The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027741	Pseudomonas chlororaphis subsp. aurantiaca strain 449 chromosome, complete genome	6962068	1326990	1416475	6962068	plate,protease,tRNA,tail	Pseudomonas_phage(42.0%)	92	NA	NA
AZD33969.1|1326990_1328343_+|protease	Intramembrane protease RasP/YluC, implicated in cell division based on FtsL cleavage	protease	NA	NA	NA	NA
AZD33970.1|1328417_1330805_+	Outer membrane protein assembly factor YaeT	NA	NA	NA	NA	NA
AZD33971.1|1330850_1331354_+	Outer membrane chaperone Skp, precursor	NA	NA	NA	NA	NA
AZD33972.1|1331357_1332413_+	UDP-3-O-[3-hydroxymyristoyl] glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AZD33973.1|1332522_1332963_+	3-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
AZD33974.1|1332959_1333736_+	Acyl-ADP--UDP-N- acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AZD33975.1|1333738_1334869_+	Lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AZD33976.1|1334880_1335513_+	Ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	38.9	1.7e-27
AZD33977.1|1335582_1339107_+	DNA polymerase III alpha subunit	NA	A0A2L1IZ23	Streptomyces_phage	38.0	6.2e-196
AZD33978.1|1339247_1340195_+	Acetyl-coenzyme A carboxyl transferase alpha chain	NA	NA	NA	NA	NA
AZD33979.1|1340314_1341643_+|tRNA	tRNA(Ile)-lysidine synthetase	tRNA	NA	NA	NA	NA
AZD33980.1|1341688_1341832_+	hypothetical protein	NA	NA	NA	NA	NA
AZD33981.1|1341917_1343549_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.5	6.9e-158
AZD33982.1|1343554_1344400_+	2-Keto-3-deoxy-D-manno-octulosonate-8-phosphate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.8	1.2e-49
AZD33983.1|1344557_1345847_+	Enolase	NA	A0A1X9I5Z8	Streptococcus_phage	59.2	9.0e-137
AZD33984.1|1346019_1346298_+	Cell division protein DivIC (FtsB), stabilizes FtsL against RasP cleavage	NA	NA	NA	NA	NA
AZD33985.1|1346294_1347002_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AZD33986.1|1347167_1348064_-	Transcriptional regulator, LysR family, in formaldehyde detoxification operon	NA	NA	NA	NA	NA
AZD33987.1|1348170_1349283_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.2	8.3e-30
AZD33988.1|1349371_1350217_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AZD33989.1|1350269_1350743_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
AZD33990.1|1350739_1351798_+|tRNA	tRNA pseudouridine(13) synthase	tRNA	NA	NA	NA	NA
AZD33991.1|1351785_1352535_+	5'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.6	1.4e-68
AZD33992.1|1352534_1353212_+	Protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.0	8.9e-43
AZD33993.1|1353421_1354255_+	Murein hydrolase activator NlpD	NA	A0A0S2SXL7	Bacillus_phage	33.3	6.3e-06
AZD33994.1|1354361_1355366_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	35.8	5.0e-34
AZD33995.1|1355867_1356191_-	4Fe-4S dicluster domain	NA	NA	NA	NA	NA
AZD33996.1|1356333_1358913_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	23.5	1.8e-27
AZD33997.1|1359109_1359835_+	Transcriptional regulator	NA	B5TK58	Pseudomonas_phage	90.6	3.8e-124
AZD33998.1|1360574_1361156_+	hypothetical protein	NA	NA	NA	NA	NA
AZD33999.1|1361258_1361606_+	Holin	NA	B5TK61	Pseudomonas_phage	87.7	7.7e-51
AZD34000.1|1361772_1362537_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	25.8	3.4e-06
AZD34001.1|1362759_1363284_+	hypothetical protein	NA	NA	NA	NA	NA
AZD34002.1|1363287_1363896_+|plate	Baseplate assembly protein V	plate	A0A2H4JBW8	uncultured_Caudovirales_phage	59.0	1.8e-47
