The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027708	Pseudomonas chlororaphis subsp. piscium strain ATCC 17411 chromosome, complete genome	7212397	1306699	1398195	7212397	plate,tail,tRNA,protease	Pseudomonas_phage(43.4%)	96	NA	NA
AZC35602.1|1306699_1308052_+|protease	Intramembrane protease RasP/YluC, implicated in cell division based on FtsL cleavage	protease	NA	NA	NA	NA
AZC35603.1|1308126_1310514_+	Outer membrane protein assembly factor YaeT	NA	NA	NA	NA	NA
AZC35604.1|1310559_1311063_+	Outer membrane chaperone Skp, precursor	NA	NA	NA	NA	NA
AZC35605.1|1311066_1312122_+	UDP-3-O-[3-hydroxymyristoyl] glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AZC35606.1|1312231_1312672_+	3-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
AZC35607.1|1312668_1313445_+	Acyl-ADP--UDP-N- acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AZC35608.1|1313447_1314578_+	Lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AZC35609.1|1314574_1315222_+	Ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.5	4.5e-28
AZC35610.1|1315291_1318816_+	DNA polymerase III alpha subunit	NA	A0A0K1Y906	Streptomyces_phage	37.4	2.4e-195
AZC35611.1|1318956_1319904_+	Acetyl-coenzyme A carboxyl transferase alpha chain	NA	NA	NA	NA	NA
AZC35612.1|1320023_1321352_+|tRNA	tRNA(Ile)-lysidine synthetase	tRNA	M1I0X1	Paramecium_bursaria_Chlorella_virus	24.7	3.8e-05
AZC35613.1|1321397_1321541_+	hypothetical protein	NA	NA	NA	NA	NA
AZC35614.1|1321626_1323258_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.5	6.9e-158
AZC35615.1|1323263_1324109_+	2-Keto-3-deoxy-D-manno-octulosonate-8-phosphate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.8	2.7e-49
AZC35616.1|1324266_1325556_+	Enolase	NA	A0A1X9I5Z8	Streptococcus_phage	59.2	9.0e-137
AZC35617.1|1325728_1326007_+	Cell division protein DivIC (FtsB), stabilizes FtsL against RasP cleavage	NA	NA	NA	NA	NA
AZC35618.1|1326003_1326711_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AZC35619.1|1326814_1327711_-	Transcriptional regulator, LysR family, in formaldehyde detoxification operon	NA	NA	NA	NA	NA
AZC35620.1|1327817_1328930_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.2	1.1e-29
AZC35621.1|1328938_1329784_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AZC35622.1|1329836_1330310_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
AZC35623.1|1330306_1331365_+|tRNA	tRNA pseudouridine(13) synthase	tRNA	NA	NA	NA	NA
AZC35624.1|1331352_1332102_+	5'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.6	1.0e-68
AZC35625.1|1332101_1332779_+	Protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.0	8.9e-43
AZC35626.1|1332988_1333822_+	Murein hydrolase activator NlpD	NA	A0A0S2SXL7	Bacillus_phage	33.3	6.3e-06
AZC35627.1|1333928_1334933_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	35.8	5.0e-34
AZC35628.1|1335434_1335758_-	4Fe-4S dicluster domain	NA	NA	NA	NA	NA
