The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027735	Pseudomonas chlororaphis subsp. piscium strain DTR133 chromosome, complete genome	7064618	1311112	1416589	7064618	tail,tRNA,plate,capsid,portal,terminase,holin,protease	Pseudomonas_phage(42.11%)	125	NA	NA
AZC55373.1|1311112_1312465_+|protease	Intramembrane protease RasP/YluC, implicated in cell division based on FtsL cleavage	protease	NA	NA	NA	NA
AZC55374.1|1312539_1314927_+	Outer membrane protein assembly factor YaeT	NA	NA	NA	NA	NA
AZC55375.1|1314972_1315476_+	Outer membrane chaperone Skp, precursor	NA	NA	NA	NA	NA
AZC55376.1|1315479_1316535_+	UDP-3-O-[3-hydroxymyristoyl] glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AZC55377.1|1316644_1317085_+	3-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
AZC55378.1|1317081_1317858_+	Acyl-ADP--UDP-N- acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AZC55379.1|1317860_1318991_+	Lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AZC55380.1|1318987_1319635_+	Ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.5	4.5e-28
AZC55381.1|1319704_1323229_+	DNA polymerase III alpha subunit	NA	A0A0K1Y906	Streptomyces_phage	37.4	2.4e-195
AZC55382.1|1323369_1324317_+	Acetyl-coenzyme A carboxyl transferase alpha chain	NA	NA	NA	NA	NA
AZC55383.1|1324436_1325765_+|tRNA	tRNA(Ile)-lysidine synthetase	tRNA	NA	NA	NA	NA
AZC55384.1|1325810_1325954_+	hypothetical protein	NA	NA	NA	NA	NA
AZC55385.1|1326039_1327671_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.5	6.9e-158
AZC55386.1|1327676_1328522_+	2-Keto-3-deoxy-D-manno-octulosonate-8-phosphate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.8	2.7e-49
AZC55387.1|1328679_1329969_+	Enolase	NA	A0A1X9I5Z8	Streptococcus_phage	59.2	9.0e-137
AZC55388.1|1330141_1330420_+	Cell division protein DivIC (FtsB), stabilizes FtsL against RasP cleavage	NA	NA	NA	NA	NA
AZC55389.1|1330416_1331124_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AZC55390.1|1331285_1332182_-	Transcriptional regulator, LysR family, in formaldehyde detoxification operon	NA	NA	NA	NA	NA
AZC55391.1|1332288_1333401_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.2	1.1e-29
AZC55392.1|1333409_1334255_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AZC55393.1|1334307_1334781_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
AZC55394.1|1334777_1335836_+|tRNA	tRNA pseudouridine(13) synthase	tRNA	NA	NA	NA	NA
AZC55395.1|1335823_1336573_+	5'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.6	1.0e-68
AZC55396.1|1336572_1337250_+	Protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.0	8.9e-43
AZC55397.1|1337540_1338293_+	Murein hydrolase activator NlpD	NA	A0A0S2SXL7	Bacillus_phage	33.3	5.7e-06
AZC55398.1|1338399_1339404_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	35.8	5.0e-34
AZC55399.1|1339905_1340229_-	4Fe-4S dicluster domain	NA	NA	NA	NA	NA
AZC55400.1|1340371_1342951_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.0	1.8e-27
AZC55401.1|1342997_1344242_-	Integrase	NA	A0A1I9KF78	Aeromonas_phage	39.9	3.3e-67
AZC55402.1|1344402_1345257_-	SAM-dependent methyltransferase	NA	Q5QF26	Pseudomonas_virus	50.5	3.0e-72
AZC55403.1|1345253_1345586_-	hypothetical protein	NA	NA	NA	NA	NA
AZC55404.1|1345582_1345981_-	hypothetical protein	NA	A0A125RNP6	Pseudomonas_phage	37.0	1.5e-13
AZC55405.1|1345977_1346232_-	hypothetical protein	NA	A0A2H4PHJ9	Dickeya_phage	50.6	3.7e-10
AZC55406.1|1346293_1346848_-	hypothetical protein	NA	W6MW33	Pseudomonas_phage	58.9	1.6e-10
AZC55407.1|1346844_1347390_-	putative hydrolase, HD superfamily	NA	K7PKJ9	Enterobacteria_phage	42.2	6.9e-30
AZC55408.1|1347386_1348022_-	hypothetical protein	NA	NA	NA	NA	NA
