The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027713	Pseudomonas chlororaphis strain TAMOak81 chromosome, complete genome	6711360	1332158	1422112	6711360	protease,tail,plate,tRNA	Pseudomonas_phage(40.38%)	94	NA	NA
AZD06620.1|1332158_1333511_+|protease	Intramembrane protease RasP/YluC, implicated in cell division based on FtsL cleavage	protease	NA	NA	NA	NA
AZD06621.1|1333585_1335973_+	Outer membrane protein assembly factor YaeT	NA	NA	NA	NA	NA
AZD06622.1|1336018_1336522_+	Outer membrane chaperone Skp, precursor	NA	NA	NA	NA	NA
AZD06623.1|1336525_1337581_+	UDP-3-O-[3-hydroxymyristoyl] glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AZD06624.1|1337690_1338131_+	3-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
AZD06625.1|1338127_1338904_+	Acyl-ADP--UDP-N- acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AZD06626.1|1338906_1340037_+	Lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AZD06627.1|1340033_1340681_+	Ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	38.9	1.0e-27
AZD06628.1|1340893_1344418_+	DNA polymerase III alpha subunit	NA	A0A2L1IZ23	Streptomyces_phage	38.1	1.1e-195
AZD06629.1|1344558_1345506_+	Acetyl-coenzyme A carboxyl transferase alpha chain	NA	NA	NA	NA	NA
AZD06630.1|1345620_1346949_+|tRNA	tRNA(Ile)-lysidine synthetase	tRNA	NA	NA	NA	NA
AZD06631.1|1346994_1347138_+	hypothetical protein	NA	NA	NA	NA	NA
AZD06632.1|1347223_1348855_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.5	6.9e-158
AZD06633.1|1348860_1349706_+	2-Keto-3-deoxy-D-manno-octulosonate-8-phosphate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.8	1.2e-49
AZD06634.1|1349863_1351153_+	Enolase	NA	A0A1X9I5Z8	Streptococcus_phage	59.2	9.0e-137
AZD06635.1|1351325_1351604_+	Cell division protein DivIC (FtsB), stabilizes FtsL against RasP cleavage	NA	NA	NA	NA	NA
AZD06636.1|1351600_1352308_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AZD06637.1|1352469_1353366_-	Transcriptional regulator, LysR family, in formaldehyde detoxification operon	NA	NA	NA	NA	NA
AZD06638.1|1353472_1354585_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	E3SJ82	Synechococcus_phage	26.9	5.4e-29
AZD06639.1|1354674_1355520_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AZD06640.1|1355572_1356046_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
AZD06641.1|1356042_1357101_+|tRNA	tRNA pseudouridine(13) synthase	tRNA	NA	NA	NA	NA
AZD06642.1|1357088_1357838_+	5'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.8	2.0e-67
AZD06643.1|1357837_1358515_+	Protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.0	6.8e-43
AZD06644.1|1358724_1359558_+	Murein hydrolase activator NlpD	NA	A0A0S2SXL7	Bacillus_phage	33.3	6.3e-06
AZD06645.1|1359664_1360669_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	35.8	5.0e-34
AZD06646.1|1361169_1361493_-	4Fe-4S dicluster domain	NA	NA	NA	NA	NA