AZC35629.1|1338675_1339401_+	Transcriptional regulator	NA	B5TK58	Pseudomonas_phage	91.4	1.3e-124
AZC35630.1|1340142_1340724_+	hypothetical protein	NA	NA	NA	NA	NA
AZC35631.1|1340826_1341174_+	Holin	NA	B5TK61	Pseudomonas_phage	87.7	7.7e-51
AZC35632.1|1341340_1342105_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	26.3	2.6e-06
AZC35633.1|1342589_1342838_+	hypothetical protein	NA	NA	NA	NA	NA
AZC35634.1|1342946_1343588_+	hypothetical protein	NA	B5TK60	Pseudomonas_phage	54.6	6.9e-61
AZC35635.1|1343829_1344354_+	hypothetical protein	NA	NA	NA	NA	NA
AZC35636.1|1344357_1344966_+|plate	Baseplate assembly protein V	plate	A0A2H4JBW8	uncultured_Caudovirales_phage	60.4	1.7e-48
AZC35637.1|1344979_1345312_+|plate	Baseplate assembly protein W	plate	A0A2H4JI46	uncultured_Caudovirales_phage	69.1	3.6e-37
AZC35638.1|1345308_1346304_+|plate	Phage-related baseplate assembly protein	plate	A0A2H4JC04	uncultured_Caudovirales_phage	63.2	8.0e-109
AZC35639.1|1346300_1347035_+|tail	Phage tail fiber	tail	A0A2H4JDK0	uncultured_Caudovirales_phage	53.5	5.3e-41
AZC35640.1|1347031_1347562_+|tail	Phage tail fiber	tail	B0ZSG1	Halomonas_phage	57.5	2.2e-49
AZC35641.1|1347688_1348471_+	hypothetical protein	NA	NA	NA	NA	NA
AZC35642.1|1348473_1348776_+	Phage protein	NA	Q8H9M8	Vibrio_phage	64.6	1.8e-11
AZC35643.1|1348863_1349085_+	hypothetical protein	NA	NA	NA	NA	NA
AZC35644.1|1349087_1350254_+|tail	Major tail sheath protein	tail	B0ZSG8	Halomonas_phage	57.2	2.5e-125
AZC35645.1|1350253_1350760_+	hypothetical protein	NA	Q6R4W3	Vibrio_virus	35.7	2.6e-23
AZC35646.1|1350886_1351498_+	hypothetical protein	NA	B0ZSH0	Halomonas_phage	36.4	1.5e-25
AZC35647.1|1351494_1351620_+	hypothetical protein	NA	NA	NA	NA	NA
AZC35648.1|1351626_1353834_+	Phage protein	NA	A0A2H4JAA5	uncultured_Caudovirales_phage	49.3	7.2e-09
AZC35649.1|1353833_1354217_+|tail	Unclassified tail protein	tail	A0A2H4JAC8	uncultured_Caudovirales_phage	59.8	4.0e-40
AZC35650.1|1354209_1354422_+|tail	P2-like prophage tail protein X	tail	A0A2H4JGD9	uncultured_Caudovirales_phage	61.4	6.9e-18
AZC35651.1|1354431_1355448_+|tail	Phage tail protein D	tail	A0A2H4JH05	uncultured_Caudovirales_phage	56.9	7.7e-107
AZC35652.1|1355590_1356175_+	hypothetical protein	NA	B5TK65	Pseudomonas_phage	72.0	6.9e-76
AZC35653.1|1356171_1356354_+	Mu-like prophage FluMu protein GP38	NA	B5TK66	Pseudomonas_phage	91.7	2.5e-24
AZC35654.1|1356353_1357850_+|tail	Bacteriophage tail sheath protein	tail	B5TK67	Pseudomonas_phage	90.8	7.8e-257
AZC35655.1|1357916_1358264_+|tail	Phage tail tube protein	tail	B5TK68	Pseudomonas_phage	93.9	2.9e-58
AZC35656.1|1358260_1358557_+|tail	Phage small tail protein E	tail	B5TK69	Pseudomonas_phage	94.9	2.3e-43
AZC35657.1|1358687_1360763_+|tail	Phage tail length tape-measure protein	tail	B5TK70	Pseudomonas_phage	47.6	9.1e-38
AZC35658.1|1360749_1361988_+|tail	Phage tail/DNA circulation protein	tail	B5TK71	Pseudomonas_phage	75.5	1.3e-180
