virus	54.2	1.8e-38
AZD84097.1|1370287_1370758_+	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	35.0	3.2e-07
AZD84098.1|1371151_1372234_+|tail	Prophage tail fiber protein	tail	B5TK79	Pseudomonas_phage	56.6	1.4e-111
AZD84099.1|1372241_1372844_+	Tail fiber assembly protein	NA	B5TK80	Pseudomonas_phage	49.2	6.9e-47
AZD84100.1|1372865_1373429_+	Lytic enzyme	NA	B5TK83	Pseudomonas_phage	84.4	8.9e-89
AZD84101.1|1373410_1373947_+	hypothetical protein	NA	B5TK84	Pseudomonas_phage	71.3	2.6e-61
AZD84102.1|1374029_1374530_+	Nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	86.1	1.0e-72
AZD84103.1|1374613_1375666_+	RecA protein	NA	A0A0S2MVG1	Bacillus_phage	60.9	4.4e-113
AZD84104.1|1375674_1376142_+	Regulatory protein RecX	NA	NA	NA	NA	NA
AZD84105.1|1376187_1377303_-	Decarboxylase family protein	NA	NA	NA	NA	NA
AZD84106.1|1377786_1377981_+	hypothetical protein	NA	NA	NA	NA	NA
AZD84107.1|1377982_1378405_-	Putative NADPH-quinone reductase (modulator of drug activity B)	NA	NA	NA	NA	NA
AZD84108.1|1378594_1379305_+	putative conserved protein YfiP, contains DTW domain	NA	NA	NA	NA	NA
AZD84109.1|1379639_1380290_+	Transcriptional regulator, LuxR family	NA	NA	NA	NA	NA
AZD84110.1|1380366_1380729_+	Diacylglycerol kinase	NA	NA	NA	NA	NA
AZD84111.1|1380725_1381652_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZD84112.1|1381785_1382565_+	Ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AZD84113.1|1382637_1383333_-	S-adenosylmethionine-dependent methyltransferase YaeB	NA	NA	NA	NA	NA
AZD84114.1|1383419_1384190_-	Rhamnolipid biosynthesis 3-oxoacyl-ACP reductase RhlG	NA	NA	NA	NA	NA
AZD84115.1|1384323_1384785_-	Uncharacterized protein YehS	NA	Q9EYF4	Enterobacteria_phage	51.3	8.5e-37
AZD84116.1|1384851_1385562_-	Ribosomal large subunit pseudouridine synthase F	NA	NA	NA	NA	NA
AZD84117.1|1385644_1386118_-	Acetyltransferase	NA	NA	NA	NA	NA
AZD84118.1|1386224_1387562_-	Ribosomal protein S12p Asp88 methylthiotransferase	NA	NA	NA	NA	NA
AZD84119.1|1387662_1387932_-	hypothetical protein	NA	NA	NA	NA	NA
AZD84120.1|1387953_1389795_+	Kup system potassium uptake protein	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	35.0	8.0e-78
AZD84121.1|1389994_1390270_-	hypothetical protein	NA	NA	NA	NA	NA
AZD84122.1|1390767_1392063_-	Alanylphosphatidylglycerol hydrolase, periplasmic	NA	NA	NA	NA	NA
AZD84123.1|1392062_1394711_-	Alanylphosphatidylglycerol synthase	NA	NA	NA	NA	NA
AZD84124.1|1395649_1396714_+	DNA polymerase IV	NA	NA	NA	NA	NA
AZD84125.1|1396916_1397870_-	putative lipoprotein	NA	NA	NA	NA	NA
AZD84126.1|1397887_1399603_-|tRNA	Prolyl-tRNA synthetase, bacterial type	tRNA	NA	NA	NA	NA
>prophage 2
CP027719	Pseudomonas chlororaphis subsp. aureofaciens strain P2 chromosome, complete genome	7203062	2053402	2088868	7203062	capsid,terminase,head,tail,plate,integrase	Pseudomonas_virus(43.75%)	46	2053266:2053290	2089834:2089858
2053266:2053290	attL	TTCGAATCCCTCCTCAACCGCCATA	NA	NA	NA	NA
AZD84727.1|2053402_2054569_-|integrase	Phage integrase	integrase	A0A2H4JGM5	uncultured_Caudovirales_phage	60.9	1.1e-138
AZD84728.1|2055031_2055280_-	hypothetical protein	NA	NA	NA	NA	NA
AZD84729.1|2055276_2055942_-	Phage protein	NA	A0A0U1SZL2	Pseudomonas_phage	48.6	1.2e-44
AZD84730.1|2055956_2056208_-	hypothetical protein	NA	NA	NA	NA	NA
AZD84731.1|2056204_2058004_-	C-5 cytosine-specific DNA methylase	NA	A0A0U1T6D1	Pseudomonas_phage	74.0	2.9e-210
AZD84732.1|2057996_2058455_-	hypothetical protein	NA	NA	NA	NA	NA
AZD84733.1|2058516_2058720_-	Phage protein	NA	Q9ZXI5	Pseudomonas_virus	67.7	6.8e-15
AZD84734.1|2058722_2058986_-	Enoyl-CoA hydratase	NA	NA	NA	NA	NA
AZD84735.1|2059063_2059429_-	Phage protein	NA	A0A0U4JP55	Pseudomonas_phage	55.5	2.9e-24