AZD06647.1|1361635_1364215_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	23.5	3.1e-27
AZD06648.1|1364402_1365137_+	Transcriptional regulator	NA	B5TK58	Pseudomonas_phage	91.5	6.3e-127
AZD06649.1|1365668_1366016_+	Holin	NA	B5TK61	Pseudomonas_phage	88.6	2.7e-51
AZD06650.1|1366200_1366965_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	26.3	8.9e-07
AZD06651.1|1367993_1368518_+	hypothetical protein	NA	NA	NA	NA	NA
AZD06652.1|1368521_1369130_+|plate	Baseplate assembly protein V	plate	A0A2H4JBW8	uncultured_Caudovirales_phage	60.4	6.3e-48
AZD06653.1|1369144_1369477_+|plate	Baseplate assembly protein W	plate	A0A2H4JI46	uncultured_Caudovirales_phage	69.1	2.1e-37
AZD06654.1|1369473_1370469_+|plate	Phage-related baseplate assembly protein	plate	A0A2H4JC04	uncultured_Caudovirales_phage	62.6	6.2e-109
AZD06655.1|1370465_1371200_+	Tail protein I	NA	A0A2H4JDK0	uncultured_Caudovirales_phage	50.9	2.6e-40
AZD06656.1|1371196_1371727_+|tail	Phage tail fiber	tail	A2I2X8	Vibrio_virus	61.3	3.8e-49
AZD06657.1|1371879_1372497_+	hypothetical protein	NA	NA	NA	NA	NA
AZD06658.1|1372714_1372843_-	hypothetical protein	NA	NA	NA	NA	NA
AZD06659.1|1372841_1373063_+	hypothetical protein	NA	NA	NA	NA	NA
AZD06660.1|1373065_1374232_+|tail	Major tail sheath protein	tail	B0ZSG8	Halomonas_phage	57.7	1.0e-126
AZD06661.1|1374231_1374738_+	hypothetical protein	NA	Q6R4W3	Vibrio_virus	35.7	2.6e-23
AZD06662.1|1374865_1375477_+	hypothetical protein	NA	B0ZSH0	Halomonas_phage	35.5	5.8e-25
AZD06663.1|1375473_1375599_+	hypothetical protein	NA	NA	NA	NA	NA
AZD06664.1|1375605_1377795_+	Phage protein	NA	A0A2H4JAA5	uncultured_Caudovirales_phage	50.7	2.1e-08
AZD06665.1|1377794_1378178_+|tail	Unclassified tail protein	tail	A0A2H4JAC8	uncultured_Caudovirales_phage	60.6	1.0e-40
AZD06666.1|1378170_1378383_+|tail	P2-like prophage tail protein X	tail	A0A2H4JGD9	uncultured_Caudovirales_phage	61.4	6.9e-18
AZD06667.1|1378392_1379409_+|tail	Phage tail protein D	tail	A0A2H4JH05	uncultured_Caudovirales_phage	56.6	2.2e-106
AZD06668.1|1379550_1380135_+	hypothetical protein	NA	B5TK65	Pseudomonas_phage	71.5	2.6e-75
AZD06669.1|1380131_1380314_+	Mu-like prophage FluMu protein GP38	NA	B5TK66	Pseudomonas_phage	93.3	6.5e-25
AZD06670.1|1380313_1381810_+|tail	Bacteriophage tail sheath protein	tail	B5TK67	Pseudomonas_phage	90.6	6.6e-256
AZD06671.1|1381876_1382224_+|tail	Phage tail tube protein	tail	B5TK68	Pseudomonas_phage	93.9	2.9e-58
AZD06672.1|1382220_1382517_+|tail	Phage small tail protein E	tail	B5TK69	Pseudomonas_phage	94.9	2.3e-43
AZD06673.1|1382647_1384600_+|tail	Phage tail length tape-measure protein	tail	B5TK70	Pseudomonas_phage	50.6	2.0e-42
AZD06674.1|1384586_1385825_+|tail	Phage tail/DNA circulation protein	tail	B5TK71	Pseudomonas_phage	75.7	5.7e-181
AZD06675.1|1385828_1386869_+|tail	Prophage tail protein	tail	B5TK72	Pseudomonas_phage	82.9	1.7e-162