AZD34003.1|1363909_1364242_+|plate	Baseplate assembly protein W	plate	A0A2H4JI46	uncultured_Caudovirales_phage	69.1	2.1e-37
AZD34004.1|1364238_1365234_+|plate	Phage-related baseplate assembly protein	plate	A0A2H4JC04	uncultured_Caudovirales_phage	62.3	3.1e-108
AZD34005.1|1365230_1365965_+|tail	Phage tail fiber	tail	A0A2H4JDK0	uncultured_Caudovirales_phage	50.9	1.3e-39
AZD34006.1|1365961_1366492_+|tail	Phage tail fiber	tail	A2I2X8	Vibrio_virus	63.1	5.3e-51
AZD34007.1|1366644_1367262_+	hypothetical protein	NA	NA	NA	NA	NA
AZD34008.1|1367607_1367829_+	hypothetical protein	NA	NA	NA	NA	NA
AZD34009.1|1367831_1368998_+|tail	Major tail sheath protein	tail	B0ZSG8	Halomonas_phage	57.5	1.4e-125
AZD34010.1|1368997_1369504_+	hypothetical protein	NA	Q6R4W3	Vibrio_virus	36.9	2.1e-25
AZD34011.1|1369631_1370213_+	hypothetical protein	NA	B0ZSH0	Halomonas_phage	39.4	9.1e-28
AZD34012.1|1370209_1370335_+	hypothetical protein	NA	NA	NA	NA	NA
AZD34013.1|1370341_1372612_+	Phage protein	NA	A2I2Y1	Vibrio_virus	35.1	1.0e-34
AZD34014.1|1372611_1372995_+|tail	Unclassified tail protein	tail	A0A2H4JAC8	uncultured_Caudovirales_phage	53.5	4.7e-33
AZD34015.1|1372987_1373200_+|tail	P2-like prophage tail protein X	tail	A0A2H4JGD9	uncultured_Caudovirales_phage	68.6	3.9e-21
AZD34016.1|1373209_1374229_+|tail	Phage tail protein D	tail	A0A2H4JH05	uncultured_Caudovirales_phage	56.5	2.7e-104
AZD34017.1|1374410_1374995_+	hypothetical protein	NA	B5TK65	Pseudomonas_phage	72.5	3.1e-76
AZD34018.1|1374991_1375174_+	Mu-like prophage FluMu protein GP38	NA	B5TK66	Pseudomonas_phage	93.3	6.5e-25
AZD34019.1|1375173_1376670_+|tail	Bacteriophage tail sheath protein	tail	B5TK67	Pseudomonas_phage	90.8	7.8e-257
AZD34020.1|1376736_1377084_+|tail	Phage tail tube protein	tail	B5TK68	Pseudomonas_phage	93.9	2.9e-58
AZD34021.1|1377080_1377377_+|tail	Phage small tail protein E	tail	B5TK69	Pseudomonas_phage	94.9	2.3e-43
AZD34022.1|1377507_1379583_+|tail	Phage tail length tape-measure protein	tail	B5TK70	Pseudomonas_phage	47.9	1.7e-36
AZD34023.1|1379569_1380808_+|tail	Phage tail/DNA circulation protein	tail	B5TK71	Pseudomonas_phage	75.7	5.7e-181
AZD34024.1|1380811_1381852_+|tail	Prophage tail protein	tail	B5TK72	Pseudomonas_phage	82.7	1.9e-161
AZD34025.1|1381916_1382426_+|plate	Prophage baseplate assembly protein V	plate	B5TK73	Pseudomonas_phage	89.3	4.4e-79
AZD34026.1|1382425_1382824_+	Bacteriophage protein GP46	NA	B5TK74	Pseudomonas_phage	89.4	1.7e-65
AZD34027.1|1382813_1383854_+	Phage FluMu protein gp47	NA	B5TK75	Pseudomonas_phage	87.3	2.3e-167
AZD34028.1|1383841_1384441_+|tail	Prophage tail protein	tail	B5TK76	Pseudomonas_phage	91.5	8.5e-106
AZD34029.1|1384452_1385310_+|tail	Prophage tail fiber protein	tail	B5TK77	Pseudomonas_phage	76.4	1.5e-23
AZD34030.1|1385314_1385956_+	hypothetical protein	NA	B5TK78	Pseudomonas_phage	62.1	8.2e-38
AZD34031.1|1386154_1386286_-	hypothetical protein	NA	NA	NA	NA	NA
AZD34032.1|1386339_1387893_+|tail	Prophage tail fiber protein	tail	A4PE45	Ralstonia_virus	54.2	1.8e-38
AZD34033.1|1387894_1388365_+	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	35.0	4.2e-07
AZD34034.1|1388759_1389842_+|tail	Prophage tail fiber protein	tail	B5TK79	Pseudomonas_phage	56.6	4.2e-111
AZD34035.1|1389849_1390452_+	Tail fiber assembly protein	NA	B5TK80	Pseudomonas_phage	49.2	5.3e-47