AZC35659.1|1361991_1363032_+|tail	Prophage tail protein	tail	B5TK72	Pseudomonas_phage	82.9	6.6e-162
AZC35660.1|1363065_1363659_+|plate	Prophage baseplate assembly protein V	plate	B5TK73	Pseudomonas_phage	89.3	5.2e-79
AZC35661.1|1363658_1364057_+	Bacteriophage protein GP46	NA	B5TK74	Pseudomonas_phage	90.2	7.5e-66
AZC35662.1|1364046_1365087_+	Phage FluMu protein gp47	NA	B5TK75	Pseudomonas_phage	86.7	1.5e-166
AZC35663.1|1365074_1365674_+|tail	Prophage tail protein	tail	B5TK76	Pseudomonas_phage	91.5	4.2e-105
AZC35664.1|1365685_1366837_+|tail	Prophage tail fiber protein	tail	B5TK77	Pseudomonas_phage	71.4	1.3e-155
AZC35665.1|1366833_1367340_+|tail	putative tail fiber assembly-like protein	tail	B5TK78	Pseudomonas_phage	61.3	1.2e-44
AZC35666.1|1367715_1369269_+|tail	Prophage tail fiber protein	tail	A4PE45	Ralstonia_virus	53.0	3.4e-37
AZC35667.1|1369270_1369741_+	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	34.2	7.1e-07
AZC35668.1|1369780_1369921_+	Lytic enzyme	NA	B5TK83	Pseudomonas_phage	67.4	2.5e-08
AZC35669.1|1369998_1371063_+|tail	Prophage tail fiber protein	tail	B5TK79	Pseudomonas_phage	58.3	1.0e-114
AZC35670.1|1371069_1371672_+|tail	Putative tail fiber assembly protein p37	tail	B5TK80	Pseudomonas_phage	45.3	4.6e-43
AZC35671.1|1371693_1372257_+	Lytic enzyme	NA	B5TK83	Pseudomonas_phage	83.3	9.9e-88
AZC35672.1|1372238_1372775_+	hypothetical protein	NA	B5TK84	Pseudomonas_phage	72.5	4.0e-62
AZC35673.1|1372857_1373358_+	Nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	86.7	7.9e-73
AZC35674.1|1373441_1374494_+	RecA protein	NA	A0A0S2MVG1	Bacillus_phage	63.0	4.4e-113
AZC35675.1|1374502_1374970_+	Regulatory protein RecX	NA	NA	NA	NA	NA
AZC35676.1|1375015_1376131_-	Decarboxylase family protein	NA	NA	NA	NA	NA
AZC35677.1|1376614_1376809_+	hypothetical protein	NA	NA	NA	NA	NA
AZC35678.1|1376810_1377233_-	Putative NADPH-quinone reductase (modulator of drug activity B)	NA	NA	NA	NA	NA
AZC35679.1|1377422_1378133_+	putative conserved protein YfiP, contains DTW domain	NA	NA	NA	NA	NA
AZC35680.1|1378466_1379117_+	Transcriptional regulator, LuxR family	NA	NA	NA	NA	NA
AZC35681.1|1379193_1379556_+	Diacylglycerol kinase	NA	NA	NA	NA	NA
AZC35682.1|1379552_1380479_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZC35683.1|1380614_1381394_+	Ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AZC35684.1|1381466_1382162_-	S-adenosylmethionine-dependent methyltransferase YaeB	NA	NA	NA	NA	NA
AZC35685.1|1382249_1383020_-	Rhamnolipid biosynthesis 3-oxoacyl-ACP reductase RhlG	NA	NA	NA	NA	NA
AZC35686.1|1383153_1383615_-	Uncharacterized protein YehS	NA	Q9EYF4	Enterobacteria_phage	51.3	6.5e-37
AZC35687.1|1383681_1384392_-	Ribosomal large subunit pseudouridine synthase F	NA	NA	NA	NA	NA
AZC35688.1|1384474_1384948_-	Acetyltransferase	NA	NA	NA	NA	NA
AZC35689.1|1385053_1386391_-	Ribosomal protein S12p Asp88 methylthiotransferase	NA	NA	NA	NA	NA