AZC55409.1|1348101_1348911_-	Uncharacterized protein YfdQ	NA	A0A2R2Z323	Escherichia_phage	42.9	3.1e-50
AZC55410.1|1348961_1349303_-	hypothetical protein	NA	A0A2D1GMS3	Marinobacter_phage	36.7	4.8e-13
AZC55411.1|1349354_1349594_-	transcriptional regulator PrtN, putative	NA	A0A2H4J8B4	uncultured_Caudovirales_phage	59.5	1.8e-19
AZC55412.1|1349590_1349974_-	hypothetical protein	NA	A0A2H4J897	uncultured_Caudovirales_phage	61.2	5.6e-34
AZC55413.1|1349970_1350246_-	hypothetical protein	NA	A0A2H4JBX5	uncultured_Caudovirales_phage	59.3	2.1e-22
AZC55414.1|1350256_1350832_-	putative deoxynucleotide monophosphate kinase	NA	A0A2H4J8A1	uncultured_Caudovirales_phage	65.9	2.0e-67
AZC55415.1|1350828_1351023_-	hypothetical protein	NA	A0A2H4JG20	uncultured_Caudovirales_phage	60.9	7.4e-11
AZC55416.1|1351172_1351838_-	HTH-type transcriptional regulator prtR	NA	A0A2H4J8I0	uncultured_Caudovirales_phage	39.6	4.5e-31
AZC55417.1|1352544_1353033_+	hypothetical protein	NA	A0A2H4JFM0	uncultured_Caudovirales_phage	75.4	1.3e-48
AZC55418.1|1353025_1353232_+	hypothetical protein	NA	A0A2H4JDJ0	uncultured_Caudovirales_phage	76.5	2.4e-23
AZC55419.1|1353228_1355949_+	Bifunctional DNA primase/polymerase	NA	A0A2H4JF22	uncultured_Caudovirales_phage	64.2	0.0e+00
AZC55420.1|1356274_1356742_+	hypothetical protein	NA	A0A2H4J8A5	uncultured_Caudovirales_phage	56.5	4.9e-40
AZC55421.1|1357071_1357290_+	Holin	NA	B5TK61	Pseudomonas_phage	80.8	3.9e-24
AZC55422.1|1357270_1357639_+|holin	Phage holin	holin	A0A2I6PIG1	Escherichia_phage	51.4	1.6e-25
AZC55423.1|1357797_1358331_+|terminase	putative phage terminase, small subunit	terminase	A0A0S2GLF2	Bacillus_phage	28.7	1.5e-08
AZC55424.1|1358293_1360120_+|terminase	Phage terminase, large subunit	terminase	A0A0U2C138	Paracoccus_phage	39.4	6.2e-115
AZC55425.1|1360116_1360296_+	hypothetical protein	NA	Q8W6U8	Burkholderia_virus	63.0	2.5e-05
AZC55426.1|1360298_1361576_+|portal	Phage portal protein	portal	Q8W6U7	Burkholderia_virus	58.9	2.9e-143
AZC55427.1|1361572_1362517_+|capsid	phage minor capsid protein C, putative	capsid	A4JX00	Burkholderia_virus	57.2	8.8e-97
AZC55428.1|1362580_1363906_+|capsid	Phage major capsid protein	capsid	Q8W6U5	Burkholderia_virus	51.4	1.4e-111
AZC55429.1|1363950_1364241_+	hypothetical protein	NA	NA	NA	NA	NA
AZC55430.1|1364243_1364795_+	Phage protein	NA	Q8W6U3	Burkholderia_virus	38.9	5.2e-25
AZC55431.1|1364797_1365160_+	hypothetical protein	NA	Q8HAC9	Salmonella_phage	48.6	1.9e-23
AZC55432.1|1365152_1365674_+	hypothetical protein	NA	NA	NA	NA	NA
AZC55433.1|1365734_1366289_+	hypothetical protein	NA	NA	NA	NA	NA
AZC55434.1|1366352_1366943_+	hypothetical protein	NA	B5TK65	Pseudomonas_phage	53.1	3.1e-52
AZC55435.1|1366939_1367146_+	Mu-like prophage FluMu protein GP38	NA	B5TK66	Pseudomonas_phage	70.6	7.9e-19
AZC55436.1|1367145_1368642_+|tail	Bacteriophage tail sheath protein	tail	B5TK67	Pseudomonas_phage	81.7	7.8e-233
AZC55437.1|1368702_1369050_+|tail	Phage tail tube protein	tail	B5TK68	Pseudomonas_phage	66.1	2.8e-40
AZC55438.1|1369046_1369343_+|tail	Phage small tail protein E	tail	B5TK69	Pseudomonas_phage	90.8	1.6e-41
AZC55439.1|1369473_1371537_+|tail	Phage tail length tape-measure protein	tail	U5P420	Shigella_phage	58.0	2.2e-108
AZC55440.1|1371533_1372838_+|tail	Phage tail/DNA circulation protein	tail	B5TK71	Pseudomonas_phage	43.1	2.1e-96
AZC55441.1|1372840_1373956_+|tail	Prophage tail protein	tail	B5TK72	Pseudomonas_phage	63.9	8.7e-120
AZC55442.1|1373952_1374459_+|plate	Prophage baseplate assembly protein V	plate	B5TK73	Pseudomonas_phage	75.8	1.2e-65
AZC55443.1|1374458_1374860_+	Bacteriophage protein GP46	NA	B5TK74	Pseudomonas_phage	65.9	7.3e-45