AZD34036.1|1390473_1391037_+	Lytic enzyme	NA	B5TK83	Pseudomonas_phage	83.3	9.9e-88
AZD34037.1|1391018_1391555_+	hypothetical protein	NA	B5TK84	Pseudomonas_phage	71.9	3.4e-61
AZD34038.1|1391637_1392138_+	Nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	87.3	2.1e-73
AZD34039.1|1392221_1393274_+	RecA protein	NA	A0A0S2MVG1	Bacillus_phage	60.9	4.4e-113
AZD34040.1|1393282_1393750_+	Regulatory protein RecX	NA	NA	NA	NA	NA
AZD34041.1|1393795_1394911_-	Decarboxylase family protein	NA	NA	NA	NA	NA
AZD34042.1|1395393_1395588_+	hypothetical protein	NA	NA	NA	NA	NA
AZD34043.1|1395589_1396012_-	Putative NADPH-quinone reductase (modulator of drug activity B)	NA	NA	NA	NA	NA
AZD34044.1|1396201_1396912_+	putative conserved protein YfiP, contains DTW domain	NA	NA	NA	NA	NA
AZD34045.1|1397247_1397898_+	Transcriptional regulator, LuxR family	NA	NA	NA	NA	NA
AZD34046.1|1397973_1398336_+	Diacylglycerol kinase	NA	NA	NA	NA	NA
AZD34047.1|1398332_1399259_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZD34048.1|1399392_1400172_+	Ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AZD34049.1|1400244_1400973_-	S-adenosylmethionine-dependent methyltransferase YaeB	NA	NA	NA	NA	NA
AZD34050.1|1401061_1401832_-	Rhamnolipid biosynthesis 3-oxoacyl-ACP reductase RhlG	NA	NA	NA	NA	NA
AZD34051.1|1401965_1402427_-	Uncharacterized protein YehS	NA	Q9EYF4	Enterobacteria_phage	51.3	8.5e-37
AZD34052.1|1402493_1403204_-	Ribosomal large subunit pseudouridine synthase F	NA	NA	NA	NA	NA
AZD34053.1|1403286_1403760_-	Acetyltransferase	NA	NA	NA	NA	NA
AZD34054.1|1403865_1405203_-	Ribosomal protein S12p Asp88 methylthiotransferase	NA	NA	NA	NA	NA
AZD34055.1|1405535_1407437_+	Kup system potassium uptake protein	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	35.0	1.2e-76
AZD34056.1|1407640_1408936_-	Alanylphosphatidylglycerol hydrolase, periplasmic	NA	NA	NA	NA	NA
AZD34057.1|1408935_1411584_-	Alanylphosphatidylglycerol synthase	NA	NA	NA	NA	NA
AZD34058.1|1412522_1413587_+	DNA polymerase IV	NA	NA	NA	NA	NA
AZD34059.1|1413788_1414742_-	putative lipoprotein	NA	NA	NA	NA	NA
AZD34060.1|1414759_1416475_-|tRNA	Prolyl-tRNA synthetase, bacterial type	tRNA	NA	NA	NA	NA
>prophage 2
CP027741	Pseudomonas chlororaphis subsp. aurantiaca strain 449 chromosome, complete genome	6962068	2024170	2060836	6962068	capsid,tail,integrase,terminase,plate,head	Pseudomonas_virus(45.16%)	51	2024034:2024058	2062094:2062118
2024034:2024058	attL	TTCGAATCCCTCCTCAACCGCCATA	NA	NA	NA	NA
AZD34627.1|2024170_2025337_-|integrase	Phage integrase	integrase	A0A2H4JGM5	uncultured_Caudovirales_phage	60.9	6.7e-139
AZD34628.1|2025633_2025807_-	hypothetical protein	NA	NA	NA	NA	NA
AZD34629.1|2025799_2027059_-	hypothetical protein	NA	R9TRT5	Rhizobium_phage	72.6	2.8e-175
AZD34630.1|2027055_2027277_-	hypothetical protein	NA	NA	NA	NA	NA
AZD34631.1|2027273_2027924_-	Phage protein	NA	A0A0U1SZL2	Pseudomonas_phage	48.6	7.7e-44
AZD34632.1|2027939_2028197_-	hypothetical protein	NA	NA	NA	NA	NA
AZD34633.1|2028260_2028479_-	Phage protein	NA	Q9ZXI5	Pseudomonas_virus	71.4	3.3e-15
AZD34634.1|2028471_2029077_-	hypothetical protein	NA	NA	NA	NA	NA
AZD34635.1|2029079_2029343_-	hypothetical protein	NA	NA	NA	NA	NA
AZD34636.1|2029423_2029720_-	hypothetical protein	NA	NA	NA	NA	NA
AZD34637.1|2029741_2029882_-	hypothetical protein	NA	NA	NA	NA	NA
AZD34638.1|2029927_2032717_-	Phage protein	NA	A0A2H4J936	uncultured_Caudovirales_phage	65.4	0.0e+00