AZC35690.1|1386491_1386761_-	hypothetical protein	NA	NA	NA	NA	NA
AZC35691.1|1386782_1388624_+	Kup system potassium uptake protein	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	35.0	6.1e-78
AZC35692.1|1388725_1388860_-	hypothetical protein	NA	NA	NA	NA	NA
AZC35693.1|1389502_1390798_-	Alanylphosphatidylglycerol hydrolase, periplasmic	NA	NA	NA	NA	NA
AZC35694.1|1393837_1393981_-	hypothetical protein	NA	NA	NA	NA	NA
AZC35695.1|1394384_1395449_+	DNA polymerase IV	NA	NA	NA	NA	NA
AZC35696.1|1395508_1396462_-	putative lipoprotein	NA	NA	NA	NA	NA
AZC35697.1|1396479_1398195_-|tRNA	Prolyl-tRNA synthetase, bacterial type	tRNA	NA	NA	NA	NA
>prophage 2
CP027708	Pseudomonas chlororaphis subsp. piscium strain ATCC 17411 chromosome, complete genome	7212397	1573238	1618880	7212397	terminase,protease,tail,plate,integrase	uncultured_Caudovirales_phage(54.29%)	59	1582741:1582800	1621643:1621726
AZC35869.1|1573238_1574666_+|protease	HtrA protease/chaperone protein	protease	A0A1B1IT49	uncultured_Mediterranean_phage	31.3	5.9e-28
AZC35870.1|1574743_1576177_-|protease	Exported zinc metalloprotease YfgC precursor	protease	NA	NA	NA	NA
AZC35871.1|1576274_1576514_+	Rhodanese-like domain protein	NA	NA	NA	NA	NA
AZC35872.1|1576555_1577626_+	Putative permease PerM (YfgO)	NA	NA	NA	NA	NA
AZC35873.1|1577708_1578182_-	Thiol peroxidase, Bcp-type	NA	NA	NA	NA	NA
AZC35874.1|1578193_1578754_-	Glycine cleavage system transcriptional antiactivator GcvR	NA	NA	NA	NA	NA
AZC35875.1|1579081_1579960_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
AZC35876.1|1579977_1581090_+	Outer membrane beta-barrel assembly protein BamC	NA	NA	NA	NA	NA
AZC35877.1|1581094_1581853_+	Metal-dependent hydrolase of the beta-lactamase superfamily I	NA	NA	NA	NA	NA
AZC35878.1|1581881_1582592_+	Phosphoribosylaminoimidazole-succinocarboxamide synthase	NA	A0A0E3HWF9	Synechococcus_phage	37.1	3.0e-41
1582741:1582800	attL	GGGTTCGAATCCCTATCTCTCCGCCATTATTGAAGTAGCCGAAGCCCCTGAAAACGTTAA	NA	NA	NA	NA
AZC35879.1|1582887_1584126_-|integrase	phage integrase	integrase	Q76UT6	Pseudomonas_virus	41.5	2.8e-42
AZC35880.1|1584122_1584377_-	hypothetical protein	NA	NA	NA	NA	NA
AZC35881.1|1584392_1584605_-	hypothetical protein	NA	Q9ZXI5	Pseudomonas_virus	63.3	3.5e-14
AZC35882.1|1584601_1585258_-	Phage protein	NA	A0A0U1SZL2	Pseudomonas_phage	47.3	1.7e-38
AZC35883.1|1585250_1585724_-	hypothetical protein	NA	A0A0S2SYB5	Pseudomonas_phage	59.6	4.5e-09
AZC35884.1|1585720_1586245_-	hypothetical protein	NA	NA	NA	NA	NA
AZC35885.1|1586357_1586687_-	hypothetical protein	NA	A0A2K8I958	Pseudomonas_phage	51.5	4.6e-21
AZC35886.1|1586683_1588363_-	C-5 cytosine-specific DNA methylase	NA	Q9ZXI4	Pseudomonas_virus	72.9	3.5e-205
AZC35887.1|1588359_1588614_-	hypothetical protein	NA	NA	NA	NA	NA
AZC35888.1|1588610_1589108_-	hypothetical protein	NA	NA	NA	NA	NA