AZD06676.1|1386976_1387486_+|plate	Prophage baseplate assembly protein V	plate	B5TK73	Pseudomonas_phage	89.3	5.8e-79
AZD06677.1|1387485_1387884_+	Bacteriophage protein GP46	NA	B5TK74	Pseudomonas_phage	89.4	1.7e-65
AZD06678.1|1387873_1388914_+	Phage FluMu protein gp47	NA	B5TK75	Pseudomonas_phage	87.3	1.8e-167
AZD06679.1|1388901_1389501_+|tail	Prophage tail protein	tail	B5TK76	Pseudomonas_phage	91.5	5.0e-106
AZD06680.1|1389512_1390367_+|tail	Prophage tail fiber protein	tail	B5TK77	Pseudomonas_phage	76.4	8.9e-24
AZD06681.1|1390371_1391013_+|tail	putative tail fiber assembly-like protein	tail	B5TK78	Pseudomonas_phage	58.5	2.4e-37
AZD06682.1|1391377_1392745_+|tail	Prophage tail fiber protein	tail	A4PE45	Ralstonia_virus	57.1	2.7e-38
AZD06683.1|1392746_1393217_+	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	35.0	2.4e-07
AZD06684.1|1393238_1394321_+|tail	Prophage tail fiber protein	tail	B5TK79	Pseudomonas_phage	57.1	4.5e-113
AZD06685.1|1394328_1394931_+	Tail fiber assembly protein	NA	B5TK80	Pseudomonas_phage	48.6	3.4e-46
AZD06686.1|1394952_1395516_+	Lytic enzyme	NA	B5TK83	Pseudomonas_phage	84.4	2.6e-88
AZD06687.1|1395497_1396034_+	hypothetical protein	NA	B5TK84	Pseudomonas_phage	71.3	5.7e-61
AZD06688.1|1396116_1396617_+	Nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	86.7	4.7e-73
AZD06689.1|1396700_1397753_+	RecA protein	NA	A0A0S2MVG1	Bacillus_phage	60.9	4.4e-113
AZD06690.1|1397761_1398229_+	Regulatory protein RecX	NA	NA	NA	NA	NA
AZD06691.1|1398274_1399390_-	Decarboxylase family protein	NA	NA	NA	NA	NA
AZD06692.1|1399872_1400067_+	hypothetical protein	NA	NA	NA	NA	NA
AZD06693.1|1400068_1400491_-	Putative NADPH-quinone reductase (modulator of drug activity B)	NA	NA	NA	NA	NA
AZD06694.1|1400680_1401391_+	putative conserved protein YfiP, contains DTW domain	NA	NA	NA	NA	NA
AZD06695.1|1401725_1402376_+	Transcriptional regulator, LuxR family	NA	NA	NA	NA	NA
AZD06696.1|1402451_1402814_+	Diacylglycerol kinase	NA	NA	NA	NA	NA
AZD06697.1|1402810_1403737_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZD06698.1|1403872_1404652_+	Ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AZD06699.1|1404836_1405532_-	S-adenosylmethionine-dependent methyltransferase YaeB	NA	NA	NA	NA	NA
AZD06700.1|1405629_1406091_-	Uncharacterized protein YehS	NA	Q9EYF4	Enterobacteria_phage	50.7	1.9e-36
AZD06701.1|1406157_1406868_-	Ribosomal large subunit pseudouridine synthase F	NA	NA	NA	NA	NA
AZD06702.1|1406950_1407424_-	Acetyltransferase	NA	NA	NA	NA	NA
AZD06703.1|1407530_1408868_-	Ribosomal protein S12p Asp88 methylthiotransferase	NA	NA	NA	NA	NA
AZD06704.1|1408968_1409238_-	hypothetical protein	NA	NA	NA	NA	NA
AZD06705.1|1409259_1411101_+	Kup system potassium uptake protein	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	35.3	8.8e-77
AZD06706.1|1411302_1411578_-	hypothetical protein	NA	NA	NA	NA	NA