AZD34639.1|2032723_2032957_-	hypothetical protein	NA	NA	NA	NA	NA
AZD34640.1|2033031_2033400_-	hypothetical protein	NA	A0A2H4J947	uncultured_Caudovirales_phage	50.0	1.7e-08
AZD34641.1|2033396_2033687_-	hypothetical protein	NA	NA	NA	NA	NA
AZD34642.1|2033689_2033881_-	hypothetical protein	NA	NA	NA	NA	NA
AZD34643.1|2033879_2034098_+	hypothetical protein	NA	NA	NA	NA	NA
AZD34644.1|2034114_2034591_-	Phage protein	NA	A0A2H4JG61	uncultured_Caudovirales_phage	64.7	1.0e-53
AZD34645.1|2034631_2034883_-	hypothetical protein	NA	NA	NA	NA	NA
AZD34646.1|2035194_2035401_+	hypothetical protein	NA	NA	NA	NA	NA
AZD34647.1|2035736_2036636_+	hypothetical protein	NA	NA	NA	NA	NA
AZD34648.1|2036632_2037277_+	Permease of the drug/metabolite transporter (DMT) superfamily	NA	NA	NA	NA	NA
AZD34649.1|2037328_2037784_+	hypothetical protein	NA	NA	NA	NA	NA
AZD34650.1|2037789_2039094_-	hypothetical protein	NA	Q9ZXJ8	Pseudomonas_virus	78.3	1.3e-186
AZD34651.1|2039090_2039531_-	Phage tape measure	NA	A0A2H4JG54	uncultured_Caudovirales_phage	76.7	1.2e-59
AZD34652.1|2039537_2042273_-|tail	Phage tail length tape-measure protein	tail	A4PE52	Ralstonia_virus	45.0	1.1e-184
AZD34653.1|2042265_2042382_-|tail	Phage tail protein GpE, GpE'	tail	Q9ZXK1	Pseudomonas_virus	78.4	5.4e-09
AZD34654.1|2042390_2042720_-|tail	Phage tail fiber	tail	Q9ZXK2	Pseudomonas_virus	63.3	1.0e-28
AZD34655.1|2042779_2043295_-|tail	Phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	76.0	5.3e-72
AZD34656.1|2043351_2044521_-|tail	Phage tail sheath monomer	tail	Q9ZXK4	Pseudomonas_virus	73.3	5.5e-165
AZD34657.1|2045002_2046505_-|tail	Phage tail fiber protein	tail	A0A2H4JF09	uncultured_Caudovirales_phage	77.7	1.8e-83
AZD34658.1|2046501_2047119_-|tail	Phage tail fiber	tail	A0A2H4JAU2	uncultured_Caudovirales_phage	71.2	1.2e-81
AZD34659.1|2047118_2048030_-|plate	Baseplate assembly protein J	plate	Q9ZXK8	Pseudomonas_virus	72.1	4.3e-117
AZD34660.1|2048026_2048371_-|plate	Phage baseplate assembly protein	plate	Q9ZXK9	Pseudomonas_virus	65.5	4.1e-36
AZD34661.1|2048367_2048958_-|plate	Baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	65.8	1.2e-54
AZD34662.1|2049080_2049782_+	hypothetical protein	NA	NA	NA	NA	NA
AZD34663.1|2049784_2050243_-|tail	Phage tail completion protein	tail	Q9ZXL2	Pseudomonas_virus	64.0	2.2e-45
AZD34664.1|2050239_2050716_-|tail	Phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	64.4	1.8e-45
AZD34665.1|2050812_2051256_-	Phage spanin Rz LysB	NA	NA	NA	NA	NA
AZD34666.1|2051252_2051459_-	hypothetical protein	NA	NA	NA	NA	NA
AZD34667.1|2051455_2052301_-	Putative phage-encoded peptidoglycan binding protein	NA	Q9ZXL6	Pseudomonas_virus	69.6	6.4e-99
AZD34668.1|2052297_2052621_-	Holin, phage lambda	NA	A0A2H4JFM8	uncultured_Caudovirales_phage	54.8	6.1e-26
AZD34669.1|2052660_2052873_-|tail	Phage tail protein	tail	Q9ZXL9	Pseudomonas_virus	80.6	5.8e-25
AZD34670.1|2052872_2053352_-|head	Phage head completion-stabilization protein	head	Q9ZXM1	Pseudomonas_virus	62.3	1.4e-47
AZD34671.1|2053456_2054164_-|terminase	Phage terminase, endonuclease subunit	terminase	A0A2H4J948	uncultured_Caudovirales_phage	64.4	7.8e-74
AZD34672.1|2054175_2055183_-|capsid	Phage major capsid protein	capsid	A0A077KEQ8	Ralstonia_phage	63.6	3.2e-121
AZD34673.1|2055227_2056106_-|capsid	Phage capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	57.6	1.6e-76