AZC35889.1|1589199_1589445_-	transcriptional regulator PrtN, putative	NA	A0A2H4J8B4	uncultured_Caudovirales_phage	60.0	5.1e-17
AZC35890.1|1589441_1589951_-	hypothetical protein	NA	A0A2H4J897	uncultured_Caudovirales_phage	42.0	8.2e-09
AZC35891.1|1590248_1591121_-	Transcriptional regulator	NA	A0A0A0YR73	Pseudomonas_phage	44.8	3.1e-56
AZC35892.1|1591189_1591399_+	hypothetical protein	NA	NA	NA	NA	NA
AZC35893.1|1591607_1592096_+	hypothetical protein	NA	A0A2H4JFM0	uncultured_Caudovirales_phage	55.5	3.0e-32
AZC35894.1|1592088_1592292_+	hypothetical protein	NA	A0A2H4JDJ0	uncultured_Caudovirales_phage	61.8	4.0e-15
AZC35895.1|1592288_1594853_+	DNA primase/helicase, phage-associated	NA	A0A2H4JF22	uncultured_Caudovirales_phage	45.1	1.4e-194
AZC35896.1|1595108_1595483_+	hypothetical protein	NA	NA	NA	NA	NA
AZC35897.1|1595493_1595952_+	hypothetical protein	NA	NA	NA	NA	NA
AZC35898.1|1596161_1596509_+	Holin	NA	B5TK61	Pseudomonas_phage	78.7	4.5e-43
AZC35899.1|1596646_1597168_+|terminase	Phage DNA packaging protein, Nu1 subunit of terminase	terminase	NA	NA	NA	NA
AZC35900.1|1597172_1599098_+|tail	Bacteriophage tail assembly protein	tail	A0A2D1GMT1	Marinobacter_phage	47.9	4.2e-162
AZC35901.1|1599110_1599326_+	hypothetical protein	NA	NA	NA	NA	NA
AZC35902.1|1599328_1600936_+	hypothetical protein	NA	A0A067ZJA4	Vibrio_phage	42.0	4.1e-94
AZC35903.1|1600938_1602159_+|protease	Periplasmic serine protease (ClpP class)	protease	A0A219YB02	Aeromonas_phage	43.0	1.4e-49
AZC35904.1|1602170_1602521_+	hypothetical protein	NA	NA	NA	NA	NA
AZC35905.1|1602532_1603564_+	hypothetical protein	NA	A0A0C5ABI0	Bacteriophage	40.6	5.5e-68
AZC35906.1|1603565_1603745_+	hypothetical protein	NA	NA	NA	NA	NA
AZC35907.1|1603774_1604068_+	hypothetical protein	NA	NA	NA	NA	NA
AZC35908.1|1604064_1604718_+	hypothetical protein	NA	A0A2H4JBV1	uncultured_Caudovirales_phage	59.2	3.8e-67
AZC35909.1|1604710_1605244_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	47.1	3.7e-36
AZC35910.1|1605240_1605822_+|plate	Baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	65.1	1.8e-55
AZC35911.1|1605865_1606081_+	hypothetical protein	NA	NA	NA	NA	NA
AZC35912.1|1606083_1606410_+|plate	Phage baseplate assembly protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	65.1	4.7e-34
AZC35913.1|1606406_1607288_+|plate	Baseplate assembly protein J	plate	A0A2H4JFK9	uncultured_Caudovirales_phage	69.3	3.8e-110
AZC35914.1|1607289_1607901_+|tail	Phage tail fiber	tail	A0A2H4JDH5	uncultured_Caudovirales_phage	67.0	4.8e-64
AZC35915.1|1607893_1609360_+|tail	Phage tail fiber protein	tail	A0A2H4JF09	uncultured_Caudovirales_phage	57.9	7.8e-60
AZC35916.1|1609372_1609807_+|tail	phage tail fiber assembly-like protein	tail	NA	NA	NA	NA
AZC35917.1|1609905_1611069_+|tail	Phage tail sheath monomer	tail	A0A2H4J869	uncultured_Caudovirales_phage	81.3	1.7e-182