AZD06707.1|1412154_1413450_-	Alanylphosphatidylglycerol hydrolase, periplasmic	NA	NA	NA	NA	NA
AZD06708.1|1413449_1416098_-	Alanylphosphatidylglycerol synthase	NA	NA	NA	NA	NA
AZD06709.1|1417038_1418100_+	DNA polymerase IV	NA	NA	NA	NA	NA
AZD06710.1|1418198_1419035_-	Mobile element protein	NA	Q716C2	Shigella_phage	45.5	1.8e-61
AZD06711.1|1419031_1419337_-	Transposase InsN for insertion sequence element IS911	NA	Q716C1	Shigella_phage	44.7	3.0e-14
AZD06712.1|1419425_1420379_-	putative lipoprotein	NA	NA	NA	NA	NA
AZD06713.1|1420396_1422112_-|tRNA	Prolyl-tRNA synthetase, bacterial type	tRNA	NA	NA	NA	NA
>prophage 2
CP027713	Pseudomonas chlororaphis strain TAMOak81 chromosome, complete genome	6711360	2261908	2318843	6711360	terminase,integrase,tail	Pseudomonas_phage(65.15%)	91	2262670:2262719	2317205:2317254
AZD07499.1|2261908_2262211_+	Integration host factor alpha subunit	NA	A0A0H3UZA0	Geobacillus_virus	38.9	1.8e-11
AZD07500.1|2262191_2262548_+	Transcriptional regulator, MerR family	NA	NA	NA	NA	NA
2262670:2262719	attL	GCATGGGGTGCTAGGGGTCGAGTGTTCGAATCACTCCGTCCCGACCATAT	NA	NA	NA	NA
AZD07501.1|2262795_2263974_-|integrase	Prophage integrase	integrase	A0A059VF45	Pseudomonas_phage	69.8	6.5e-158
AZD07502.1|2264301_2264505_-	hypothetical protein	NA	NA	NA	NA	NA
AZD07503.1|2264785_2265136_-	hypothetical protein	NA	H2BD40	Pseudomonas_phage	71.2	8.6e-42
AZD07504.1|2265132_2265507_-	hypothetical protein	NA	A0A1B0VMD7	Pseudomonas_phage	39.7	9.0e-13
AZD07505.1|2265503_2265839_-	hypothetical protein	NA	NA	NA	NA	NA
AZD07506.1|2265888_2266278_-	hypothetical protein	NA	A0A0H5ARN8	Pseudomonas_phage	38.4	2.0e-07
AZD07507.1|2266326_2266506_-	hypothetical protein	NA	NA	NA	NA	NA
AZD07508.1|2266502_2267096_-	hypothetical protein	NA	A0A2H4J0N7	uncultured_Caudovirales_phage	66.7	2.4e-23
AZD07509.1|2267150_2267894_+	hypothetical protein	NA	NA	NA	NA	NA
AZD07510.1|2267988_2268222_+	hypothetical protein	NA	A0A1B0VP27	Pseudomonas_phage	80.5	6.0e-31
AZD07511.1|2268213_2268405_-	hypothetical protein	NA	A0A2H4JE08	uncultured_Caudovirales_phage	93.7	1.4e-25
AZD07512.1|2268401_2268608_-	hypothetical protein	NA	A0A2H4J1K8	uncultured_Caudovirales_phage	74.2	4.5e-22
AZD07513.1|2268888_2269896_-	Retron-type RNA-directed DNA polymerase	NA	A0A0N7AE80	Bacillus_phage	35.2	4.1e-44
AZD07514.1|2270266_2270623_-	hypothetical protein	NA	NA	NA	NA	NA
AZD07515.1|2270677_2271298_-	hypothetical protein	NA	A0A2I6PHV0	Pseudomonas_phage	31.3	6.3e-11
AZD07516.1|2271368_2271962_-	hypothetical protein	NA	A0A0A0YR68	Pseudomonas_phage	36.2	7.6e-22
AZD07517.1|2271991_2272282_+	hypothetical protein	NA	NA	NA	NA	NA
AZD07518.1|2272270_2272642_-	hypothetical protein	NA	NA	NA	NA	NA
AZD07519.1|2272711_2273305_-	hypothetical protein	NA	A0A1B0VMB1	Pseudomonas_phage	58.4	1.7e-58
AZD07520.1|2273301_2274069_-	Phage related protein	NA	A0A0M3LPU0	Mannheimia_phage	28.3	8.3e-13