AZD34674.1|2056257_2058018_+|terminase	Phage terminase, ATPase subunit	terminase	Q9ZXM5	Pseudomonas_virus	83.6	4.8e-298
AZD34675.1|2058017_2059070_+|capsid	Phage-related capsid packaging protein	capsid	A0A2H4J922	uncultured_Caudovirales_phage	83.4	4.6e-163
AZD34676.1|2059138_2060041_-	hypothetical protein	NA	NA	NA	NA	NA
AZD34677.1|2060137_2060836_-	Gifsy-2 prophage protein	NA	A0A2H4J991	uncultured_Caudovirales_phage	80.0	9.6e-109
2062094:2062118	attR	TTCGAATCCCTCCTCAACCGCCATA	NA	NA	NA	NA
>prophage 3
CP027741	Pseudomonas chlororaphis subsp. aurantiaca strain 449 chromosome, complete genome	6962068	2237341	2353229	6962068	tail,integrase,protease,terminase,plate,portal,tRNA	uncultured_Caudovirales_phage(59.09%)	113	2257903:2257919	2319385:2319401
AZD34817.1|2237341_2237950_-|protease	SOS-response repressor and protease LexA	protease	A0A2H4JG58	uncultured_Caudovirales_phage	55.4	1.1e-12
AZD34818.1|2238202_2238910_+	putative transcriptional regulator for fatty acid degradation FadQ, TetR family	NA	NA	NA	NA	NA
AZD34819.1|2239102_2240113_+	beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
AZD34820.1|2240124_2240868_+	S-methyl-5'-thioinosine phosphorylase	NA	NA	NA	NA	NA
AZD34821.1|2240974_2243668_-	DNA/RNA helicase, SNF2 family	NA	V9XTV7	Choristoneura_murinana_nucleopolyhedrovirus	30.8	6.0e-50
AZD34822.1|2243679_2244243_-	hypothetical protein	NA	NA	NA	NA	NA
AZD34823.1|2244253_2247703_-	Transcription-repair coupling factor	NA	NA	NA	NA	NA
AZD34824.1|2248053_2249517_+	NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AZD34825.1|2249643_2250942_-	putative MFS-type transporter	NA	Q6JIH2	Burkholderia_virus	37.9	3.1e-68
AZD34826.1|2251301_2252279_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
AZD34827.1|2252480_2253875_+	Soluble pyridine nucleotide transhydrogenase	NA	NA	NA	NA	NA
AZD34828.1|2253917_2254640_-	Glycerophosphoryl diester phosphodiesterase	NA	A0A292GJA3	Xanthomonas_phage	40.4	7.8e-05
AZD34829.1|2254701_2255289_-	hypothetical protein	NA	NA	NA	NA	NA
AZD34830.1|2255383_2256634_+	Lipoprotein releasing system transmembrane protein LolC	NA	NA	NA	NA	NA
AZD34831.1|2256626_2257325_+	Lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	41.1	1.3e-36
AZD34832.1|2257389_2258634_+	Lipoprotein releasing system transmembrane protein LolE	NA	NA	NA	NA	NA
2257903:2257919	attL	ATCAGCTCCGCGCCGGG	NA	NA	NA	NA
AZD34833.1|2258696_2260058_-	Copper sensory histidine kinase CusS	NA	B5LWN8	Feldmannia_species_virus	22.7	2.1e-06
AZD34834.1|2260057_2260738_-	Copper-sensing two-component system response regulator CusR	NA	NA	NA	NA	NA
AZD34835.1|2260893_2261448_+	Copper tolerance protein	NA	NA	NA	NA	NA
AZD34836.1|2261516_2262347_+	NADPH-dependent 7-cyano-7-deazaguanine reductase	NA	A0A2I7SAX1	Vibrio_phage	37.4	1.6e-38
AZD34837.1|2262395_2262659_-	Chromosome segregation ATPase	NA	NA	NA	NA	NA
AZD34838.1|2262772_2263393_-	Phosphonoacetaldehyde phosphonohydrolase-related protein	NA	NA	NA	NA	NA
AZD34839.1|2263595_2264279_+	Outer-membrane-phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AZD34840.1|2264338_2264638_-	hypothetical protein	NA	NA	NA	NA	NA
AZD34841.1|2264852_2266097_+	Serine phosphatase RsbU, regulator of sigma subunit	NA	NA	NA	NA	NA
AZD34842.1|2266096_2266579_+	Serine-protein kinase RsbW	NA	NA	NA	NA	NA
AZD34843.1|2266653_2267580_-	Transaldolase	NA	A0A127KNC6	Cyanophage	33.5	1.2e-13
AZD34844.1|2267769_2268789_-|tRNA	tRNA-dihydrouridine(20/20a) synthase	tRNA	NA	NA	NA	NA