AZC35918.1|1611081_1611591_+|tail	Phage major tail tube protein	tail	A0A2H4JBU0	uncultured_Caudovirales_phage	70.1	2.6e-63
AZC35919.1|1611620_1611917_+	hypothetical protein	NA	A0A2H4J873	uncultured_Caudovirales_phage	57.4	6.0e-20
AZC35920.1|1612048_1614649_+	Phage protein	NA	A0A2H4JG00	uncultured_Caudovirales_phage	32.7	5.8e-74
AZC35921.1|1614658_1615504_+	Phage protein U	NA	A0A2H4J875	uncultured_Caudovirales_phage	58.9	3.5e-89
AZC35922.1|1615478_1615685_+|tail	Phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	67.2	1.6e-19
AZC35923.1|1615741_1616791_+|tail	Phage tail protein D	tail	A0A2H4JBF6	uncultured_Caudovirales_phage	77.7	7.8e-147
AZC35924.1|1616841_1617396_+	Lytic enzyme	NA	B5TK83	Pseudomonas_phage	77.6	3.5e-77
AZC35925.1|1617422_1617644_-	hypothetical protein	NA	NA	NA	NA	NA
AZC35926.1|1617660_1617876_+	hypothetical protein	NA	NA	NA	NA	NA
AZC35927.1|1618232_1618880_+	hypothetical protein	NA	R9TRP4	Vibrio_phage	50.0	8.2e-54
1621643:1621726	attR	GGGTTCGAATCCCTATCTCTCCGCCATTATTGAAGTAGCCGAAGCCCCTGAAAACGTTAAAGTTTTCAGGGGCTTCGTCGTTTC	NA	NA	NA	NA
>prophage 3
CP027708	Pseudomonas chlororaphis subsp. piscium strain ATCC 17411 chromosome, complete genome	7212397	2849914	2912791	7212397	terminase,protease,tRNA,tail,plate	uncultured_Caudovirales_phage(62.96%)	71	NA	NA
AZC37050.1|2849914_2850688_+|tRNA	tRNA (adenine(22)-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
AZC37051.1|2850773_2851163_-	Transcriptional regulator, MerR family	NA	NA	NA	NA	NA
AZC37052.1|2851237_2852317_+	NAD-dependent epimerase/dehydratase	NA	NA	NA	NA	NA
AZC37053.1|2852469_2853369_+	Permease of the drug/metabolite transporter (DMT) superfamily	NA	NA	NA	NA	NA
AZC37054.1|2853455_2854346_-	putative exported protein	NA	NA	NA	NA	NA
AZC37055.1|2854372_2855827_-	putative membrane protein	NA	NA	NA	NA	NA
AZC37056.1|2855961_2856636_-	inner membrane protein MarC	NA	NA	NA	NA	NA
AZC37057.1|2856686_2857217_-	hypothetical protein	NA	NA	NA	NA	NA
AZC37058.1|2857763_2858564_+	hypothetical protein	NA	NA	NA	NA	NA
AZC37059.1|2858560_2859184_+	hypothetical protein	NA	NA	NA	NA	NA
AZC37060.1|2859605_2859887_-	hypothetical protein	NA	NA	NA	NA	NA
AZC37061.1|2860802_2861888_+	hypothetical protein	NA	NA	NA	NA	NA
AZC37062.1|2862124_2862286_+	hypothetical protein	NA	NA	NA	NA	NA
AZC37063.1|2862355_2864482_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AZC37064.1|2864887_2865370_+	hypothetical protein	NA	NA	NA	NA	NA
AZC37065.1|2865450_2865789_-	hypothetical protein	NA	NA	NA	NA	NA
AZC37066.1|2866273_2868013_+	Sulfate permease	NA	NA	NA	NA	NA
AZC37067.1|2868064_2868457_+	Gfa-like protein	NA	NA	NA	NA	NA
AZC37068.1|2868469_2869498_-	Sterol desaturase	NA	NA	NA	NA	NA
AZC37069.1|2869649_2870564_+	Transcriptional regulator, AraC family	NA	A0A291LAM3	Bordetella_phage	39.8	2.7e-10
AZC37070.1|2870631_2871282_+	Periplasmic aromatic aldehyde oxidoreductase, iron-sulfur subunit YagT	NA	NA	NA	NA	NA