AZC55444.1|1374849_1375887_+	Phage FluMu protein gp47	NA	B5TK75	Pseudomonas_phage	71.6	3.3e-137
AZC55445.1|1375877_1376477_+|tail	Prophage tail protein	tail	B5TK76	Pseudomonas_phage	70.4	4.3e-81
AZC55446.1|1376488_1377745_+|tail	Prophage tail fiber protein	tail	B5TK79	Pseudomonas_phage	62.7	2.4e-17
AZC55447.1|1377836_1378196_+	hypothetical protein	NA	A0A291LAV4	Bordetella_phage	45.1	4.0e-18
AZC55448.1|1378211_1378763_+	Lytic enzyme	NA	B5TK83	Pseudomonas_phage	80.2	3.0e-81
AZC55449.1|1378759_1379281_+	hypothetical protein	NA	B5TK84	Pseudomonas_phage	68.9	1.7e-49
AZC55450.1|1379321_1379816_-	putative bacteriophage protein	NA	NA	NA	NA	NA
AZC55451.1|1379819_1379990_-	putative bacteriophage protein	NA	NA	NA	NA	NA
AZC55452.1|1380702_1381428_+	Transcriptional regulator	NA	B5TK58	Pseudomonas_phage	91.4	1.3e-124
AZC55453.1|1382169_1382751_+	hypothetical protein	NA	NA	NA	NA	NA
AZC55454.1|1382853_1383201_+	Holin	NA	B5TK61	Pseudomonas_phage	87.7	7.7e-51
AZC55455.1|1383367_1384132_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	26.3	2.6e-06
AZC55456.1|1384614_1384863_+	hypothetical protein	NA	NA	NA	NA	NA
AZC55457.1|1384971_1385613_+	hypothetical protein	NA	B5TK60	Pseudomonas_phage	55.1	5.2e-61
AZC55458.1|1385854_1386379_+	hypothetical protein	NA	NA	NA	NA	NA
AZC55459.1|1386382_1386991_+|plate	Baseplate assembly protein V	plate	A0A2H4JBW8	uncultured_Caudovirales_phage	61.0	7.5e-49
AZC55460.1|1387004_1387337_+|plate	Baseplate assembly protein W	plate	A0A2H4JI46	uncultured_Caudovirales_phage	69.1	3.6e-37
AZC55461.1|1387333_1388329_+|plate	Phage-related baseplate assembly protein	plate	A0A2H4JC04	uncultured_Caudovirales_phage	63.8	4.3e-110
AZC55462.1|1388325_1389060_+|tail	Phage tail fiber	tail	A0A2H4JDK0	uncultured_Caudovirales_phage	53.5	5.3e-41
AZC55463.1|1389056_1389587_+|tail	Phage tail fiber	tail	B0ZSG1	Halomonas_phage	57.5	2.2e-49
AZC55464.1|1389713_1390496_+	hypothetical protein	NA	NA	NA	NA	NA
AZC55465.1|1390498_1390801_+	Phage protein	NA	Q8H9M8	Vibrio_phage	64.6	1.8e-11
AZC55466.1|1390888_1391110_+	hypothetical protein	NA	NA	NA	NA	NA
AZC55467.1|1391112_1392279_+|tail	Major tail sheath protein	tail	B0ZSG8	Halomonas_phage	57.2	2.5e-125
AZC55468.1|1392278_1392785_+	hypothetical protein	NA	Q6R4W3	Vibrio_virus	35.7	2.6e-23
AZC55469.1|1392911_1393523_+	hypothetical protein	NA	B0ZSH0	Halomonas_phage	36.4	1.5e-25
AZC55470.1|1393519_1393645_+	hypothetical protein	NA	NA	NA	NA	NA
AZC55471.1|1393651_1395859_+	Phage protein	NA	A0A2H4JAA5	uncultured_Caudovirales_phage	49.3	7.2e-09
AZC55472.1|1395858_1396242_+|tail	Unclassified tail protein	tail	A0A2H4JAC8	uncultured_Caudovirales_phage	59.8	4.0e-40
AZC55473.1|1396234_1396447_+|tail	P2-like prophage tail protein X	tail	A0A2H4JGD9	uncultured_Caudovirales_phage	61.4	6.9e-18
AZC55474.1|1396456_1397473_+|tail	Phage tail protein D	tail	A0A2H4JH05	uncultured_Caudovirales_phage	56.9	7.7e-107
AZC55475.1|1397615_1398200_+	hypothetical protein	NA	B5TK65	Pseudomonas_phage	72.0	6.9e-76
AZC55476.1|1398196_1398379_+	Mu-like prophage FluMu protein GP38	NA	B5TK66	Pseudomonas_phage	91.7	2.5e-24
AZC55477.1|1398378_1399875_+|tail	Bacteriophage tail sheath protein	tail	B5TK67	Pseudomonas_phage	90.6	4.6e-257
AZC55478.1|1399941_1400289_+|tail	Phage tail tube protein	tail	B5TK68	Pseudomonas_phage	93.9	2.9e-58
AZC55479.1|1400285_1400582_+|tail	Phage small tail protein E	tail	B5TK69	Pseudomonas_phage	94.9	2.3e-43
AZC55480.1|1400712_1402911_+|tail	Phage tail length tape-measure protein	tail	B5TK70	Pseudomonas_phage	44.9	2.5e-33
AZC55481.1|1402897_1404136_+|tail	Phage tail/DNA circulation protein	tail	B5TK71	Pseudomonas_phage	75.2	1.3e-180
AZC55482.1|1404139_1405180_+|tail	Prophage tail protein	tail	B5TK72	Pseudomonas_phage	82.9	1.3e-162