AZD34845.1|2268891_2269989_+|integrase	Phage integrase family protein	integrase	L7TP61	Pseudomonas_virus	73.5	2.8e-155
AZD34846.1|2270764_2271037_-	hypothetical protein	NA	A0A2K8HN48	Pseudomonas_phage	60.7	5.9e-22
AZD34847.1|2271033_2272755_-	C-5 cytosine-specific DNA methylase family protein	NA	Q5QF27	Pseudomonas_virus	54.9	1.7e-215
AZD34848.1|2272751_2273771_-	hypothetical protein	NA	NA	NA	NA	NA
AZD34849.1|2273767_2274304_-	Phage hydrolase, HD superfamily	NA	A0A1W6JP41	Morganella_phage	38.6	6.0e-18
AZD34850.1|2274300_2274522_-	hypothetical protein	NA	NA	NA	NA	NA
AZD34851.1|2274518_2274938_-	hypothetical protein	NA	NA	NA	NA	NA
AZD34852.1|2274983_2275307_-	transcriptional regulator, putative	NA	NA	NA	NA	NA
AZD34853.1|2275462_2275747_-	DNA-binding protein Roi-related protein	NA	NA	NA	NA	NA
AZD34854.1|2275759_2276350_-	hypothetical protein	NA	NA	NA	NA	NA
AZD34855.1|2276346_2276523_-	hypothetical protein	NA	NA	NA	NA	NA
AZD34856.1|2276722_2277970_+	hypothetical protein	NA	NA	NA	NA	NA
AZD34857.1|2277956_2278688_-	repressor protein c2	NA	A5VW98	Enterobacteria_phage	38.7	1.9e-30
AZD34858.1|2279360_2279879_+	hypothetical protein	NA	NA	NA	NA	NA
AZD34859.1|2280088_2282308_+	DNA primase, phage associated	NA	A0A2D1GN57	Marinobacter_phage	47.4	7.6e-192
AZD34860.1|2282300_2282660_+	hypothetical protein	NA	NA	NA	NA	NA
AZD34861.1|2283199_2283544_+	Holin	NA	A0A2H4J893	uncultured_Caudovirales_phage	81.5	5.3e-44
AZD34862.1|2283689_2284289_+	hypothetical protein	NA	A0A2H4JG15	uncultured_Caudovirales_phage	67.9	7.6e-62
AZD34863.1|2284293_2286315_+|terminase	terminase, large subunit, putative	terminase	A0A2H4J898	uncultured_Caudovirales_phage	82.6	0.0e+00
AZD34864.1|2286316_2286523_+	hypothetical protein	NA	A0A2H4JA19	uncultured_Caudovirales_phage	73.5	7.6e-22
AZD34865.1|2286522_2288004_+|portal	phage portal protein, lambda family	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	84.6	5.7e-244
AZD34866.1|2288000_2289146_+|protease	Prophage Clp protease-like protein	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	70.3	1.1e-138
AZD34867.1|2289142_2289484_+	hypothetical protein	NA	A0A2H4JF15	uncultured_Caudovirales_phage	85.6	2.1e-45
AZD34868.1|2289648_2290644_+	Phage protein	NA	A0A2H4J890	uncultured_Caudovirales_phage	87.9	1.3e-167
AZD34869.1|2290646_2290967_+	hypothetical protein	NA	A0A2H4J879	uncultured_Caudovirales_phage	67.6	4.5e-37
AZD34870.1|2290963_2291629_+	hypothetical protein	NA	A0A2H4JBV1	uncultured_Caudovirales_phage	69.1	1.1e-82
AZD34871.1|2291621_2292152_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	57.1	6.7e-54
AZD34872.1|2292148_2292730_+|plate	Baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	69.8	2.3e-55
AZD34873.1|2292787_2293027_+	hypothetical protein	NA	NA	NA	NA	NA
AZD34874.1|2293031_2293358_+|plate	Phage baseplate assembly protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	60.4	4.1e-30
AZD34875.1|2293354_2294239_+|plate	Baseplate assembly protein J	plate	A0A2H4JFK9	uncultured_Caudovirales_phage	68.4	6.7e-107
AZD34876.1|2294240_2294846_+|tail	Phage tail fiber	tail	A0A2H4JDH5	uncultured_Caudovirales_phage	69.7	2.9e-77
AZD34877.1|2294842_2296345_+|tail	Phage tail fiber protein	tail	A0A2H4JF09	uncultured_Caudovirales_phage	77.7	2.3e-83
AZD34878.1|2296341_2296692_-	hypothetical protein	NA	NA	NA	NA	NA