AZC37071.1|2871286_2872282_+	Periplasmic aromatic aldehyde oxidoreductase, FAD binding subunit YagS	NA	NA	NA	NA	NA
AZC37072.1|2872278_2874531_+	Periplasmic aromatic aldehyde oxidoreductase, molybdenum binding subunit YagR	NA	NA	NA	NA	NA
AZC37073.1|2874649_2875045_+	Lysine exporter protein (LYSE/YGGA)	NA	NA	NA	NA	NA
AZC37074.1|2875098_2875977_-	hypothetical protein	NA	NA	NA	NA	NA
AZC37075.1|2876524_2876893_-	hypothetical protein	NA	NA	NA	NA	NA
AZC37076.1|2877369_2878128_+	hypothetical protein	NA	NA	NA	NA	NA
AZC37077.1|2878257_2879874_+	phage recombinase, putative	NA	Q3HQV4	Burkholderia_phage	55.5	3.6e-151
AZC37078.1|2879874_2880147_-	hypothetical protein	NA	NA	NA	NA	NA
AZC37079.1|2880143_2880278_-	hypothetical protein	NA	NA	NA	NA	NA
AZC37080.1|2880274_2882233_-	C-5 cytosine-specific DNA methylase family protein	NA	Q5QF27	Pseudomonas_virus	62.4	1.1e-255
AZC37081.1|2882229_2883138_-	hypothetical protein	NA	NA	NA	NA	NA
AZC37082.1|2883134_2883224_-	hypothetical protein	NA	NA	NA	NA	NA
AZC37083.1|2883220_2883442_-	hypothetical protein	NA	NA	NA	NA	NA
AZC37084.1|2883438_2883843_-	hypothetical protein	NA	NA	NA	NA	NA
AZC37085.1|2883893_2884211_-	transcriptional regulator, putative	NA	NA	NA	NA	NA
AZC37086.1|2884369_2884654_-	DNA-binding protein Roi-related protein	NA	NA	NA	NA	NA
AZC37087.1|2884664_2885258_-	hypothetical protein	NA	NA	NA	NA	NA
AZC37088.1|2885254_2885431_-	hypothetical protein	NA	NA	NA	NA	NA
AZC37089.1|2885507_2885903_-	phage repressor	NA	G9L676	Escherichia_phage	56.2	1.6e-31
AZC37090.1|2886882_2887401_+	hypothetical protein	NA	NA	NA	NA	NA
AZC37091.1|2887610_2889830_+	DNA primase, phage associated	NA	A0A2D1GN57	Marinobacter_phage	47.1	2.2e-191
AZC37092.1|2889822_2890182_+	hypothetical protein	NA	NA	NA	NA	NA
AZC37093.1|2890710_2891058_+	Holin	NA	A0A2H4J893	uncultured_Caudovirales_phage	80.6	2.7e-43
AZC37094.1|2891195_2891720_+|terminase	Phage DNA packaging protein, Nu1 subunit of terminase	terminase	A0A2D1GMW4	Marinobacter_phage	38.5	1.6e-20
AZC37095.1|2891763_2893650_+|terminase	Phage terminase, large subunit	terminase	A0A2D1GMT1	Marinobacter_phage	48.1	1.7e-163
AZC37096.1|2893662_2893878_+	hypothetical protein	NA	NA	NA	NA	NA
AZC37097.1|2893880_2895488_+	hypothetical protein	NA	A0A067ZJA4	Vibrio_phage	42.2	5.3e-94
AZC37098.1|2895490_2896711_+|protease	Periplasmic serine protease (ClpP class)	protease	A0A219YB02	Aeromonas_phage	43.4	4.7e-50
AZC37099.1|2896723_2897074_+	hypothetical protein	NA	NA	NA	NA	NA
AZC37100.1|2897085_2898117_+	hypothetical protein	NA	A0A0C5ABI0	Bacteriophage	41.7	3.4e-70
AZC37101.1|2898118_2898292_+	hypothetical protein	NA	NA	NA	NA	NA
AZC37102.1|2898294_2898615_+	hypothetical protein	NA	NA	NA	NA	NA
AZC37103.1|2898611_2899265_+	hypothetical protein	NA	A0A2H4JBV1	uncultured_Caudovirales_phage	59.6	1.4e-69
AZC37104.1|2899257_2899791_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	47.7	1.7e-36
