The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027709	Pseudomonas chlororaphis subsp. piscium strain ATCC 17809 chromosome, complete genome	7218893	1306705	1398204	7218893	tRNA,tail,protease,plate	Pseudomonas_phage(42.59%)	98	NA	NA
AZC42143.1|1306705_1308058_+|protease	Intramembrane protease RasP/YluC, implicated in cell division based on FtsL cleavage	protease	NA	NA	NA	NA
AZC42144.1|1308132_1310520_+	Outer membrane protein assembly factor YaeT	NA	NA	NA	NA	NA
AZC42145.1|1310565_1311069_+	Outer membrane chaperone Skp, precursor	NA	NA	NA	NA	NA
AZC42146.1|1311072_1312128_+	UDP-3-O-[3-hydroxymyristoyl] glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AZC42147.1|1312237_1312678_+	3-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
AZC42148.1|1312674_1313451_+	Acyl-ADP--UDP-N- acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AZC42149.1|1313453_1314584_+	Lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AZC42150.1|1314580_1315228_+	Ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.5	4.5e-28
AZC42151.1|1315297_1318822_+	DNA polymerase III alpha subunit	NA	A0A0K1Y906	Streptomyces_phage	37.4	2.4e-195
AZC42152.1|1318962_1319910_+	Acetyl-coenzyme A carboxyl transferase alpha chain	NA	NA	NA	NA	NA
AZC42153.1|1320029_1321358_+|tRNA	tRNA(Ile)-lysidine synthetase	tRNA	M1I0X1	Paramecium_bursaria_Chlorella_virus	24.7	3.8e-05
AZC42154.1|1321403_1321547_+	hypothetical protein	NA	NA	NA	NA	NA
AZC42155.1|1321632_1323264_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.5	6.9e-158
AZC42156.1|1323269_1324115_+	2-Keto-3-deoxy-D-manno-octulosonate-8-phosphate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	42.8	2.7e-49
AZC42157.1|1324272_1325562_+	Enolase	NA	A0A1X9I5Z8	Streptococcus_phage	59.2	9.0e-137
AZC42158.1|1325734_1326013_+	Cell division protein DivIC (FtsB), stabilizes FtsL against RasP cleavage	NA	NA	NA	NA	NA
AZC42159.1|1326009_1326717_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AZC42160.1|1326820_1327717_-	Transcriptional regulator, LysR family, in formaldehyde detoxification operon	NA	NA	NA	NA	NA
AZC42161.1|1327823_1328936_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.2	1.1e-29
AZC42162.1|1328944_1329790_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AZC42163.1|1329842_1330316_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
AZC42164.1|1330312_1331371_+|tRNA	tRNA pseudouridine(13) synthase	tRNA	NA	NA	NA	NA
AZC42165.1|1331358_1332108_+	5'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.6	1.0e-68
AZC42166.1|1332107_1332785_+	Protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.0	8.9e-43
AZC42167.1|1332994_1333828_+	Murein hydrolase activator NlpD	NA	A0A0S2SXL7	Bacillus_phage	33.3	6.3e-06
AZC42168.1|1333934_1334939_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	35.8	5.0e-34
AZC42169.1|1335440_1335764_-	4Fe-4S dicluster domain	NA	NA	NA	NA	NA
AZC42170.1|1335906_1338486_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	23.5	2.4e-27
AZC42171.1|1338682_1339408_+	Transcriptional regulator	NA	B5TK58	Pseudomonas_phage	91.4	1.3e-124