AZD84736.1|2059477_2060299_-	hypothetical protein	NA	A0A077K8T2	Ralstonia_phage	33.7	7.0e-26
AZD84737.1|2060351_2060492_-	hypothetical protein	NA	NA	NA	NA	NA
AZD84738.1|2060538_2063328_-	Phage protein	NA	A0A2H4J936	uncultured_Caudovirales_phage	65.4	0.0e+00
AZD84739.1|2063334_2063568_-	hypothetical protein	NA	NA	NA	NA	NA
AZD84740.1|2063642_2064011_-	hypothetical protein	NA	A0A2H4J947	uncultured_Caudovirales_phage	49.3	4.6e-09
AZD84741.1|2064007_2064298_-	hypothetical protein	NA	NA	NA	NA	NA
AZD84742.1|2064300_2064492_-	hypothetical protein	NA	NA	NA	NA	NA
AZD84743.1|2064725_2065259_-	Phage protein	NA	A0A0U4B0E3	Pseudomonas_phage	54.3	1.8e-30
AZD84744.1|2065944_2066385_+	hypothetical protein	NA	NA	NA	NA	NA
AZD84745.1|2066534_2066702_+	hypothetical protein	NA	NA	NA	NA	NA
AZD84746.1|2066733_2068005_-	hypothetical protein	NA	Q9ZXJ8	Pseudomonas_virus	79.9	1.5e-192
AZD84747.1|2068001_2068442_-|tail	Unclassified tail protein	tail	A0A2H4JG54	uncultured_Caudovirales_phage	75.3	5.7e-59
AZD84748.1|2068448_2071184_-|tail	Phage tail length tape-measure protein	tail	E5FFG5	Burkholderia_phage	38.2	6.2e-151
AZD84749.1|2071173_2071293_-|tail	Phage tail protein GpE, GpE'	tail	Q9ZXK1	Pseudomonas_virus	82.1	7.7e-11
AZD84750.1|2071301_2071631_-|tail	Phage tail fiber	tail	Q9ZXK2	Pseudomonas_virus	63.3	6.0e-29
AZD84751.1|2071694_2072210_-|tail	Phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	78.4	2.1e-76
AZD84752.1|2072265_2073435_-|tail	Phage tail sheath monomer	tail	Q9ZXK4	Pseudomonas_virus	77.7	3.5e-172
AZD84753.1|2073999_2075544_-|tail	Phage tail fiber protein	tail	A4PE45	Ralstonia_virus	48.0	2.0e-74
AZD84754.1|2075540_2076158_-|tail	Phage tail fiber	tail	A0A2H4JAU2	uncultured_Caudovirales_phage	71.7	4.7e-83
AZD84755.1|2076157_2077069_-|plate	Baseplate assembly protein J	plate	Q9ZXK8	Pseudomonas_virus	72.8	5.1e-118
AZD84756.1|2077405_2077996_-|plate	Baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	65.8	4.0e-55
AZD84757.1|2078342_2078606_-	hypothetical protein	NA	NA	NA	NA	NA
AZD84758.1|2078852_2079314_-|tail	Phage tail completion protein	tail	Q9ZXL2	Pseudomonas_virus	63.2	2.0e-46
AZD84759.1|2079310_2079787_-|tail	Phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	64.4	3.0e-45
AZD84760.1|2079883_2080327_-	Phage spanin Rz LysB	NA	Q9ZXL5	Pseudomonas_virus	34.3	5.0e-10
AZD84761.1|2080323_2080809_-	hypothetical protein	NA	NA	NA	NA	NA
AZD84762.1|2080805_2081009_-	hypothetical protein	NA	NA	NA	NA	NA
AZD84763.1|2081005_2081263_-	hypothetical protein	NA	NA	NA	NA	NA
AZD84764.1|2081259_2082102_-	Putative phage-encoded peptidoglycan binding protein	NA	Q9ZXL6	Pseudomonas_virus	70.7	6.2e-102
AZD84765.1|2082098_2082422_-	Holin, phage lambda	NA	A0A2H4JFM8	uncultured_Caudovirales_phage	53.8	1.4e-25
AZD84766.1|2082461_2082674_-|tail	Phage tail protein	tail	Q9ZXL9	Pseudomonas_virus	80.6	5.8e-25
AZD84767.1|2082673_2083153_-|head	Phage head completion-stabilization protein	head	Q9ZXM1	Pseudomonas_virus	62.3	1.4e-47
AZD84768.1|2083257_2083965_-|terminase	Phage terminase, endonuclease subunit	terminase	A0A2H4J948	uncultured_Caudovirales_phage	64.8	2.7e-74
AZD84769.1|2083976_2084984_-|capsid	Phage major capsid protein	capsid	A4PE30	Ralstonia_virus	64.0	1.1e-121
AZD84770.1|2085028_2085907_-|capsid	Phage capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	57.9	3.2e-77
AZD84771.1|2086058_2087819_+|terminase	Phage terminase, ATPase subunit	terminase	Q9ZXM5	Pseudomonas_virus	83.8	1.6e-298
AZD84772.1|2087818_2088868_+|capsid	Phage-related capsid packaging protein	capsid	A0A2H4J922	uncultured_Caudovirales_phage	83.4	4.6e-163
2089834:2089858	attR	TTCGAATCCCTCCTCAACCGCCATA	NA	NA	NA	NA
>prophage 3