AZD07521.1|2274065_2274875_-	Phage related protein	NA	A0A1B0VMB2	Pseudomonas_phage	85.5	1.8e-90
AZD07522.1|2274882_2275986_-	TolA protein	NA	B5WZW5	Pseudomonas_phage	69.2	3.7e-30
AZD07523.1|2276031_2276148_-	hypothetical protein	NA	NA	NA	NA	NA
AZD07524.1|2276144_2276516_-	hypothetical protein	NA	NA	NA	NA	NA
AZD07525.1|2276512_2276707_-	hypothetical protein	NA	Q9MC67	Pseudomonas_phage	44.4	9.4e-06
AZD07526.1|2276703_2276895_-	hypothetical protein	NA	A0A1B0VMB8	Pseudomonas_phage	50.8	2.8e-10
AZD07527.1|2276891_2277329_-	hypothetical protein	NA	A0A1B0VMC3	Pseudomonas_phage	36.7	1.3e-10
AZD07528.1|2277348_2277498_-	hypothetical protein	NA	NA	NA	NA	NA
AZD07529.1|2277519_2277903_-	hypothetical protein	NA	NA	NA	NA	NA
AZD07530.1|2278403_2278664_-	hypothetical protein	NA	NA	NA	NA	NA
AZD07531.1|2278730_2279021_-	hypothetical protein	NA	NA	NA	NA	NA
AZD07532.1|2279393_2279711_+	Phage protein	NA	A0A2D1GND3	Pseudomonas_phage	54.3	1.6e-23
AZD07533.1|2279801_2280620_-	ATPase	NA	NA	NA	NA	NA
AZD07534.1|2281343_2282201_-	Transcriptional regulator, Cro/CI family	NA	A0A0S2SYF7	Pseudomonas_phage	54.3	8.8e-80
AZD07535.1|2282289_2282466_+	Transcriptional regulator, Cro/CI family	NA	A0A0S2SYB8	Pseudomonas_phage	62.7	2.1e-12
AZD07536.1|2282522_2282723_+	hypothetical protein	NA	A0A2H4J528	uncultured_Caudovirales_phage	100.0	3.3e-30
AZD07537.1|2282742_2282949_+	hypothetical protein	NA	A0A2H4J8V2	uncultured_Caudovirales_phage	88.2	7.4e-25
AZD07538.1|2283039_2283852_+	phage antirepressor	NA	A0A2H4J5H6	uncultured_Caudovirales_phage	47.8	1.5e-60
AZD07539.1|2283848_2284151_+	hypothetical protein	NA	A0A0S2SY28	Pseudomonas_phage	70.8	1.6e-36
AZD07540.1|2284147_2284948_+	Phage protein	NA	A0A2H4J580	uncultured_Caudovirales_phage	75.9	1.1e-108
AZD07541.1|2284944_2285742_+	Replication protein P	NA	A0A2D1GNB3	Pseudomonas_phage	72.7	2.6e-102
AZD07542.1|2285744_2285837_+	hypothetical protein	NA	NA	NA	NA	NA
AZD07543.1|2285833_2286331_+	hypothetical protein	NA	Q9MC82	Pseudomonas_phage	33.6	1.9e-05
AZD07544.1|2286327_2286798_+	hypothetical protein	NA	A0A2H4J106	uncultured_Caudovirales_phage	62.8	1.3e-53
AZD07545.1|2286794_2287424_+	Phage NinG rap recombination	NA	A0A2H4JA27	uncultured_Caudovirales_phage	70.8	3.1e-74
AZD07546.1|2287408_2288251_+	hypothetical protein	NA	A0A2H4JH74	uncultured_Caudovirales_phage	70.8	4.3e-79
AZD07547.1|2288247_2288943_+	Phage protein	NA	A0A1B0YZZ3	Pseudomonas_phage	56.7	6.7e-62
AZD07548.1|2289350_2289674_+	hypothetical protein	NA	A0A1B0VME9	Pseudomonas_phage	83.2	1.7e-39
AZD07549.1|2289675_2289948_+	hypothetical protein	NA	A0A1B0VME7	Pseudomonas_phage	75.3	7.4e-33
AZD07550.1|2289952_2290249_+	hypothetical protein	NA	V5K3F8	Pseudomonas_phage	34.0	6.7e-11
AZD07551.1|2290272_2290524_+	hypothetical protein	NA	NA	NA	NA	NA