AZC42172.1|1340149_1340731_+	hypothetical protein	NA	NA	NA	NA	NA
AZC42173.1|1340833_1341181_+	Holin	NA	B5TK61	Pseudomonas_phage	87.7	7.7e-51
AZC42174.1|1341347_1342112_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	26.3	2.6e-06
AZC42175.1|1342596_1342845_+	hypothetical protein	NA	NA	NA	NA	NA
AZC42176.1|1342953_1343595_+	hypothetical protein	NA	B5TK60	Pseudomonas_phage	54.6	6.9e-61
AZC42177.1|1343836_1344361_+	hypothetical protein	NA	NA	NA	NA	NA
AZC42178.1|1344364_1344973_+|plate	Baseplate assembly protein V	plate	A0A2H4JBW8	uncultured_Caudovirales_phage	60.4	1.7e-48
AZC42179.1|1344986_1345319_+|plate	Baseplate assembly protein W	plate	A0A2H4JI46	uncultured_Caudovirales_phage	69.1	3.6e-37
AZC42180.1|1345315_1346311_+|plate	Phage-related baseplate assembly protein	plate	A0A2H4JC04	uncultured_Caudovirales_phage	63.2	8.0e-109
AZC42181.1|1346307_1347042_+|tail	Phage tail fiber	tail	A0A2H4JDK0	uncultured_Caudovirales_phage	53.5	5.3e-41
AZC42182.1|1347038_1347569_+|tail	Phage tail fiber	tail	B0ZSG1	Halomonas_phage	57.5	2.2e-49
AZC42183.1|1347695_1348478_+	hypothetical protein	NA	NA	NA	NA	NA
AZC42184.1|1348480_1348783_+	Phage protein	NA	Q8H9M8	Vibrio_phage	64.6	1.8e-11
AZC42185.1|1348870_1349092_+	hypothetical protein	NA	NA	NA	NA	NA
AZC42186.1|1349094_1350261_+|tail	Major tail sheath protein	tail	B0ZSG8	Halomonas_phage	57.2	2.5e-125
AZC42187.1|1350260_1350767_+	hypothetical protein	NA	Q6R4W3	Vibrio_virus	35.7	2.6e-23
AZC42188.1|1350893_1351505_+	hypothetical protein	NA	B0ZSH0	Halomonas_phage	36.4	1.5e-25
AZC42189.1|1351501_1351627_+	hypothetical protein	NA	NA	NA	NA	NA
AZC42190.1|1351633_1353841_+|tail	Phage tail length tape-measure protein	tail	A0A2H4JAA5	uncultured_Caudovirales_phage	49.3	7.2e-09
AZC42191.1|1353840_1354224_+|tail	Unclassified tail protein	tail	A0A2H4JAC8	uncultured_Caudovirales_phage	59.8	4.0e-40
AZC42192.1|1354216_1354429_+|tail	P2-like prophage tail protein X	tail	A0A2H4JGD9	uncultured_Caudovirales_phage	61.4	6.9e-18
AZC42193.1|1354438_1355455_+|tail	Phage tail protein D	tail	A0A2H4JH05	uncultured_Caudovirales_phage	56.9	7.7e-107
AZC42194.1|1355597_1356182_+	hypothetical protein	NA	B5TK65	Pseudomonas_phage	72.0	6.9e-76
AZC42195.1|1356178_1356361_+	Mu-like prophage FluMu protein GP38	NA	B5TK66	Pseudomonas_phage	91.7	2.5e-24
AZC42196.1|1356360_1357857_+|tail	Bacteriophage tail sheath protein	tail	B5TK67	Pseudomonas_phage	90.8	7.8e-257
AZC42197.1|1357923_1358271_+|tail	Phage tail tube protein	tail	B5TK68	Pseudomonas_phage	93.9	2.9e-58
AZC42198.1|1358267_1358564_+|tail	Phage small tail protein E	tail	B5TK69	Pseudomonas_phage	94.9	2.3e-43
AZC42199.1|1358694_1360770_+|tail	Phage tail length tape-measure protein	tail	B5TK70	Pseudomonas_phage	47.6	9.1e-38
AZC42200.1|1360756_1361995_+|tail	Phage tail/DNA circulation protein	tail	B5TK71	Pseudomonas_phage	75.5	1.3e-180
AZC42201.1|1361998_1363039_+|tail	Prophage tail protein	tail	B5TK72	Pseudomonas_phage	82.9	6.6e-162
AZC42202.1|1363072_1363666_+|plate	Prophage baseplate assembly protein V	plate	B5TK73	Pseudomonas_phage	89.3	5.2e-79