AZC37105.1|2899787_2900369_+|plate	Baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	65.1	3.5e-56
AZC37106.1|2900376_2900682_+	hypothetical protein	NA	NA	NA	NA	NA
AZC37107.1|2900753_2900969_+	hypothetical protein	NA	NA	NA	NA	NA
AZC37108.1|2900971_2901298_+|plate	Phage baseplate assembly protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	65.1	6.2e-34
AZC37109.1|2901294_2902176_+|plate	Baseplate assembly protein J	plate	A0A2H4JFK9	uncultured_Caudovirales_phage	70.0	1.3e-110
AZC37110.1|2902177_2902783_+|tail	Phage tail fiber	tail	A0A2H4JDH5	uncultured_Caudovirales_phage	71.2	3.6e-80
AZC37111.1|2902779_2904249_+|tail	Phage tail fiber protein	tail	A0A2H4JF09	uncultured_Caudovirales_phage	77.8	3.3e-82
AZC37112.1|2904790_2905954_+|tail	Phage tail sheath monomer	tail	A0A2H4J869	uncultured_Caudovirales_phage	80.7	1.4e-181
AZC37113.1|2905966_2906476_+|tail	Phage major tail tube protein	tail	A0A2H4JBU0	uncultured_Caudovirales_phage	70.1	2.6e-63
AZC37114.1|2906506_2906803_+	hypothetical protein	NA	A0A2H4J873	uncultured_Caudovirales_phage	57.4	6.0e-20
AZC37115.1|2906934_2909529_+	Phage protein	NA	A0A2H4JG00	uncultured_Caudovirales_phage	31.7	4.4e-66
AZC37116.1|2909538_2910384_+	Phage protein U	NA	A0A2H4J875	uncultured_Caudovirales_phage	59.6	3.5e-89
AZC37117.1|2910358_2910565_+|tail	Phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	68.7	9.3e-20
AZC37118.1|2910621_2911674_+|tail	Phage tail protein D	tail	A0A2H4JBF6	uncultured_Caudovirales_phage	75.2	8.4e-149
AZC37119.1|2911697_2912249_+	Phage endolysin	NA	A0A2H4JHX4	uncultured_Caudovirales_phage	68.1	7.2e-67
AZC37120.1|2912248_2912791_+	hypothetical protein	NA	A0A2H4JBH9	uncultured_Caudovirales_phage	47.6	1.4e-27
>prophage 4
CP027708	Pseudomonas chlororaphis subsp. piscium strain ATCC 17411 chromosome, complete genome	7212397	4506606	4512864	7212397	tRNA	uncultured_Caudovirales_phage(83.33%)	8	NA	NA
AZC38511.1|4506606_4506999_+|tRNA	tRNA 5-methylaminomethyl-2-thiouridine synthase subunit TusD	tRNA	A0A2H4JA39	uncultured_Caudovirales_phage	83.8	2.5e-58
AZC38512.1|4507000_4507363_+|tRNA	tRNA 5-methylaminomethyl-2-thiouridine synthase subunit TusC	tRNA	A0A2H4J8C0	uncultured_Caudovirales_phage	75.0	1.9e-44
AZC38513.1|4507362_4507662_+|tRNA	tRNA 5-methylaminomethyl-2-thiouridine synthase subunit TusB	tRNA	A0A2H4JG28	uncultured_Caudovirales_phage	70.7	4.8e-33
AZC38514.1|4507658_4507994_+|tRNA	tRNA 2-thiouridine synthesis protein TusE	tRNA	A0A2H4J8B6	uncultured_Caudovirales_phage	81.1	7.2e-46
AZC38515.1|4507990_4508992_+	Anthranilate phosphoribosyltransferase like	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	84.8	2.7e-165
AZC38516.1|4509081_4510089_+	Glutathione S-transferase, omega	NA	NA	NA	NA	NA
AZC38517.1|4510188_4511583_-	Precorrin-2 oxidase	NA	NA	NA	NA	NA
AZC38518.1|4511583_4512864_-|tRNA	Seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	55.1	2.1e-101