AZD07552.1|2290584_2290815_+	NAD/FAD-utilizing enzyme	NA	A0A1S6UB66	Serratia_phage	62.0	3.7e-17
AZD07553.1|2290814_2291003_+	hypothetical protein	NA	NA	NA	NA	NA
AZD07554.1|2291003_2291192_+	hypothetical protein	NA	NA	NA	NA	NA
AZD07555.1|2291188_2291443_+	hypothetical protein	NA	NA	NA	NA	NA
AZD07556.1|2291677_2292289_+	hypothetical protein	NA	A0A1B0VRJ1	Pseudomonas_phage	83.5	2.5e-97
AZD07557.1|2292321_2292798_+	Phage protein	NA	A0A1B0VMH2	Pseudomonas_phage	84.2	7.8e-70
AZD07558.1|2292772_2294092_+|terminase	Phage terminase	terminase	A0A0S2SYF1	Pseudomonas_phage	92.3	3.5e-245
AZD07559.1|2294094_2295474_+	structural protein	NA	A0A0H5AWC7	Pseudomonas_phage	67.0	1.1e-177
AZD07560.1|2295473_2296547_+	NAD+--asparagine ADP-ribosyltransferase	NA	A0A0H5BBX3	Pseudomonas_phage	54.3	1.3e-101
AZD07561.1|2296697_2297441_+	hypothetical protein	NA	A0A0H5AWD1	Pseudomonas_phage	81.6	6.2e-90
AZD07562.1|2297461_2298415_+	putative phage protein	NA	A0A0M3LQL5	Mannheimia_phage	66.1	3.3e-112
AZD07563.1|2298457_2298943_+	hypothetical protein	NA	NA	NA	NA	NA
AZD07564.1|2298942_2299314_+	hypothetical protein	NA	A0A0S2SYB7	Pseudomonas_phage	60.3	3.6e-30
AZD07565.1|2299315_2299702_+	hypothetical protein	NA	A0A059VA70	Pseudomonas_phage	47.6	7.3e-26
AZD07566.1|2299701_2300082_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	54.9	1.6e-33
AZD07567.1|2300078_2300474_+	hypothetical protein	NA	A0A059VK45	Pseudomonas_phage	79.4	8.2e-57
AZD07568.1|2300583_2300772_+	hypothetical protein	NA	NA	NA	NA	NA
AZD07569.1|2300867_2302031_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	88.1	1.8e-152
AZD07570.1|2302112_2302598_+	hypothetical protein	NA	A0A059VF34	Pseudomonas_phage	50.0	3.6e-38
AZD07571.1|2302600_2302840_+	hypothetical protein	NA	A0A059VJS3	Pseudomonas_phage	63.3	1.1e-24
AZD07572.1|2302884_2303292_-	hypothetical protein	NA	A0A0P0IVR2	Acinetobacter_phage	73.0	7.5e-05
AZD07573.1|2303468_2304515_+	putative antirepressor protein	NA	G9L6D8	Escherichia_phage	42.3	3.3e-36
AZD07574.1|2304603_2304942_+	immunity protein, putative	NA	A0A0S2SY85	Pseudomonas_phage	46.0	4.2e-09
AZD07575.1|2305378_2305504_-	hypothetical protein	NA	NA	NA	NA	NA
AZD07576.1|2305882_2307805_+|tail	Phage tail length tape-measure protein 1	tail	A0A2H4J7J3	uncultured_Caudovirales_phage	41.7	1.2e-113
AZD07577.1|2307822_2308407_+	hypothetical protein	NA	A0A059VJR9	Pseudomonas_phage	82.5	2.3e-87
AZD07578.1|2308406_2309009_+	hypothetical protein	NA	A0A059VA31	Pseudomonas_phage	91.0	1.0e-103
AZD07579.1|2309011_2309410_+	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	84.8	2.6e-66
AZD07580.1|2309406_2312340_+|tail	Phage tail fiber protein	tail	A0A059VFW9	Pseudomonas_phage	70.4	0.0e+00
AZD07581.1|2312336_2312660_+	hypothetical protein	NA	NA	NA	NA	NA
AZD07582.1|2312659_2313340_+	hypothetical protein	NA	A0A2D1GNS6	Pseudomonas_phage	39.7	2.2e-41