AZC42203.1|1363665_1364064_+	Bacteriophage protein GP46	NA	B5TK74	Pseudomonas_phage	90.2	7.5e-66
AZC42204.1|1364053_1365094_+	Phage FluMu protein gp47	NA	B5TK75	Pseudomonas_phage	86.7	1.5e-166
AZC42205.1|1365081_1365681_+|tail	Prophage tail protein	tail	B5TK76	Pseudomonas_phage	91.5	4.2e-105
AZC42206.1|1365692_1366844_+|tail	Prophage tail fiber protein	tail	B5TK77	Pseudomonas_phage	71.4	1.3e-155
AZC42207.1|1366840_1367347_+|tail	putative tail fiber assembly-like protein	tail	B5TK78	Pseudomonas_phage	61.3	1.2e-44
AZC42208.1|1367722_1369276_+|tail	Prophage tail fiber protein	tail	A4PE45	Ralstonia_virus	53.0	3.4e-37
AZC42209.1|1369277_1369748_+	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	34.2	7.1e-07
AZC42210.1|1369787_1369928_+	Lytic enzyme	NA	B5TK83	Pseudomonas_phage	67.4	2.5e-08
AZC42211.1|1370005_1371070_+|tail	Prophage tail fiber protein	tail	B5TK79	Pseudomonas_phage	58.3	1.0e-114
AZC42212.1|1371076_1371679_+|tail	Putative tail fiber assembly protein p37	tail	B5TK80	Pseudomonas_phage	45.3	4.6e-43
AZC42213.1|1371700_1372264_+	Lytic enzyme	NA	B5TK83	Pseudomonas_phage	83.3	9.9e-88
AZC42214.1|1372245_1372782_+	hypothetical protein	NA	B5TK84	Pseudomonas_phage	72.5	4.0e-62
AZC42215.1|1372864_1373365_+	Nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	86.7	7.9e-73
AZC42216.1|1373448_1374501_+	RecA protein	NA	A0A0S2MVG1	Bacillus_phage	63.0	4.4e-113
AZC42217.1|1374509_1374977_+	Regulatory protein RecX	NA	NA	NA	NA	NA
AZC42218.1|1375022_1376138_-	Decarboxylase family protein	NA	NA	NA	NA	NA
AZC42219.1|1376621_1376816_+	hypothetical protein	NA	NA	NA	NA	NA
AZC42220.1|1376817_1377240_-	Putative NADPH-quinone reductase (modulator of drug activity B)	NA	NA	NA	NA	NA
AZC42221.1|1377429_1378140_+	putative conserved protein YfiP, contains DTW domain	NA	NA	NA	NA	NA
AZC42222.1|1378473_1379124_+	Transcriptional regulator, LuxR family	NA	NA	NA	NA	NA
AZC42223.1|1379200_1379563_+	Diacylglycerol kinase	NA	NA	NA	NA	NA
AZC42224.1|1379559_1380486_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AZC42225.1|1380621_1381401_+	Ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AZC42226.1|1381473_1382169_-	S-adenosylmethionine-dependent methyltransferase YaeB	NA	NA	NA	NA	NA
AZC42227.1|1382256_1383027_-	Rhamnolipid biosynthesis 3-oxoacyl-ACP reductase RhlG	NA	NA	NA	NA	NA
AZC42228.1|1383160_1383622_-	Uncharacterized protein YehS	NA	Q9EYF4	Enterobacteria_phage	51.3	6.5e-37
AZC42229.1|1383688_1384399_-	Ribosomal large subunit pseudouridine synthase F	NA	NA	NA	NA	NA
AZC42230.1|1384481_1384955_-	Acetyltransferase	NA	NA	NA	NA	NA
AZC42231.1|1385060_1386398_-	Ribosomal protein S12p Asp88 methylthiotransferase	NA	NA	NA	NA	NA
AZC42232.1|1386498_1386768_-	hypothetical protein	NA	NA	NA	NA	NA
AZC42233.1|1386789_1388631_+	Kup system potassium uptake protein	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	35.0	6.1e-78
AZC42234.1|1388732_1388867_-	hypothetical protein	NA	NA	NA	NA	NA
AZC42235.1|1389510_1390806_-	Alanylphosphatidylglycerol hydrolase, periplasmic	NA	NA	NA	NA	NA
AZC42236.1|1390805_1393454_-	Alanylphosphatidylglycerol synthase	NA	NA	NA	NA	NA