CP027719	Pseudomonas chlororaphis subsp. aureofaciens strain P2 chromosome, complete genome	7203062	2221254	2336568	7203062	capsid,holin,terminase,portal,protease,tail,plate,integrase,tRNA	uncultured_Caudovirales_phage(35.63%)	140	2214518:2214535	2325482:2325499
2214518:2214535	attL	CACCGTTGCCTACGCCAA	NA	NA	NA	NA
AZD84885.1|2221254_2221863_-|protease	SOS-response repressor and protease LexA	protease	A0A2H4JG58	uncultured_Caudovirales_phage	55.4	1.1e-12
AZD84886.1|2222115_2222823_+	putative transcriptional regulator for fatty acid degradation FadQ, TetR family	NA	NA	NA	NA	NA
AZD84887.1|2223015_2224026_+	beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
AZD84888.1|2224037_2224781_+	S-methyl-5'-thioinosine phosphorylase	NA	NA	NA	NA	NA
AZD84889.1|2224885_2227579_-	DNA/RNA helicase, SNF2 family	NA	V9XTV7	Choristoneura_murinana_nucleopolyhedrovirus	29.9	1.0e-49
AZD84890.1|2227590_2228154_-	hypothetical protein	NA	NA	NA	NA	NA
AZD84891.1|2228164_2231614_-	Transcription-repair coupling factor	NA	NA	NA	NA	NA
AZD84892.1|2231862_2233428_+	NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AZD84893.1|2233575_2234874_-	putative MFS-type transporter	NA	Q6JIH2	Burkholderia_virus	37.9	1.4e-68
AZD84894.1|2235247_2236225_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
AZD84895.1|2236426_2237821_+	Soluble pyridine nucleotide transhydrogenase	NA	NA	NA	NA	NA
AZD84896.1|2237863_2238586_-	Glycerophosphoryl diester phosphodiesterase	NA	A0A292GJA3	Xanthomonas_phage	40.4	7.8e-05
AZD84897.1|2238647_2239235_-	hypothetical protein	NA	NA	NA	NA	NA
AZD84898.1|2239329_2240580_+	Lipoprotein releasing system transmembrane protein LolC	NA	NA	NA	NA	NA
AZD84899.1|2240572_2241271_+	Lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	41.1	5.8e-37
AZD84900.1|2241335_2242580_+	Lipoprotein releasing system transmembrane protein LolE	NA	NA	NA	NA	NA
AZD84901.1|2242642_2244004_-	Copper sensory histidine kinase CusS	NA	B5LWN8	Feldmannia_species_virus	22.7	3.5e-06
AZD84902.1|2244003_2244684_-	Copper-sensing two-component system response regulator CusR	NA	NA	NA	NA	NA
AZD84903.1|2244839_2245394_+	Copper tolerance protein	NA	NA	NA	NA	NA
AZD84904.1|2245462_2246293_+	NADPH-dependent 7-cyano-7-deazaguanine reductase	NA	A0A2I7SAX1	Vibrio_phage	37.4	2.8e-38
AZD84905.1|2246341_2246605_-	Chromosome segregation ATPase	NA	NA	NA	NA	NA
AZD84906.1|2246718_2247339_-	Phosphonoacetaldehyde phosphonohydrolase-related protein	NA	NA	NA	NA	NA
AZD84907.1|2247541_2248225_+	Outer-membrane-phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AZD84908.1|2248285_2248585_-	hypothetical protein	NA	NA	NA	NA	NA
AZD84909.1|2248862_2250044_+	Serine phosphatase RsbU, regulator of sigma subunit	NA	NA	NA	NA	NA
AZD84910.1|2250043_2250526_+	Serine-protein kinase RsbW	NA	NA	NA	NA	NA
AZD84911.1|2250600_2251527_-	Transaldolase	NA	A0A127KNC6	Cyanophage	33.5	1.2e-13
AZD84912.1|2251716_2252652_-|tRNA	tRNA-dihydrouridine(20/20a) synthase	tRNA	NA	NA	NA	NA
AZD84913.1|2252830_2253988_+|integrase	integrase family protein	integrase	L7TP61	Pseudomonas_virus	66.8	9.3e-141
AZD84914.1|2253962_2254238_-	hypothetical protein	NA	I6NSR8	Burkholderia_phage	65.9	1.5e-25
AZD84915.1|2254401_2254902_-	SAM-dependent methyltransferase	NA	A0A0N7IRF6	Acinetobacter_phage	64.1	6.5e-59
AZD84916.1|2254898_2256575_-	C-5 cytosine-specific DNA methylase	NA	Q5QF27	Pseudomonas_virus	41.8	1.5e-139
AZD84917.1|2256571_2257414_-	hypothetical protein	NA	NA	NA	NA	NA
AZD84918.1|2257410_2257500_-	hypothetical protein	NA	NA	NA	NA	NA
AZD84919.1|2257496_2257718_-	hypothetical protein	NA	NA	NA	NA	NA
AZD84920.1|2257714_2258119_-	hypothetical protein	NA	NA	NA	NA	NA
AZD84921.1|2258169_2258487_-	transcriptional regulator, putative	NA	NA	NA	NA	NA
AZD84922.1|2258645_2258930_-	DNA-binding protein Roi-related protein	NA	NA	NA	NA	NA