AZC55483.1|1405244_1405754_+|plate	Prophage baseplate assembly protein V	plate	B5TK73	Pseudomonas_phage	89.3	5.8e-79
AZC55484.1|1405753_1406152_+	Bacteriophage protein GP46	NA	B5TK74	Pseudomonas_phage	90.2	7.5e-66
AZC55485.1|1406141_1407182_+	Phage FluMu protein gp47	NA	B5TK75	Pseudomonas_phage	87.3	5.2e-167
AZC55486.1|1407169_1407769_+|tail	Prophage tail protein	tail	B5TK76	Pseudomonas_phage	91.5	4.2e-105
AZC55487.1|1407780_1408932_+|tail	Prophage tail fiber protein	tail	B5TK77	Pseudomonas_phage	71.2	2.3e-155
AZC55488.1|1408928_1409435_+|tail	putative tail fiber assembly-like protein	tail	B5TK78	Pseudomonas_phage	62.6	2.4e-45
AZC55489.1|1409810_1411364_+|tail	Prophage tail fiber protein	tail	A4PE45	Ralstonia_virus	53.0	3.4e-37
AZC55490.1|1411365_1411836_+	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	34.2	4.2e-07
AZC55491.1|1411875_1412016_+	Lytic enzyme	NA	B5TK83	Pseudomonas_phage	67.4	1.9e-08
AZC55492.1|1412093_1413158_+|tail	Prophage tail fiber protein	tail	B5TK79	Pseudomonas_phage	58.3	1.0e-114
AZC55493.1|1413164_1413767_+|tail	Putative tail fiber assembly protein p37	tail	B5TK80	Pseudomonas_phage	45.3	4.6e-43
AZC55494.1|1413788_1414352_+	Lytic enzyme	NA	B5TK83	Pseudomonas_phage	83.3	9.9e-88
AZC55495.1|1414333_1414870_+	hypothetical protein	NA	B5TK84	Pseudomonas_phage	71.9	4.0e-62
AZC55496.1|1414952_1415453_+	Nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	86.7	4.7e-73
AZC55497.1|1415536_1416589_+	RecA protein	NA	A0A0S2MVG1	Bacillus_phage	63.0	4.4e-113
>prophage 2
CP027735	Pseudomonas chlororaphis subsp. piscium strain DTR133 chromosome, complete genome	7064618	2185601	2298435	7064618	tail,tRNA,plate,portal,integrase,terminase,protease	uncultured_Caudovirales_phage(54.55%)	111	2216989:2217007	2258006:2258024
AZC56218.1|2185601_2186210_-|protease	SOS-response repressor and protease LexA	protease	A0A2H4JG58	uncultured_Caudovirales_phage	55.4	1.1e-12
AZC56219.1|2186462_2187170_+	putative transcriptional regulator for fatty acid degradation FadQ, TetR family	NA	NA	NA	NA	NA
AZC56220.1|2187362_2188373_+	beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
AZC56221.1|2188384_2189128_+	S-methyl-5'-thioinosine phosphorylase	NA	NA	NA	NA	NA
AZC56222.1|2189233_2191927_-	DNA/RNA helicase, SNF2 family	NA	V9XTV7	Choristoneura_murinana_nucleopolyhedrovirus	29.7	2.3e-49
AZC56223.1|2191938_2192502_-	hypothetical protein	NA	NA	NA	NA	NA
AZC56224.1|2192512_2195962_-	Transcription-repair coupling factor	NA	NA	NA	NA	NA
AZC56225.1|2196312_2197776_+	NADPH-dependent glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AZC56226.1|2197921_2199220_-	putative MFS-type transporter	NA	Q6JIH2	Burkholderia_virus	37.9	1.4e-68
AZC56227.1|2199593_2200571_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
AZC56228.1|2200772_2202167_+	Soluble pyridine nucleotide transhydrogenase	NA	NA	NA	NA	NA
AZC56229.1|2202209_2202932_-	Glycerophosphoryl diester phosphodiesterase	NA	A0A292GJA3	Xanthomonas_phage	40.4	7.8e-05
AZC56230.1|2202993_2203581_-	hypothetical protein	NA	NA	NA	NA	NA
AZC56231.1|2203675_2204926_+	Lipoprotein releasing system transmembrane protein LolC	NA	NA	NA	NA	NA
AZC56232.1|2204918_2205617_+	Lipoprotein-releasing system ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	41.1	1.3e-36
AZC56233.1|2205681_2206926_+	Lipoprotein releasing system transmembrane protein LolE	NA	NA	NA	NA	NA
AZC56234.1|2206989_2208351_-	Copper sensory histidine kinase CusS	NA	B5LWN8	Feldmannia_species_virus	22.9	7.9e-06
AZC56235.1|2208350_2209031_-	Copper-sensing two-component system response regulator CusR	NA	NA	NA	NA	NA
AZC56236.1|2209186_2209741_+	Copper tolerance protein	NA	NA	NA	NA	NA