AZC42237.1|1393846_1393990_-	hypothetical protein	NA	NA	NA	NA	NA
AZC42238.1|1394393_1395458_+	DNA polymerase IV	NA	NA	NA	NA	NA
AZC42239.1|1395517_1396471_-	putative lipoprotein	NA	NA	NA	NA	NA
AZC42240.1|1396488_1398204_-|tRNA	Prolyl-tRNA synthetase, bacterial type	tRNA	NA	NA	NA	NA
>prophage 2
CP027709	Pseudomonas chlororaphis subsp. piscium strain ATCC 17809 chromosome, complete genome	7218893	1573248	1618891	7218893	plate,integrase,tail,protease,terminase	uncultured_Caudovirales_phage(54.29%)	60	1582751:1582810	1621654:1621737
AZC42413.1|1573248_1574676_+|protease	HtrA protease/chaperone protein	protease	A0A1B1IT49	uncultured_Mediterranean_phage	31.3	5.9e-28
AZC42414.1|1574753_1576187_-|protease	Exported zinc metalloprotease YfgC precursor	protease	NA	NA	NA	NA
AZC42415.1|1576284_1576524_+	Rhodanese-like domain protein	NA	NA	NA	NA	NA
AZC42416.1|1576565_1577636_+	Putative permease PerM (YfgO)	NA	NA	NA	NA	NA
AZC42417.1|1577718_1578192_-	Thiol peroxidase, Bcp-type	NA	NA	NA	NA	NA
AZC42418.1|1578203_1578764_-	Glycine cleavage system transcriptional antiactivator GcvR	NA	NA	NA	NA	NA
AZC42419.1|1578955_1579093_-	hypothetical protein	NA	NA	NA	NA	NA
AZC42420.1|1579091_1579970_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
AZC42421.1|1579987_1581100_+	Outer membrane beta-barrel assembly protein BamC	NA	NA	NA	NA	NA
AZC42422.1|1581104_1581863_+	Metal-dependent hydrolase of the beta-lactamase superfamily I	NA	NA	NA	NA	NA
AZC42423.1|1581891_1582602_+	Phosphoribosylaminoimidazole-succinocarboxamide synthase	NA	A0A0E3HWF9	Synechococcus_phage	37.1	3.0e-41
1582751:1582810	attL	GGGTTCGAATCCCTATCTCTCCGCCATTATTGAAGTAGCCGAAGCCCCTGAAAACGTTAA	NA	NA	NA	NA
AZC42424.1|1582897_1584136_-|integrase	phage integrase	integrase	Q76UT6	Pseudomonas_virus	41.5	2.8e-42
AZC42425.1|1584132_1584387_-	hypothetical protein	NA	NA	NA	NA	NA
AZC42426.1|1584402_1584615_-	hypothetical protein	NA	Q9ZXI5	Pseudomonas_virus	63.3	3.5e-14
AZC42427.1|1584611_1585268_-	Phage protein	NA	A0A0U1SZL2	Pseudomonas_phage	47.3	1.7e-38
AZC42428.1|1585260_1585734_-	hypothetical protein	NA	A0A0S2SYB5	Pseudomonas_phage	59.6	4.5e-09
AZC42429.1|1585730_1586255_-	hypothetical protein	NA	NA	NA	NA	NA
AZC42430.1|1586367_1586697_-	hypothetical protein	NA	A0A2K8I958	Pseudomonas_phage	51.5	4.6e-21
AZC42431.1|1586693_1588373_-	C-5 cytosine-specific DNA methylase	NA	Q9ZXI4	Pseudomonas_virus	72.9	3.5e-205
AZC42432.1|1588369_1588624_-	hypothetical protein	NA	NA	NA	NA	NA
AZC42433.1|1588620_1589118_-	hypothetical protein	NA	NA	NA	NA	NA
AZC42434.1|1589209_1589455_-	transcriptional regulator PrtN, putative	NA	A0A2H4J8B4	uncultured_Caudovirales_phage	60.0	5.1e-17
AZC42435.1|1589451_1589961_-	hypothetical protein	NA	A0A2H4J897	uncultured_Caudovirales_phage	42.0	8.2e-09
AZC42436.1|1590258_1591131_-	Transcriptional regulator	NA	A0A0A0YR73	Pseudomonas_phage	44.8	3.1e-56
AZC42437.1|1591199_1591409_+	hypothetical protein	NA	NA	NA	NA	NA
AZC42438.1|1591617_1592106_+	hypothetical protein	NA	A0A2H4JFM0	uncultured_Caudovirales_phage	55.5	3.0e-32
AZC42439.1|1592098_1592302_+	hypothetical protein	NA	A0A2H4JDJ0	uncultured_Caudovirales_phage	61.8	4.0e-15