AZD84923.1|2258939_2259530_-	hypothetical protein	NA	NA	NA	NA	NA
AZD84924.1|2259526_2260351_-	Phage antirepressor protein	NA	A0A2H4JG39	uncultured_Caudovirales_phage	74.5	4.0e-37
AZD84925.1|2260350_2260521_-	hypothetical protein	NA	NA	NA	NA	NA
AZD84926.1|2260618_2261341_-	repressor protein c2	NA	A5VW98	Enterobacteria_phage	38.4	2.5e-27
AZD84927.1|2262010_2262529_+	hypothetical protein	NA	NA	NA	NA	NA
AZD84928.1|2262738_2264958_+	DNA primase, phage associated	NA	A0A2D1GN57	Marinobacter_phage	47.5	2.0e-192
AZD84929.1|2264950_2265310_+	hypothetical protein	NA	NA	NA	NA	NA
AZD84930.1|2265838_2266183_+	Holin	NA	A0A2H4J893	uncultured_Caudovirales_phage	81.5	5.3e-44
AZD84931.1|2266328_2266928_+	hypothetical protein	NA	A0A2H4JG15	uncultured_Caudovirales_phage	67.4	9.9e-62
AZD84932.1|2266932_2268954_+|terminase	terminase, large subunit, putative	terminase	A0A2H4J898	uncultured_Caudovirales_phage	83.7	0.0e+00
AZD84933.1|2268954_2269920_+|terminase	Phage terminase, large subunit	terminase	A0A2H4J898	uncultured_Caudovirales_phage	56.6	3.1e-97
AZD84934.1|2269989_2270196_+	hypothetical protein	NA	A0A2H4JA19	uncultured_Caudovirales_phage	75.0	2.6e-22
AZD84935.1|2270195_2271677_+|portal	phage portal protein, lambda family	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	84.4	9.7e-244
AZD84936.1|2271673_2272819_+|protease	Prophage Clp protease-like protein	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	70.3	1.1e-138
AZD84937.1|2272815_2273157_+	hypothetical protein	NA	A0A2H4JF15	uncultured_Caudovirales_phage	85.6	3.7e-45
AZD84938.1|2273320_2274316_+	Phage protein	NA	A0A2H4J890	uncultured_Caudovirales_phage	86.7	1.2e-165
AZD84939.1|2274318_2274639_+	hypothetical protein	NA	A0A2H4J879	uncultured_Caudovirales_phage	69.5	3.1e-38
AZD84940.1|2274635_2275301_+	hypothetical protein	NA	A0A2H4JBV1	uncultured_Caudovirales_phage	69.1	5.1e-83
AZD84941.1|2275293_2275824_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	58.9	3.2e-56
AZD84942.1|2275820_2276402_+|plate	Baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	69.3	8.7e-55
AZD84943.1|2276457_2276697_+	hypothetical protein	NA	NA	NA	NA	NA
AZD84944.1|2276701_2277028_+|plate	Phage baseplate assembly protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	60.4	4.1e-30
AZD84945.1|2277024_2277909_+|plate	Baseplate assembly protein J	plate	A0A2H4JFK9	uncultured_Caudovirales_phage	68.0	1.6e-105
AZD84946.1|2277910_2278522_+|tail	Phage tail fiber	tail	A0A2H4JDH5	uncultured_Caudovirales_phage	69.8	1.0e-66
AZD84947.1|2278616_2280059_+|tail	Phage tail fiber protein	tail	A4PE45	Ralstonia_virus	55.9	3.4e-68
AZD84948.1|2280599_2281760_+|tail	Phage tail sheath monomer	tail	A0A2H4J869	uncultured_Caudovirales_phage	76.8	2.0e-167
AZD84949.1|2281771_2282281_+|tail	Phage major tail tube protein	tail	A0A2H4JBU0	uncultured_Caudovirales_phage	68.9	3.4e-63
AZD84950.1|2282296_2282608_+	hypothetical protein	NA	A0A2H4J873	uncultured_Caudovirales_phage	51.5	1.3e-20
AZD84951.1|2282757_2285244_+	Phage protein	NA	A0A2H4JG00	uncultured_Caudovirales_phage	41.5	6.1e-81
AZD84952.1|2285256_2286102_+	Phage protein U	NA	A0A2H4J875	uncultured_Caudovirales_phage	73.2	1.9e-114
AZD84953.1|2286076_2286283_+|tail	Phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	74.6	4.5e-22
AZD84954.1|2286768_2287818_+	Phage protein D	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	76.5	2.5e-145
AZD84955.1|2287869_2288424_+	Lytic enzyme	NA	B5TK83	Pseudomonas_phage	77.6	3.5e-77
AZD84956.1|2288414_2288951_+	hypothetical protein	NA	B5TK84	Pseudomonas_phage	65.3	2.8e-52
AZD84957.1|2289631_2290426_+	Dam modification methylase	NA	C7BGE1	Burkholderia_phage	66.4	1.3e-98
AZD84958.1|2290627_2291809_-	hypothetical protein	NA	NA	NA	NA	NA