AZC56237.1|2209809_2210640_+	NADPH-dependent 7-cyano-7-deazaguanine reductase	NA	A0A2I7SAX1	Vibrio_phage	37.4	1.6e-38
AZC56238.1|2210686_2210950_-	Chromosome segregation ATPase	NA	NA	NA	NA	NA
AZC56239.1|2211063_2211684_-	Phosphonoacetaldehyde phosphonohydrolase-related protein	NA	NA	NA	NA	NA
AZC56240.1|2211886_2212570_+	Outer-membrane-phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AZC56241.1|2212629_2212929_-	hypothetical protein	NA	NA	NA	NA	NA
AZC56242.1|2213207_2214389_+	Serine phosphatase RsbU, regulator of sigma subunit	NA	NA	NA	NA	NA
AZC56243.1|2214388_2214871_+	Serine-protein kinase RsbW	NA	NA	NA	NA	NA
AZC56244.1|2214946_2215873_-	Transaldolase	NA	A0A127KNC6	Cyanophage	33.5	1.6e-13
AZC56245.1|2216062_2217001_-|tRNA	tRNA-dihydrouridine(20/20a) synthase	tRNA	NA	NA	NA	NA
2216989:2217007	attL	TCCAATCCATCATGGGCGC	NA	NA	NA	NA
AZC56246.1|2217176_2218334_+|integrase	integrase family protein	integrase	L7TP61	Pseudomonas_virus	67.0	1.1e-141
AZC56247.1|2218308_2218584_-	hypothetical protein	NA	I6NSR8	Burkholderia_phage	67.1	1.2e-25
AZC56248.1|2218580_2218805_-	hypothetical protein	NA	NA	NA	NA	NA
AZC56249.1|2218801_2220151_-	hypothetical protein	NA	W6MW33	Pseudomonas_phage	66.1	5.0e-13
AZC56250.1|2220147_2220237_-	hypothetical protein	NA	NA	NA	NA	NA
AZC56251.1|2220233_2220455_-	hypothetical protein	NA	NA	NA	NA	NA
AZC56252.1|2220451_2220856_-	hypothetical protein	NA	NA	NA	NA	NA
AZC56253.1|2220905_2221223_-	transcriptional regulator, putative	NA	NA	NA	NA	NA
AZC56254.1|2221381_2221666_-	DNA-binding protein Roi-related protein	NA	NA	NA	NA	NA
AZC56255.1|2221676_2222267_-	hypothetical protein	NA	NA	NA	NA	NA
AZC56256.1|2222263_2222440_-	hypothetical protein	NA	NA	NA	NA	NA
AZC56257.1|2222608_2224120_+	hypothetical protein	NA	NA	NA	NA	NA
AZC56258.1|2224168_2224900_-	repressor protein c2	NA	A5VW98	Enterobacteria_phage	39.7	8.4e-31
AZC56259.1|2225571_2226090_+	hypothetical protein	NA	NA	NA	NA	NA
AZC56260.1|2226299_2228516_+	DNA primase, phage associated	NA	A0A2D1GN57	Marinobacter_phage	47.0	7.1e-190
AZC56261.1|2228529_2228871_+	hypothetical protein	NA	NA	NA	NA	NA
AZC56262.1|2229389_2229737_+	Holin	NA	A0A2H4J893	uncultured_Caudovirales_phage	81.5	7.0e-44
AZC56263.1|2229900_2230500_+	hypothetical protein	NA	A0A2H4JG15	uncultured_Caudovirales_phage	67.9	5.8e-62
AZC56264.1|2230504_2232526_+|terminase	terminase, large subunit, putative	terminase	A0A2H4J898	uncultured_Caudovirales_phage	82.2	0.0e+00
AZC56265.1|2232527_2232734_+	hypothetical protein	NA	A0A2H4JA19	uncultured_Caudovirales_phage	72.1	2.2e-21
AZC56266.1|2232733_2234215_+|portal	phage portal protein, lambda family	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	84.2	8.3e-243
AZC56267.1|2234211_2235357_+|protease	Prophage Clp protease-like protein	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	70.0	8.6e-139
AZC56268.1|2235353_2235698_+	hypothetical protein	NA	A0A2H4JF15	uncultured_Caudovirales_phage	87.7	3.6e-48
AZC56269.1|2235861_2236857_+	Phage protein	NA	A0A2H4J890	uncultured_Caudovirales_phage	83.7	3.1e-161
AZC56270.1|2236859_2237180_+	hypothetical protein	NA	A0A2H4J879	uncultured_Caudovirales_phage	68.6	3.1e-38
AZC56271.1|2237176_2237842_+	hypothetical protein	NA	A0A2H4JBV1	uncultured_Caudovirales_phage	69.1	1.5e-82
AZC56272.1|2237828_2238365_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	55.7	5.2e-54
AZC56273.1|2238361_2238943_+|plate	Baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	70.5	1.8e-55
AZC56274.1|2238999_2239239_+	hypothetical protein	NA	NA	NA	NA	NA
AZC56275.1|2239243_2239570_+|plate	Phage baseplate assembly protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	60.4	3.2e-30