AZC42440.1|1592298_1594863_+	DNA primase/helicase, phage-associated	NA	A0A2H4JF22	uncultured_Caudovirales_phage	45.1	1.4e-194
AZC42441.1|1595118_1595493_+	hypothetical protein	NA	NA	NA	NA	NA
AZC42442.1|1595503_1595962_+	hypothetical protein	NA	NA	NA	NA	NA
AZC42443.1|1596171_1596519_+	Holin	NA	B5TK61	Pseudomonas_phage	78.7	4.5e-43
AZC42444.1|1596656_1597178_+|terminase	Phage DNA packaging protein, Nu1 subunit of terminase	terminase	NA	NA	NA	NA
AZC42445.1|1597182_1599108_+|tail	Bacteriophage tail assembly protein	tail	A0A2D1GMT1	Marinobacter_phage	47.9	4.2e-162
AZC42446.1|1599120_1599336_+	hypothetical protein	NA	NA	NA	NA	NA
AZC42447.1|1599338_1600946_+	hypothetical protein	NA	A0A067ZJA4	Vibrio_phage	42.0	4.1e-94
AZC42448.1|1600948_1602169_+|protease	Periplasmic serine protease (ClpP class)	protease	A0A219YB02	Aeromonas_phage	43.0	1.4e-49
AZC42449.1|1602180_1602531_+	hypothetical protein	NA	NA	NA	NA	NA
AZC42450.1|1602542_1603574_+	hypothetical protein	NA	A0A0C5ABI0	Bacteriophage	40.6	5.5e-68
AZC42451.1|1603575_1603755_+	hypothetical protein	NA	NA	NA	NA	NA
AZC42452.1|1603784_1604078_+	hypothetical protein	NA	NA	NA	NA	NA
AZC42453.1|1604074_1604728_+	hypothetical protein	NA	A0A2H4JBV1	uncultured_Caudovirales_phage	59.2	3.8e-67
AZC42454.1|1604720_1605254_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	47.1	3.7e-36
AZC42455.1|1605250_1605832_+|plate	Baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	65.1	1.8e-55
AZC42456.1|1605875_1606091_+	hypothetical protein	NA	NA	NA	NA	NA
AZC42457.1|1606093_1606420_+|plate	Phage baseplate assembly protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	65.1	4.7e-34
AZC42458.1|1606416_1607298_+|plate	Baseplate assembly protein J	plate	A0A2H4JFK9	uncultured_Caudovirales_phage	69.3	3.8e-110
AZC42459.1|1607299_1607911_+|tail	Phage tail fiber	tail	A0A2H4JDH5	uncultured_Caudovirales_phage	67.0	4.8e-64
AZC42460.1|1607903_1609370_+|tail	Phage tail fiber protein	tail	A0A2H4JF09	uncultured_Caudovirales_phage	57.9	7.8e-60
AZC42461.1|1609382_1609817_+|tail	phage tail fiber assembly-like protein	tail	NA	NA	NA	NA
AZC42462.1|1609915_1611079_+|tail	Phage tail sheath monomer	tail	A0A2H4J869	uncultured_Caudovirales_phage	81.3	1.7e-182
AZC42463.1|1611091_1611601_+|tail	Phage major tail tube protein	tail	A0A2H4JBU0	uncultured_Caudovirales_phage	70.1	2.6e-63
AZC42464.1|1611631_1611928_+	hypothetical protein	NA	A0A2H4J873	uncultured_Caudovirales_phage	57.4	6.0e-20
AZC42465.1|1612059_1614660_+	Phage protein	NA	A0A2H4JG00	uncultured_Caudovirales_phage	32.7	5.8e-74
AZC42466.1|1614669_1615515_+	Phage protein U	NA	A0A2H4J875	uncultured_Caudovirales_phage	58.9	3.5e-89
AZC42467.1|1615489_1615696_+|tail	Phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	67.2	1.6e-19
AZC42468.1|1615752_1616802_+|tail	Phage tail protein D	tail	A0A2H4JBF6	uncultured_Caudovirales_phage	77.7	7.8e-147
AZC42469.1|1616852_1617407_+	Lytic enzyme	NA	B5TK83	Pseudomonas_phage	77.6	3.5e-77
AZC42470.1|1617433_1617655_-	hypothetical protein	NA	NA	NA	NA	NA
AZC42471.1|1617671_1617887_+	hypothetical protein	NA	NA	NA	NA	NA