AZD84959.1|2291792_2292866_-	Nucleoid-associated protein ndpA	NA	A0A291AUQ0	Sinorhizobium_phage	39.5	5.0e-64
AZD84960.1|2293564_2294626_+|integrase	Phage integrase family protein	integrase	L7TP61	Pseudomonas_virus	78.6	6.0e-163
AZD84961.1|2294608_2294890_-	hypothetical protein	NA	A0A2K8HN48	Pseudomonas_phage	84.1	4.8e-35
AZD84962.1|2295049_2295442_-	hypothetical protein	NA	A0A291AUQ6	Sinorhizobium_phage	46.9	2.1e-28
AZD84963.1|2295503_2296196_-	Phage protein	NA	A0A2H4IY33	uncultured_phage	36.7	2.7e-34
AZD84964.1|2296247_2296997_-	hypothetical protein	NA	NA	NA	NA	NA
AZD84965.1|2296989_2297226_-	hypothetical protein	NA	NA	NA	NA	NA
AZD84966.1|2297222_2297528_-	hypothetical protein	NA	NA	NA	NA	NA
AZD84967.1|2297520_2297697_-	hypothetical protein	NA	A0A2H4J6V8	uncultured_Caudovirales_phage	55.2	4.1e-08
AZD84968.1|2297693_2298011_-	hypothetical protein	NA	A0A2H4J405	uncultured_Caudovirales_phage	60.6	1.1e-27
AZD84969.1|2298025_2298235_-	hypothetical protein	NA	NA	NA	NA	NA
AZD84970.1|2298231_2300028_-	C-5 cytosine-specific DNA methylase	NA	Q9ZXI4	Pseudomonas_virus	78.9	4.4e-230
AZD84971.1|2300085_2300697_-	DNA polymerase III alpha subunit	NA	A0A2H4J7C9	uncultured_Caudovirales_phage	69.0	4.7e-75
AZD84972.1|2300761_2302516_-	hypothetical protein	NA	J7HXJ7	Pseudomonas_phage	40.5	2.2e-93
AZD84973.1|2302520_2303567_-	DNA translocase FtsK	NA	A0A2H4J7E6	uncultured_Caudovirales_phage	47.8	3.5e-70
AZD84974.1|2303578_2303779_-	hypothetical protein	NA	A0A2H4J6K7	uncultured_Caudovirales_phage	65.2	1.0e-18
AZD84975.1|2303786_2304590_-	hypothetical protein	NA	H2BD49	Pseudomonas_phage	66.5	6.1e-99
AZD84976.1|2304601_2305405_-	hypothetical protein	NA	J7HXJ4	Pseudomonas_phage	69.7	1.4e-108
AZD84977.1|2305410_2305533_-	hypothetical protein	NA	NA	NA	NA	NA
AZD84978.1|2305529_2305682_-	hypothetical protein	NA	NA	NA	NA	NA
AZD84979.1|2305671_2305821_-	hypothetical protein	NA	NA	NA	NA	NA
AZD84980.1|2305817_2306060_-	hypothetical protein	NA	NA	NA	NA	NA
AZD84981.1|2306165_2307017_-	Phage flagellar hook-length control protein fliK	NA	Q775A9	Bordetella_phage	69.7	1.2e-33
AZD84982.1|2307220_2307364_-	hypothetical protein	NA	NA	NA	NA	NA
AZD84983.1|2307755_2308235_-	hypothetical protein	NA	NA	NA	NA	NA
AZD84984.1|2308263_2308398_-	hypothetical protein	NA	NA	NA	NA	NA
AZD84985.1|2308869_2309577_-	prophage MuSo1, transcriptional regulator, Cro/CI family	NA	A0A2D1GNH0	Pseudomonas_phage	39.3	8.7e-41
AZD84986.1|2309674_2309896_+	hypothetical protein	NA	A0A2D1GND2	Pseudomonas_phage	61.8	1.4e-18
AZD84987.1|2309898_2310213_+	Phage repressor protein C1	NA	NA	NA	NA	NA
AZD84988.1|2310215_2311193_+	hypothetical protein	NA	H2BD69	Pseudomonas_phage	74.6	4.7e-77
AZD84989.1|2311189_2311909_+	hypothetical protein	NA	A0A2H4J6S4	uncultured_Caudovirales_phage	53.9	1.6e-50
AZD84990.1|2311901_2312243_+	hypothetical protein	NA	NA	NA	NA	NA
AZD84991.1|2312235_2312679_+	Phage Holliday junction resolvase	NA	J7I4J7	Pseudomonas_phage	61.6	3.6e-45
AZD84992.1|2312675_2312774_+	hypothetical protein	NA	NA	NA	NA	NA
AZD84993.1|2312814_2313696_+	hypothetical protein	NA	J7HXH6	Pseudomonas_phage	54.1	2.4e-80
AZD84994.1|2313850_2314186_+|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	71.6	4.7e-37
AZD84995.1|2314225_2314444_+	hypothetical protein	NA	NA	NA	NA	NA
AZD84996.1|2314503_2315049_+|terminase	Phage terminase small subunit	terminase	H2BD75	Pseudomonas_phage	47.9	3.0e-33
AZD84997.1|2315002_2316427_+|terminase	Phage terminase, large subunit	terminase	A6N3C5	Burkholderia_virus	43.9	2.3e-96
AZD84998.1|2316440_2317946_+	Phage-related protein	NA	A0A2H4P6S9	Pseudomonas_phage	47.1	3.2e-109
AZD84999.1|2317953_2318688_+	Plasmid-related protein	NA	Q6IWU3	Burkholderia_phage	40.2	2.0e-40