AZD34879.1|2296803_2297964_+|tail	Phage tail sheath monomer	tail	A0A2H4J869	uncultured_Caudovirales_phage	76.8	2.0e-167
AZD34880.1|2297975_2298485_+|tail	Phage major tail tube protein	tail	A0A2H4JBU0	uncultured_Caudovirales_phage	68.3	5.8e-63
AZD34881.1|2298500_2298821_+	hypothetical protein	NA	A0A2H4J873	uncultured_Caudovirales_phage	57.0	5.3e-22
AZD34882.1|2298970_2301457_+	Phage protein	NA	A0A2H4JG00	uncultured_Caudovirales_phage	41.0	4.4e-79
AZD34883.1|2301469_2302315_+	Phage protein U	NA	A0A2H4J875	uncultured_Caudovirales_phage	73.2	1.9e-114
AZD34884.1|2302289_2302496_+|tail	Phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	74.6	4.5e-22
AZD34885.1|2302981_2304031_+	Phage protein D	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	77.1	1.3e-146
AZD34886.1|2304083_2304638_+	Lytic enzyme	NA	B5TK83	Pseudomonas_phage	77.6	3.5e-77
AZD34887.1|2304628_2305165_+	hypothetical protein	NA	B5TK84	Pseudomonas_phage	61.8	3.2e-51
AZD34888.1|2305334_2306309_+	hypothetical protein	NA	NA	NA	NA	NA
AZD34889.1|2306337_2307024_-	Gifsy-2 prophage protein	NA	A0A2H4J991	uncultured_Caudovirales_phage	73.7	2.8e-100
AZD34890.1|2307052_2307424_-	hypothetical protein	NA	NA	NA	NA	NA
AZD34891.1|2307733_2308603_+	hypothetical protein	NA	A0A2H4JE36	uncultured_Caudovirales_phage	34.9	8.2e-33
AZD34892.1|2308748_2309333_+	hypothetical protein	NA	NA	NA	NA	NA
AZD34893.1|2309739_2310378_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AZD34894.1|2310472_2311327_+	Transcriptional regulator	NA	NA	NA	NA	NA
AZD34895.1|2311379_2311868_-	hypothetical protein	NA	NA	NA	NA	NA
AZD34896.1|2312125_2313688_+	Two-component transcriptional response regulator, LuxR family	NA	NA	NA	NA	NA
AZD34897.1|2313691_2314282_-	Acetyltransferase	NA	NA	NA	NA	NA
AZD34898.1|2314469_2315306_+	N-hydroxyarylamine O-acetyltransferase	NA	NA	NA	NA	NA
AZD34899.1|2315318_2315741_-	hypothetical protein	NA	NA	NA	NA	NA
AZD34900.1|2315802_2316222_-	hypothetical protein	NA	NA	NA	NA	NA
AZD34901.1|2316462_2318001_+	Xanthine/uracil permease family protein	NA	NA	NA	NA	NA
AZD34902.1|2318056_2319214_-	putative MFS-type transporter	NA	NA	NA	NA	NA
AZD34903.1|2319241_2319430_+	hypothetical protein	NA	NA	NA	NA	NA
2319385:2319401	attR	ATCAGCTCCGCGCCGGG	NA	NA	NA	NA
AZD34904.1|2320120_2320354_+	hypothetical protein	NA	NA	NA	NA	NA
AZD34905.1|2320360_2320555_-	hypothetical protein	NA	NA	NA	NA	NA
AZD34906.1|2320689_2321886_-	aromatic-amino-acid aminotransferase	NA	NA	NA	NA	NA
AZD34907.1|2322221_2324237_+	Excinuclease ABC subunit B	NA	NA	NA	NA	NA
AZD34908.1|2324369_2325920_-	Inner-membrane proton/drug antiporter (MSF type) of tripartite multidrug efflux system	NA	NA	NA	NA	NA
AZD34909.1|2325909_2326971_-	Membrane fusion component of MSF-type tripartite multidrug efflux system	NA	NA	NA	NA	NA
AZD34910.1|2327207_2328689_+|tRNA	Glutamyl-tRNA synthetase	tRNA	NA	NA	NA	NA
AZD34911.1|2329622_2330162_+	Transcriptional regulator, AcrR family	NA	NA	NA	NA	NA
AZD34912.1|2330191_2331025_+	Putative hydrolase	NA	NA	NA	NA	NA
AZD34913.1|2331073_2331511_+	4-hydroxybenzoyl-CoA thioesterase domain protein	NA	NA	NA	NA	NA
AZD34914.1|2331610_2332570_+|tRNA	tRNA-dihydrouridine(16) synthase	tRNA	NA	NA	NA	NA
AZD34915.1|2332691_2333138_+	Small heat shock protein	NA	A0A1D8KN82	Synechococcus_phage	37.0	2.2e-18
AZD34916.1|2333323_2334022_+|tRNA	putative tRNA ligase	tRNA	NA	NA	NA	NA
AZD34917.1|2334018_2336703_+	Putative molecular chaperone, DnaJ family	NA	NA	NA	NA	NA