AZC42472.1|1618243_1618891_+	hypothetical protein	NA	R9TRP4	Vibrio_phage	50.0	8.2e-54
1621654:1621737	attR	GGGTTCGAATCCCTATCTCTCCGCCATTATTGAAGTAGCCGAAGCCCCTGAAAACGTTAAAGTTTTCAGGGGCTTCGTCGTTTC	NA	NA	NA	NA
>prophage 3
CP027709	Pseudomonas chlororaphis subsp. piscium strain ATCC 17809 chromosome, complete genome	7218893	2849902	2912780	7218893	tRNA,plate,tail,protease,terminase	uncultured_Caudovirales_phage(62.96%)	71	NA	NA
AZC43596.1|2849902_2850676_+|tRNA	tRNA (adenine(22)-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
AZC43597.1|2850762_2851152_-	Transcriptional regulator, MerR family	NA	NA	NA	NA	NA
AZC43598.1|2851226_2852306_+	NAD-dependent epimerase/dehydratase	NA	NA	NA	NA	NA
AZC43599.1|2852458_2853358_+	Permease of the drug/metabolite transporter (DMT) superfamily	NA	NA	NA	NA	NA
AZC43600.1|2853444_2854335_-	putative exported protein	NA	NA	NA	NA	NA
AZC43601.1|2854361_2855816_-	putative membrane protein	NA	NA	NA	NA	NA
AZC43602.1|2855950_2856625_-	inner membrane protein MarC	NA	NA	NA	NA	NA
AZC43603.1|2856675_2857206_-	hypothetical protein	NA	NA	NA	NA	NA
AZC43604.1|2857752_2858553_+	hypothetical protein	NA	NA	NA	NA	NA
AZC43605.1|2858549_2859173_+	hypothetical protein	NA	NA	NA	NA	NA
AZC43606.1|2859594_2859876_-	hypothetical protein	NA	NA	NA	NA	NA
AZC43607.1|2860791_2861877_+	hypothetical protein	NA	NA	NA	NA	NA
AZC43608.1|2862113_2862275_+	hypothetical protein	NA	NA	NA	NA	NA
AZC43609.1|2862344_2864471_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AZC43610.1|2864876_2865359_+	hypothetical protein	NA	NA	NA	NA	NA
AZC43611.1|2865439_2865778_-	hypothetical protein	NA	NA	NA	NA	NA
AZC43612.1|2866262_2868002_+	Sulfate permease	NA	NA	NA	NA	NA
AZC43613.1|2868053_2868446_+	Gfa-like protein	NA	NA	NA	NA	NA
AZC43614.1|2868458_2869487_-	Sterol desaturase	NA	NA	NA	NA	NA
AZC43615.1|2869638_2870553_+	Transcriptional regulator, AraC family	NA	A0A291LAM3	Bordetella_phage	39.8	2.7e-10
AZC43616.1|2870620_2871271_+	Periplasmic aromatic aldehyde oxidoreductase, iron-sulfur subunit YagT	NA	NA	NA	NA	NA
AZC43617.1|2871275_2872271_+	Periplasmic aromatic aldehyde oxidoreductase, FAD binding subunit YagS	NA	NA	NA	NA	NA
AZC43618.1|2872267_2874520_+	Periplasmic aromatic aldehyde oxidoreductase, molybdenum binding subunit YagR	NA	NA	NA	NA	NA
AZC43619.1|2874638_2875034_+	Lysine exporter protein (LYSE/YGGA)	NA	NA	NA	NA	NA
AZC43620.1|2875087_2875966_-	hypothetical protein	NA	NA	NA	NA	NA
AZC43621.1|2876513_2876882_-	hypothetical protein	NA	NA	NA	NA	NA
AZC43622.1|2877358_2878117_+	hypothetical protein	NA	NA	NA	NA	NA
AZC43623.1|2878246_2879863_+	phage recombinase, putative	NA	Q3HQV4	Burkholderia_phage	55.5	3.6e-151
AZC43624.1|2879863_2880136_-	hypothetical protein	NA	NA	NA	NA	NA
AZC43625.1|2880132_2880267_-	hypothetical protein	NA	NA	NA	NA	NA
AZC43626.1|2880263_2882222_-	C-5 cytosine-specific DNA methylase family protein	NA	Q5QF27	Pseudomonas_virus	62.4	1.1e-255
AZC43627.1|2882218_2883127_-	hypothetical protein	NA	NA	NA	NA	NA
AZC43628.1|2883123_2883213_-	hypothetical protein	NA	NA	NA	NA	NA