AZD85000.1|2318695_2318986_+	hypothetical protein	NA	NA	NA	NA	NA
AZD85001.1|2319039_2320218_+	hypothetical protein	NA	Q6IWU4	Burkholderia_phage	40.3	8.2e-52
AZD85002.1|2320221_2320728_+	hypothetical protein	NA	Q6IWU5	Burkholderia_phage	40.3	1.0e-19
AZD85003.1|2320741_2321803_+|capsid	Phage capsid and scaffold	capsid	I6ZXX2	Escherichia_phage	45.8	1.9e-76
AZD85004.1|2321873_2322251_+	hypothetical protein	NA	NA	NA	NA	NA
AZD85005.1|2322254_2322680_+	hypothetical protein	NA	A0A088C3T8	Shewanella_sp._phage	39.0	1.4e-17
AZD85006.1|2322667_2323135_+	Phage-related protein	NA	A0A077KC03	Edwardsiella_phage	40.0	4.0e-18
AZD85007.1|2323131_2323506_+	hypothetical protein	NA	NA	NA	NA	NA
AZD85008.1|2323502_2324039_+	hypothetical protein	NA	NA	NA	NA	NA
AZD85009.1|2324048_2325545_+	hypothetical protein	NA	Q6IWV2	Burkholderia_phage	34.7	3.2e-69
2325482:2325499	attR	CACCGTTGCCTACGCCAA	NA	NA	NA	NA
AZD85010.1|2325590_2326046_+	hypothetical protein	NA	A0A2H4P6T4	Pseudomonas_phage	46.2	1.6e-27
AZD85011.1|2326055_2326511_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	50.4	3.3e-25
AZD85012.1|2326606_2328307_+	hypothetical protein	NA	A0A088C3U4	Shewanella_sp._phage	25.3	1.6e-19
AZD85013.1|2328306_2328852_+	hypothetical protein	NA	NA	NA	NA	NA
AZD85014.1|2328851_2329154_+	hypothetical protein	NA	NA	NA	NA	NA
AZD85015.1|2329146_2329962_+	Phage protein	NA	A1Z005	Burkholderia_virus	27.0	2.6e-12
AZD85016.1|2329958_2330627_+	Phage-related protein	NA	Q6IWQ1	Burkholderia_phage	42.9	1.8e-40
AZD85017.1|2330623_2330968_+	hypothetical protein	NA	A0A2H5BG60	Pseudoalteromonas_phage	25.7	2.9e-05
AZD85018.1|2330960_2332151_+	Phage-related protein	NA	A0A2H5BG53	Pseudoalteromonas_phage	39.9	2.1e-71
AZD85019.1|2332147_2332810_+	Transposon/IS	NA	Q6IWQ4	Burkholderia_phage	46.8	2.0e-47
AZD85020.1|2332811_2333843_+|tail	Phage tail fiber protein	tail	A4JWL8	Burkholderia_virus	36.9	2.1e-11
AZD85021.1|2334352_2335390_+	hypothetical protein	NA	A0A1R3Y5Q6	Salmonella_virus	25.4	1.9e-12
AZD85022.1|2335451_2335877_+	Cell wall hydrolase	NA	A0A1B0VMI2	Pseudomonas_phage	83.7	8.5e-68
AZD85023.1|2335876_2336248_+	hypothetical protein	NA	A0A0S2SY58	Pseudomonas_phage	49.1	2.6e-20
AZD85024.1|2336244_2336568_+	Phage protein	NA	H2BDA1	Pseudomonas_phage	64.8	7.2e-27
>prophage 4
CP027719	Pseudomonas chlororaphis subsp. aureofaciens strain P2 chromosome, complete genome	7203062	3929757	3985025	7203062	tail	Pseudomonas_phage(61.4%)	86	NA	NA
AZD86488.1|3929757_3930186_+	putative acetyltransferase	NA	A0A1X9I6I8	Streptococcus_phage	34.1	5.1e-20
AZD86489.1|3930290_3930677_-	hypothetical protein	NA	NA	NA	NA	NA
AZD86490.1|3930707_3930947_+	hypothetical protein	NA	NA	NA	NA	NA
AZD86491.1|3931294_3931687_+	hypothetical protein	NA	NA	NA	NA	NA
AZD86492.1|3931983_3932133_-	hypothetical protein	NA	NA	NA	NA	NA
AZD86493.1|3932295_3932532_-	lipoprotein, putative	NA	NA	NA	NA	NA
AZD86494.1|3932961_3933480_-	hypothetical protein	NA	B5TK84	Pseudomonas_phage	64.7	1.2e-50
AZD86495.1|3933476_3933902_-	structural protein P5, putative	NA	A0A2H4J6R1	uncultured_Caudovirales_phage	88.7	1.6e-66
AZD86496.1|3933961_3934669_-	hypothetical protein	NA	A0A059VFX9	Pseudomonas_phage	50.4	3.2e-51
AZD86497.1|3934668_3935427_-	hypothetical protein	NA	A0A0S2SY45	Pseudomonas_phage	45.1	2.0e-35
AZD86498.1|3935490_3936171_-	hypothetical protein	NA	A0A2D1GNS6	Pseudomonas_phage	40.2	9.9e-42
AZD86499.1|3936170_3936494_-	hypothetical protein	NA	NA	NA	NA	NA
AZD86500.1|3936490_3939424_-|tail	Phage tail fiber protein	tail	A0A059VFW9	Pseudomonas_phage	71.2	0.0e+00
AZD86501.1|3939420_3939819_-	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	82.6	3.1e-64
AZD86502.1|3939875_3940796_-	hypothetical protein	NA	A0A0F6SJ48	Sinorhizobium_phage	34.8	2.0e-05