AZC56276.1|2239566_2240451_+|plate	Baseplate assembly protein J	plate	A0A2H4JFK9	uncultured_Caudovirales_phage	68.4	6.7e-107
AZC56277.1|2240452_2241064_+|tail	Phage tail fiber	tail	A0A2H4JDH5	uncultured_Caudovirales_phage	69.3	4.7e-67
AZC56278.1|2241056_2242523_+|tail	Phage tail fiber protein	tail	A0A2H4JF09	uncultured_Caudovirales_phage	57.4	8.6e-59
AZC56279.1|2242535_2242970_+|tail	phage tail fiber assembly-like protein	tail	NA	NA	NA	NA
AZC56280.1|2243075_2244236_+|tail	Phage tail sheath monomer	tail	A0A2H4J869	uncultured_Caudovirales_phage	77.4	3.1e-168
AZC56281.1|2244247_2244757_+|tail	Phage major tail tube protein	tail	A0A2H4JBU0	uncultured_Caudovirales_phage	68.3	4.4e-63
AZC56282.1|2244773_2245094_+	hypothetical protein	NA	A0A2H4J873	uncultured_Caudovirales_phage	54.6	7.0e-22
AZC56283.1|2245244_2247854_+	Phage protein	NA	A0A2H4JG00	uncultured_Caudovirales_phage	34.1	1.4e-80
AZC56284.1|2247866_2248712_+	Phage protein U	NA	A0A2H4J875	uncultured_Caudovirales_phage	72.1	2.1e-113
AZC56285.1|2248686_2248893_+|tail	Phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	74.6	3.4e-22
AZC56286.1|2249378_2250428_+|tail	Phage tail protein D	tail	A0A2H4JBF6	uncultured_Caudovirales_phage	76.5	6.6e-146
AZC56287.1|2250480_2251035_+	Lytic enzyme	NA	B5TK83	Pseudomonas_phage	77.6	9.1e-78
AZC56288.1|2251025_2251568_+	hypothetical protein	NA	B5TK84	Pseudomonas_phage	63.8	1.0e-49
AZC56289.1|2251718_2252513_+	Dam modification methylase	NA	C7BGE1	Burkholderia_phage	67.7	5.3e-103
AZC56290.1|2253075_2253465_-	hypothetical protein	NA	NA	NA	NA	NA
AZC56291.1|2253449_2254232_-	putative membrane-associated	NA	NA	NA	NA	NA
AZC56292.1|2254242_2254788_-	Superfamily II DNA helicase	NA	NA	NA	NA	NA
AZC56293.1|2254895_2255675_-	hypothetical protein	NA	A0A1S6KZY1	Salmonella_phage	37.2	2.5e-17
AZC56294.1|2256357_2257719_-	hypothetical protein	NA	A0A1V0E025	Clostridioides_phage	29.7	2.5e-20
AZC56295.1|2258306_2258945_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
2258006:2258024	attR	TCCAATCCATCATGGGCGC	NA	NA	NA	NA
AZC56296.1|2259039_2259894_+	Transcriptional regulator	NA	NA	NA	NA	NA
AZC56297.1|2259945_2260434_-	hypothetical protein	NA	NA	NA	NA	NA
AZC56298.1|2260700_2262263_+	Two-component transcriptional response regulator, LuxR family	NA	NA	NA	NA	NA
AZC56299.1|2262567_2263404_+	N-hydroxyarylamine O-acetyltransferase	NA	NA	NA	NA	NA
AZC56300.1|2263416_2263839_-	hypothetical protein	NA	NA	NA	NA	NA
AZC56301.1|2263967_2264387_-	hypothetical protein	NA	NA	NA	NA	NA
AZC56302.1|2264623_2266162_+	Xanthine/uracil permease family protein	NA	NA	NA	NA	NA
AZC56303.1|2266209_2267367_-	putative MFS-type transporter	NA	NA	NA	NA	NA
AZC56304.1|2267385_2267724_+	hypothetical protein	NA	NA	NA	NA	NA
AZC56305.1|2268224_2268419_-	hypothetical protein	NA	NA	NA	NA	NA
AZC56306.1|2268545_2269742_-	aromatic-amino-acid aminotransferase	NA	NA	NA	NA	NA
AZC56307.1|2270077_2272093_+	Excinuclease ABC subunit B	NA	NA	NA	NA	NA
AZC56308.1|2272199_2272391_-	hypothetical protein	NA	NA	NA	NA	NA
AZC56309.1|2272394_2273876_+|tRNA	Glutamyl-tRNA synthetase	tRNA	NA	NA	NA	NA
AZC56310.1|2274811_2275351_+	Transcriptional regulator, AcrR family	NA	NA	NA	NA	NA
AZC56311.1|2275380_2276214_+	Putative hydrolase	NA	NA	NA	NA	NA
AZC56312.1|2276262_2276700_+	4-hydroxybenzoyl-CoA thioesterase domain protein	NA	NA	NA	NA	NA
AZC56313.1|2276820_2277780_+|tRNA	tRNA-dihydrouridine(16) synthase	tRNA	NA	NA	NA	NA
AZC56314.1|2277899_2278346_+	Small heat shock protein	NA	A0A1D8KN82	Synechococcus_phage	37.0	2.9e-18
AZC56315.1|2278530_2279229_+|tRNA	putative tRNA ligase	tRNA	NA	NA	NA	NA
AZC56316.1|2279225_2281910_+	Putative molecular chaperone, DnaJ family	NA	NA	NA	NA	NA