AZD34918.1|2336699_2338391_-	Chaperone protein HscC	NA	M4R062	Micromonas_pusilla_virus	38.5	1.8e-76
AZD34919.1|2338499_2341778_-	Sensory box/GGDEF family protein	NA	A0A127AWB9	Bacillus_phage	31.2	3.8e-14
AZD34920.1|2341859_2342750_-	Cys regulon transcriptional activator CysB	NA	NA	NA	NA	NA
AZD34921.1|2342895_2344314_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
AZD34922.1|2344324_2344969_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
AZD34923.1|2345048_2345198_-	hypothetical protein	NA	NA	NA	NA	NA
AZD34924.1|2345196_2346279_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
AZD34925.1|2346333_2347446_+	Aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AZD34926.1|2347629_2348640_+	Aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AZD34927.1|2348842_2351434_+	putative type IV pilus assembly FimV-related transmembrane protein	NA	NA	NA	NA	NA
AZD34928.1|2351514_2352174_-	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
AZD34929.1|2352374_2353229_+|tRNA	tRNA pseudouridine(38-40) synthase	tRNA	NA	NA	NA	NA
>prophage 4
CP027741	Pseudomonas chlororaphis subsp. aurantiaca strain 449 chromosome, complete genome	6962068	2389662	2395621	6962068	integrase	Pseudomonas_phage(50.0%)	9	2388984:2388997	2396605:2396618
2388984:2388997	attL	TCTGTTCGAGAGCG	NA	NA	NA	NA
AZD34971.1|2389662_2389965_+	Integration host factor alpha subunit	NA	A0A0H3UZA0	Geobacillus_virus	38.9	1.8e-11
AZD34972.1|2389945_2390302_+	Transcriptional regulator, MerR family	NA	NA	NA	NA	NA
AZD34973.1|2390539_2391421_-|integrase	Phage integrase family protein	integrase	A0A059VF45	Pseudomonas_phage	68.5	1.3e-115
AZD34974.1|2391588_2391990_-	hypothetical protein	NA	A0A059VFY6	Pseudomonas_phage	69.3	1.3e-44
AZD34975.1|2392028_2392607_-	hypothetical protein	NA	NA	NA	NA	NA
AZD34976.1|2392642_2392996_+	hypothetical protein	NA	J7HXL1	Pseudomonas_phage	45.8	5.7e-17
AZD34977.1|2393308_2393623_-	hypothetical protein	NA	NA	NA	NA	NA
AZD34978.1|2393876_2394083_-	Gifsy-2 prophage protein	NA	A0A2H4J991	uncultured_Caudovirales_phage	72.7	1.3e-21
AZD34979.1|2394400_2395621_-	hypothetical protein	NA	A0A2H4JA46	uncultured_Caudovirales_phage	38.9	7.9e-50
2396605:2396618	attR	TCTGTTCGAGAGCG	NA	NA	NA	NA
>prophage 5
CP027741	Pseudomonas chlororaphis subsp. aurantiaca strain 449 chromosome, complete genome	6962068	4406589	4412847	6962068	tRNA	uncultured_Caudovirales_phage(83.33%)	8	NA	NA
AZD36747.1|4406589_4406982_+|tRNA	tRNA 5-methylaminomethyl-2-thiouridine synthase subunit TusD	tRNA	A0A2H4JA39	uncultured_Caudovirales_phage	84.6	6.7e-59
AZD36748.1|4406985_4407348_+|tRNA	tRNA 5-methylaminomethyl-2-thiouridine synthase subunit TusC	tRNA	A0A2H4J8C0	uncultured_Caudovirales_phage	74.2	5.6e-44
AZD36749.1|4407347_4407647_+|tRNA	tRNA 5-methylaminomethyl-2-thiouridine synthase subunit TusB	tRNA	A0A2H4JG28	uncultured_Caudovirales_phage	69.7	2.4e-32
AZD36750.1|4407643_4407979_+|tRNA	tRNA 2-thiouridine synthesis protein TusE	tRNA	A0A2H4J8B6	uncultured_Caudovirales_phage	82.0	1.9e-46
AZD36751.1|4407975_4408977_+	Anthranilate phosphoribosyltransferase like	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	85.1	3.2e-166
AZD36752.1|4409065_4410073_+	Glutathione S-transferase, omega	NA	NA	NA	NA	NA
AZD36753.1|4410171_4411566_-	Precorrin-2 oxidase	NA	NA	NA	NA	NA
AZD36754.1|4411566_4412847_-|tRNA	Seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	54.8	3.6e-101