AZD86503.1|3940798_3941401_-	hypothetical protein	NA	A0A059VA31	Pseudomonas_phage	88.4	9.2e-100
AZD86504.1|3941400_3941985_-	hypothetical protein	NA	A0A059VJR9	Pseudomonas_phage	79.9	2.4e-84
AZD86505.1|3942003_3944163_-|tail	Phage tail length tape-measure protein 1	tail	A0A2H4J7J3	uncultured_Caudovirales_phage	51.4	8.2e-175
AZD86506.1|3945418_3945718_-	hypothetical protein	NA	NA	NA	NA	NA
AZD86507.1|3945727_3945976_-	hypothetical protein	NA	NA	NA	NA	NA
AZD86508.1|3946224_3946581_-	hypothetical protein	NA	NA	NA	NA	NA
AZD86509.1|3946612_3946756_-	hypothetical protein	NA	A0A059VJS3	Pseudomonas_phage	60.9	4.6e-10
AZD86510.1|3946854_3947340_-	hypothetical protein	NA	A0A059VF34	Pseudomonas_phage	51.7	1.3e-40
AZD86511.1|3947420_3948584_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	89.4	2.5e-154
AZD86512.1|3948648_3949044_-	hypothetical protein	NA	A0A059VK45	Pseudomonas_phage	80.9	4.4e-58
AZD86513.1|3949040_3949616_-	hypothetical protein	NA	A0A2H4J0Q3	uncultured_Caudovirales_phage	39.2	1.3e-26
AZD86514.1|3949616_3950003_-	hypothetical protein	NA	A0A059VA70	Pseudomonas_phage	52.8	1.7e-27
AZD86515.1|3950005_3950383_-	hypothetical protein	NA	A0A2H4J0N2	uncultured_Caudovirales_phage	64.5	2.7e-33
AZD86516.1|3950386_3950665_-	hypothetical protein	NA	A0A0H5BBX8	Pseudomonas_phage	66.7	3.0e-05
AZD86517.1|3950714_3951683_-	putative phage protein	NA	A0A0H5ARK0	Pseudomonas_phage	79.8	1.3e-140
AZD86518.1|3951692_3952439_-	hypothetical protein	NA	A0A0H5AWD1	Pseudomonas_phage	61.0	2.0e-67
AZD86519.1|3952546_3953662_-	Phage protein	NA	A0A0H5BBX3	Pseudomonas_phage	60.8	8.7e-128
AZD86520.1|3953663_3955040_-	structural protein	NA	A0A0H5AWC7	Pseudomonas_phage	73.5	6.8e-191
AZD86521.1|3955042_3956530_-	hypothetical protein	NA	A0A2H4J2I1	uncultured_Caudovirales_phage	85.7	1.2e-257
AZD86522.1|3956531_3957131_-	hypothetical protein	NA	A0A2H4J2I6	uncultured_Caudovirales_phage	42.0	6.3e-24
AZD86523.1|3957204_3957465_+	hypothetical protein	NA	NA	NA	NA	NA
AZD86524.1|3957486_3957738_-	hypothetical protein	NA	NA	NA	NA	NA
AZD86525.1|3957734_3957923_-	hypothetical protein	NA	A0A0H5ARJ1	Pseudomonas_phage	59.3	8.5e-12
AZD86526.1|3958185_3958482_-	hypothetical protein	NA	V5K3F8	Pseudomonas_phage	34.0	5.6e-10
AZD86527.1|3958481_3958808_-	hypothetical protein	NA	A0A0A0YUH2	Pseudomonas_phage	70.3	6.2e-34
AZD86528.1|3958900_3959542_+	hypothetical protein	NA	NA	NA	NA	NA
AZD86529.1|3959702_3960374_-	Phage protein	NA	A0A2H4J9G7	uncultured_Caudovirales_phage	69.9	6.0e-84
AZD86530.1|3960370_3960973_-	NinG recombination protein	NA	L7TH85	Pseudomonas_virus	63.8	1.0e-66
AZD86531.1|3960969_3961440_-	hypothetical protein	NA	A0A2H4J106	uncultured_Caudovirales_phage	59.6	8.0e-51
AZD86532.1|3961432_3961627_-	hypothetical protein	NA	NA	NA	NA	NA
AZD86533.1|3961623_3962484_-	hypothetical protein	NA	NA	NA	NA	NA
AZD86534.1|3962480_3962663_-	hypothetical protein	NA	NA	NA	NA	NA
AZD86535.1|3962659_3962794_-	hypothetical protein	NA	A0A2H4J9M2	uncultured_Caudovirales_phage	86.4	5.5e-13
AZD86536.1|3962844_3963345_-	Phage protein	NA	H2BDI1	Pseudomonas_virus	61.6	1.5e-50
AZD86537.1|3963341_3964115_-	hypothetical protein	NA	A0A1B0VMD9	Pseudomonas_phage	73.2	6.9e-100
AZD86538.1|3964119_3964458_-	Primosomal protein I	NA	A0A1B0VME0	Pseudomonas_phage	61.6	8.4e-34
AZD86539.1|3965024_3965816_-	phage antirepressor	NA	A0A2D1GNK4	Pseudomonas_phage	57.6	8.8e-42
AZD86540.1|3965906_3966113_-	hypothetical protein	NA	A0A2H4J8V2	uncultured_Caudovirales_phage	88.2	1.3e-24
AZD86541.1|3966132_3966333_-	hypothetical protein	NA	A0A2H4J528	uncultured_Caudovirales_phage	98.5	9.6e-30
AZD86542.1|3966387_3966564_-	Transcriptional regulator, Cro/CI family	NA	A0A0S2SYB8	Pseudomonas_phage	64.4	7.2e-13