AZD07583.1|2313401_2314571_+	hypothetical protein	NA	A0A2H4J1J6	uncultured_Caudovirales_phage	53.7	8.9e-75
AZD07584.1|2314613_2315147_+	Phage endolysin	NA	A0A059VA40	Pseudomonas_phage	72.7	4.2e-64
AZD07585.1|2315143_2315665_+	hypothetical protein	NA	A0A2H4IZW4	uncultured_Caudovirales_phage	63.5	7.8e-47
AZD07586.1|2315654_2316338_-	Gifsy-2 prophage protein	NA	A0A2H4J991	uncultured_Caudovirales_phage	72.4	2.8e-97
AZD07587.1|2316421_2316631_+	hypothetical protein	NA	A0A2H4J2T0	uncultured_Caudovirales_phage	56.5	2.6e-17
AZD07588.1|2316633_2316963_-	hypothetical protein	NA	NA	NA	NA	NA
AZD07589.1|2318729_2318843_-	Gifsy-2 prophage protein	NA	A0A2H4J991	uncultured_Caudovirales_phage	68.6	2.2e-07
2317205:2317254	attR	GCATGGGGTGCTAGGGGTCGAGTGTTCGAATCACTCCGTCCCGACCATAT	NA	NA	NA	NA
>prophage 3
CP027713	Pseudomonas chlororaphis strain TAMOak81 chromosome, complete genome	6711360	4166014	4172247	6711360	tRNA	uncultured_Caudovirales_phage(83.33%)	8	NA	NA
AZD09187.1|4166014_4166407_+|tRNA	tRNA 5-methylaminomethyl-2-thiouridine synthase subunit TusD	tRNA	A0A2H4JA39	uncultured_Caudovirales_phage	84.6	5.1e-59
AZD09188.1|4166410_4166773_+|tRNA	tRNA 5-methylaminomethyl-2-thiouridine synthase subunit TusC	tRNA	A0A2H4J8C0	uncultured_Caudovirales_phage	73.3	9.6e-44
AZD09189.1|4166772_4167072_+|tRNA	tRNA 5-methylaminomethyl-2-thiouridine synthase subunit TusB	tRNA	A0A2H4JG28	uncultured_Caudovirales_phage	72.7	1.5e-34
AZD09190.1|4167068_4167404_+|tRNA	tRNA 2-thiouridine synthesis protein TusE	tRNA	A0A2H4J8B6	uncultured_Caudovirales_phage	82.9	1.5e-46
AZD09191.1|4167400_4168402_+	Anthranilate phosphoribosyltransferase like	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	84.5	3.6e-165
AZD09192.1|4168491_4169493_+	Glutathione S-transferase, omega	NA	NA	NA	NA	NA
AZD09193.1|4169571_4170966_-	Precorrin-2 oxidase	NA	NA	NA	NA	NA
AZD09194.1|4170966_4172247_-|tRNA	Seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	54.8	2.1e-101
>prophage 4
CP027713	Pseudomonas chlororaphis strain TAMOak81 chromosome, complete genome	6711360	4792778	4799928	6711360		Enterobacteria_phage(66.67%)	8	NA	NA
AZD09722.1|4792778_4793900_-	dTDP-3-amino-3,6-dideoxy-alpha-D- galactopyranose transaminase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	27.8	3.0e-35
AZD09723.1|4793954_4794950_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.3	4.7e-40
AZD09724.1|4795064_4796126_-	hypothetical protein	NA	NA	NA	NA	NA
AZD09725.1|4796276_4797167_-	Glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	67.9	1.4e-109
AZD09726.1|4797163_4798057_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	32.7	1.0e-25
AZD09727.1|4798053_4799160_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	1.0e-96
AZD09728.1|4799374_4799614_-	hypothetical protein	NA	NA	NA	NA	NA
AZD09729.1|4799637_4799928_-	Integration host factor beta subunit	NA	A3E2K9	Sodalis_phage	41.1	1.5e-10