AZC56317.1|2281906_2283598_-	Chaperone protein HscC	NA	G8DDB7	Micromonas_pusilla_virus	37.6	1.5e-78
AZC56318.1|2283706_2286985_-	Sensory box/GGDEF family protein	NA	A0A127AWB9	Bacillus_phage	31.2	3.8e-14
AZC56319.1|2287065_2287956_-	Cys regulon transcriptional activator CysB	NA	NA	NA	NA	NA
AZC56320.1|2288101_2289520_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
AZC56321.1|2289530_2290175_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
AZC56322.1|2290181_2290373_-	hypothetical protein	NA	NA	NA	NA	NA
AZC56323.1|2290403_2291486_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
AZC56324.1|2291540_2292653_+	Aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AZC56325.1|2292818_2293829_+	Aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AZC56326.1|2294031_2296641_+	putative type IV pilus assembly FimV-related transmembrane protein	NA	NA	NA	NA	NA
AZC56327.1|2296719_2297022_-	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
AZC56328.1|2297580_2298435_+|tRNA	tRNA pseudouridine(38-40) synthase	tRNA	NA	NA	NA	NA
>prophage 3
CP027735	Pseudomonas chlororaphis subsp. piscium strain DTR133 chromosome, complete genome	7064618	4424767	4431024	7064618	tRNA	uncultured_Caudovirales_phage(83.33%)	8	NA	NA
AZC58156.1|4424767_4425160_+|tRNA	tRNA 5-methylaminomethyl-2-thiouridine synthase subunit TusD	tRNA	A0A2H4JA39	uncultured_Caudovirales_phage	83.8	2.5e-58
AZC58157.1|4425161_4425524_+|tRNA	tRNA 5-methylaminomethyl-2-thiouridine synthase subunit TusC	tRNA	A0A2H4J8C0	uncultured_Caudovirales_phage	74.2	4.3e-44
AZC58158.1|4425523_4425823_+|tRNA	tRNA 5-methylaminomethyl-2-thiouridine synthase subunit TusB	tRNA	A0A2H4JG28	uncultured_Caudovirales_phage	70.7	4.8e-33
AZC58159.1|4425819_4426155_+|tRNA	tRNA 2-thiouridine synthesis protein TusE	tRNA	A0A2H4J8B6	uncultured_Caudovirales_phage	82.0	1.9e-46
AZC58160.1|4426151_4427153_+	Anthranilate phosphoribosyltransferase like	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	84.8	5.5e-166
AZC58161.1|4427242_4428250_+	Glutathione S-transferase, omega	NA	NA	NA	NA	NA
AZC58162.1|4428348_4429743_-	Precorrin-2 oxidase	NA	NA	NA	NA	NA
AZC58163.1|4429743_4431024_-|tRNA	Seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	54.8	1.4e-100
>prophage 4
CP027735	Pseudomonas chlororaphis subsp. piscium strain DTR133 chromosome, complete genome	7064618	6407659	6452438	7064618	tRNA,capsid,head,integrase,terminase,tail	Pseudomonas_phage(75.0%)	48	6420222:6420281	6453288:6453364
AZC59919.1|6407659_6408889_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A1V0E714	Klebsiella_phage	41.2	5.0e-76
AZC59920.1|6408971_6409490_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine pyrophosphokinase	NA	NA	NA	NA	NA
AZC59921.1|6409480_6409834_-	Dihydroneopterin aldolase	NA	NA	NA	NA	NA
AZC59922.1|6409908_6410478_+	Acyl-phosphate:glycerol-3-phosphate O-acyltransferase PlsY	NA	NA	NA	NA	NA
AZC59923.1|6410519_6411545_-	N(6)-L-threonylcarbamoyladenine synthase	NA	A0A0R6PI74	Moraxella_phage	55.2	5.2e-103
AZC59924.1|6411745_6411961_+	SSU ribosomal protein S21p	NA	NA	NA	NA	NA
AZC59925.1|6412430_6414395_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.2	1.3e-73
AZC59926.1|6414462_6416310_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	34.3	6.8e-37
AZC59927.1|6416433_6420177_+	Sensory box/GGDEF family protein	NA	A0A127AWB9	Bacillus_phage	35.9	9.7e-14
6420222:6420281	attL	GGACTCATAATCCTTTGGTCCACGGTTCGAGTCCGTGTGGGCCCACCATCTTTGAAAGCC	NA	NA	NA	NA
AZC59928.1|6420375_6421935_-	hypothetical protein	NA	NA	NA	NA	NA
AZC59929.1|6421946_6422972_-|integrase	Phage integrase, site-specific tyrosine recombinase	integrase	A0A0U4IBS1	Pseudomonas_phage	67.6	1.1e-129