AZD86543.1|3966652_3967510_+	Transcriptional regulator, Cro/CI family	NA	A0A0S2SYF7	Pseudomonas_phage	54.3	1.2e-79
AZD86544.1|3967615_3968686_+	Phage protein	NA	Q7Y4B3	Escherichia_virus	40.0	2.0e-52
AZD86545.1|3968687_3969587_+	hypothetical protein	NA	NA	NA	NA	NA
AZD86546.1|3969587_3970721_-	DNA-cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	62.8	7.7e-116
AZD86547.1|3970701_3971019_-	Phage protein	NA	A0A0S2SYC9	Pseudomonas_phage	56.0	2.1e-23
AZD86548.1|3971718_3971853_+	hypothetical protein	NA	NA	NA	NA	NA
AZD86549.1|3971881_3972361_+	hypothetical protein	NA	NA	NA	NA	NA
AZD86550.1|3972407_3972521_+	hypothetical protein	NA	NA	NA	NA	NA
AZD86551.1|3972542_3972974_+	hypothetical protein	NA	A0A1B0VMC3	Pseudomonas_phage	40.1	2.6e-11
AZD86552.1|3972967_3973162_+	hypothetical protein	NA	A0A1B0VMB8	Pseudomonas_phage	46.8	2.0e-08
AZD86553.1|3973158_3973353_+	hypothetical protein	NA	NA	NA	NA	NA
AZD86554.1|3973349_3973472_+	hypothetical protein	NA	NA	NA	NA	NA
AZD86555.1|3973578_3973812_-	hypothetical protein	NA	NA	NA	NA	NA
AZD86556.1|3973803_3974739_+	TolA protein	NA	A0A1B0VN89	Pseudomonas_phage	35.9	1.5e-11
AZD86557.1|3974746_3975508_+	Phage related protein	NA	Q9MC70	Pseudomonas_phage	52.2	5.1e-55
AZD86558.1|3975511_3976129_+	Phage related protein	NA	A0A1B0VMB3	Pseudomonas_phage	87.3	1.7e-101
AZD86559.1|3976125_3976650_+	hypothetical protein	NA	NA	NA	NA	NA
AZD86560.1|3976722_3977034_+	hypothetical protein	NA	A0A2H4JAQ1	uncultured_Caudovirales_phage	84.5	1.8e-43
AZD86561.1|3977093_3977570_+	Phage protein	NA	NA	NA	NA	NA
AZD86562.1|3977690_3978278_+	hypothetical protein	NA	A0A0A0YR68	Pseudomonas_phage	39.9	6.1e-24
AZD86563.1|3978333_3978687_+	hypothetical protein	NA	NA	NA	NA	NA
AZD86564.1|3979061_3980057_+	Retron-type RNA-directed DNA polymerase	NA	A0A0N7AE80	Bacillus_phage	36.7	1.3e-45
AZD86565.1|3980304_3980508_+	hypothetical protein	NA	A0A2H4IZU4	uncultured_Caudovirales_phage	89.6	2.9e-26
AZD86566.1|3980782_3981166_+	hypothetical protein	NA	NA	NA	NA	NA
AZD86567.1|3981162_3981399_+	hypothetical protein	NA	NA	NA	NA	NA
AZD86568.1|3981391_3982150_+	hypothetical protein	NA	NA	NA	NA	NA
AZD86569.1|3982146_3982326_+	hypothetical protein	NA	NA	NA	NA	NA
AZD86570.1|3982391_3982958_+	Phage protein	NA	A0A0S3UGC2	Pseudomonas_phage	56.0	2.4e-49
AZD86571.1|3983019_3983334_+	Phage protein	NA	B5WZY6	Pseudomonas_phage	64.7	5.9e-34
AZD86572.1|3983327_3983630_+	hypothetical protein	NA	A0A2H4JG78	uncultured_Caudovirales_phage	41.4	1.3e-06
AZD86573.1|3983999_3985025_+	Mobile element protein	NA	C8CLF4	Xylella_phage	54.5	2.9e-93
>prophage 5
CP027719	Pseudomonas chlororaphis subsp. aureofaciens strain P2 chromosome, complete genome	7203062	4703085	4709344	7203062	tRNA	uncultured_Caudovirales_phage(83.33%)	8	NA	NA
AZD87159.1|4703085_4703478_+|tRNA	tRNA 5-methylaminomethyl-2-thiouridine synthase subunit TusD	tRNA	A0A2H4JA39	uncultured_Caudovirales_phage	84.6	6.7e-59
AZD87160.1|4703481_4703844_+|tRNA	tRNA 5-methylaminomethyl-2-thiouridine synthase subunit TusC	tRNA	A0A2H4J8C0	uncultured_Caudovirales_phage	75.0	1.9e-44
AZD87161.1|4703843_4704143_+|tRNA	tRNA 5-methylaminomethyl-2-thiouridine synthase subunit TusB	tRNA	A0A2H4JG28	uncultured_Caudovirales_phage	69.7	1.1e-32
AZD87162.1|4704139_4704475_+|tRNA	tRNA 2-thiouridine synthesis protein TusE	tRNA	A0A2H4J8B6	uncultured_Caudovirales_phage	82.0	1.9e-46
AZD87163.1|4704471_4705473_+	Anthranilate phosphoribosyltransferase like	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	84.5	2.1e-165
AZD87164.1|4705562_4706570_+	Glutathione S-transferase, omega	NA	NA	NA	NA	NA
AZD87165.1|4706668_4708063_-	Precorrin-2 oxidase	NA	NA	NA	NA	NA
AZD87166.1|4708063_4709344_-|tRNA	Seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	55.1	2.1e-101