AZC59930.1|6422974_6423211_-	C protein	NA	A0A0U4ISL7	Pseudomonas_phage	58.2	1.1e-19
AZC59931.1|6423303_6423540_+	hypothetical protein	NA	A0A0U4KLD7	Pseudomonas_phage	69.4	8.2e-20
AZC59932.1|6423540_6426231_+	putative phage protein	NA	A0A0U3TH43	Pseudomonas_phage	51.1	1.4e-272
AZC59933.1|6426699_6426993_+	hypothetical protein	NA	NA	NA	NA	NA
AZC59934.1|6427003_6427255_+	hypothetical protein	NA	NA	NA	NA	NA
AZC59935.1|6427317_6427611_+	hypothetical protein	NA	NA	NA	NA	NA
AZC59936.1|6427603_6427843_+	Alginate biosynthesis transcriptional activator	NA	A0A0U4B0M9	Pseudomonas_phage	51.5	3.3e-08
AZC59937.1|6427836_6428085_+	hypothetical protein	NA	NA	NA	NA	NA
AZC59938.1|6428884_6429148_-	putative phage protein	NA	A5X9H0	Aeromonas_virus	52.0	7.5e-14
AZC59939.1|6429229_6429949_-|capsid	Phage capsid and scaffold	capsid	A0A0U4B0L9	Pseudomonas_phage	78.4	1.1e-102
AZC59940.1|6430007_6432059_-|terminase	Phage terminase, ATPase subunit	terminase	A0A0U4JIZ9	Pseudomonas_phage	67.2	1.0e-259
AZC59941.1|6432222_6433146_+|capsid	Phage capsid scaffolding protein	capsid	A0A0U4JVV6	Pseudomonas_phage	55.9	4.4e-61
AZC59942.1|6433147_6434167_+|capsid	Phage capsid protein	capsid	A0A0U4K5I9	Pseudomonas_phage	67.3	7.7e-123
AZC59943.1|6434163_6434886_+|terminase	putative terminase, endonuclease subunit	terminase	A0A0U4JEJ1	Pseudomonas_phage	66.0	3.5e-77
AZC59944.1|6434920_6435445_+|head	putative head completion/stabilization protein	head	A0A0U4J933	Pseudomonas_phage	55.6	5.4e-40
AZC59945.1|6435441_6435897_+	hypothetical protein	NA	A0A0U4IBS7	Pseudomonas_phage	59.6	1.9e-41
AZC59946.1|6435886_6436567_+	hypothetical protein	NA	A0A0U4ISN1	Pseudomonas_phage	62.8	7.0e-64
AZC59947.1|6436578_6437694_+	Phage protein	NA	A0A0U4KLE6	Pseudomonas_phage	66.8	1.7e-139
AZC59948.1|6437699_6438149_+	hypothetical protein	NA	A0A0U3TH58	Pseudomonas_phage	77.7	3.4e-59
AZC59949.1|6438148_6438361_+	putative Zinc-finger containing protein	NA	A0A0U4IIN4	Pseudomonas_phage	58.5	2.1e-14
AZC59950.1|6438456_6438711_+	hypothetical protein	NA	A0A0H5AUD7	Pseudomonas_phage	38.0	6.5e-07
AZC59951.1|6438707_6439241_+	putative phage lysozyme	NA	NA	NA	NA	NA
AZC59952.1|6439237_6439732_+	Phage outer membrane lytic protein Rz	NA	A0A0U4JXC2	Pseudomonas_phage	55.8	1.2e-25
AZC59953.1|6439769_6440057_+	hypothetical protein	NA	A0A0U4B0P2	Pseudomonas_phage	59.6	2.1e-22
AZC59954.1|6440229_6442590_+|tail	Phage-related tail protein	tail	A0A0U4IJ81	Pseudomonas_phage	40.8	6.1e-139
AZC59955.1|6442589_6442907_+	hypothetical protein	NA	A0A0U4B0N5	Pseudomonas_phage	78.4	7.6e-37
AZC59956.1|6442903_6444076_+	Phage protein	NA	A0A0U4JJ14	Pseudomonas_phage	73.8	5.8e-167
AZC59957.1|6444072_6444597_+	hypothetical protein	NA	A0A0U4JVX3	Pseudomonas_phage	83.3	2.0e-82
AZC59958.1|6444606_6447105_+|tail	Phage tail fiber protein	tail	A0A0U4K5K2	Pseudomonas_phage	44.3	1.1e-143
AZC59959.1|6447113_6447824_+|tail	putative tail fiber assembly protein	tail	A0A0U4JEJ6	Pseudomonas_phage	47.0	2.1e-58
AZC59960.1|6447805_6448744_+	hypothetical protein	NA	NA	NA	NA	NA
AZC59961.1|6448740_6449289_+	hypothetical protein	NA	A0A0U4J942	Pseudomonas_phage	62.9	1.8e-54
AZC59962.1|6449285_6449990_+	hypothetical protein	NA	A0A2I7RNK1	Vibrio_phage	38.9	2.3e-41
AZC59963.1|6449962_6450934_+	hypothetical protein	NA	A0A0U4IBV2	Pseudomonas_phage	70.2	7.5e-128
AZC59964.1|6450930_6451572_-	hypothetical protein	NA	NA	NA	NA	NA
AZC59965.1|6451797_6451980_+	putative mRNA interferase HicA	NA	A0A2H4JDU5	uncultured_Caudovirales_phage	61.0	1.4e-11
AZC59966.1|6452012_6452438_+	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	47.9	4.6e-29
6453288:6453364	attR	GGACTCATAATCCTTTGGTCCACGGTTCGAGTCCGTGTGGGCCCACCATCTTTGAAAGCCGCGCATTGCGCGGCTTT	NA	NA	NA	NA