AZC43629.1|2883209_2883431_-	hypothetical protein	NA	NA	NA	NA	NA
AZC43630.1|2883427_2883832_-	hypothetical protein	NA	NA	NA	NA	NA
AZC43631.1|2883882_2884200_-	transcriptional regulator, putative	NA	NA	NA	NA	NA
AZC43632.1|2884358_2884643_-	DNA-binding protein Roi-related protein	NA	NA	NA	NA	NA
AZC43633.1|2884653_2885247_-	hypothetical protein	NA	NA	NA	NA	NA
AZC43634.1|2885243_2885420_-	hypothetical protein	NA	NA	NA	NA	NA
AZC43635.1|2885496_2885892_-	phage repressor	NA	G9L676	Escherichia_phage	56.2	1.6e-31
AZC43636.1|2886871_2887390_+	hypothetical protein	NA	NA	NA	NA	NA
AZC43637.1|2887599_2889819_+	DNA primase, phage associated	NA	A0A2D1GN57	Marinobacter_phage	47.1	2.2e-191
AZC43638.1|2889811_2890171_+	hypothetical protein	NA	NA	NA	NA	NA
AZC43639.1|2890699_2891047_+	Holin	NA	A0A2H4J893	uncultured_Caudovirales_phage	80.6	2.7e-43
AZC43640.1|2891184_2891709_+|terminase	Phage DNA packaging protein, Nu1 subunit of terminase	terminase	A0A2D1GMW4	Marinobacter_phage	38.5	1.6e-20
AZC43641.1|2891752_2893639_+|terminase	Phage terminase, large subunit	terminase	A0A2D1GMT1	Marinobacter_phage	48.1	1.7e-163
AZC43642.1|2893651_2893867_+	hypothetical protein	NA	NA	NA	NA	NA
AZC43643.1|2893869_2895477_+	hypothetical protein	NA	A0A067ZJA4	Vibrio_phage	42.2	5.3e-94
AZC43644.1|2895479_2896700_+|protease	Periplasmic serine protease (ClpP class)	protease	A0A219YB02	Aeromonas_phage	43.4	4.7e-50
AZC43645.1|2896712_2897063_+	hypothetical protein	NA	NA	NA	NA	NA
AZC43646.1|2897074_2898106_+	hypothetical protein	NA	A0A0C5ABI0	Bacteriophage	41.7	3.4e-70
AZC43647.1|2898107_2898281_+	hypothetical protein	NA	NA	NA	NA	NA
AZC43648.1|2898283_2898604_+	hypothetical protein	NA	NA	NA	NA	NA
AZC43649.1|2898600_2899254_+	hypothetical protein	NA	A0A2H4JBV1	uncultured_Caudovirales_phage	59.6	1.4e-69
AZC43650.1|2899246_2899780_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	47.7	1.7e-36
AZC43651.1|2899776_2900358_+|plate	Baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	65.1	3.5e-56
AZC43652.1|2900365_2900671_+	hypothetical protein	NA	NA	NA	NA	NA
AZC43653.1|2900742_2900958_+	hypothetical protein	NA	NA	NA	NA	NA
AZC43654.1|2900960_2901287_+|plate	Phage baseplate assembly protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	65.1	6.2e-34
AZC43655.1|2901283_2902165_+|plate	Baseplate assembly protein J	plate	A0A2H4JFK9	uncultured_Caudovirales_phage	70.0	1.3e-110
AZC43656.1|2902166_2902772_+|tail	Phage tail fiber	tail	A0A2H4JDH5	uncultured_Caudovirales_phage	71.2	3.6e-80
AZC43657.1|2902768_2904238_+|tail	Phage tail fiber protein	tail	A0A2H4JF09	uncultured_Caudovirales_phage	77.8	3.3e-82
AZC43658.1|2904779_2905943_+|tail	Phage tail sheath monomer	tail	A0A2H4J869	uncultured_Caudovirales_phage	80.7	1.4e-181
AZC43659.1|2905955_2906465_+|tail	Phage major tail tube protein	tail	A0A2H4JBU0	uncultured_Caudovirales_phage	70.1	2.6e-63
AZC43660.1|2906495_2906792_+	hypothetical protein	NA	A0A2H4J873	uncultured_Caudovirales_phage	57.4	6.0e-20
AZC43661.1|2906923_2909518_+	Phage protein	NA	A0A2H4JG00	uncultured_Caudovirales_phage	31.7	4.4e-66
AZC43662.1|2909527_2910373_+	Phage protein U	NA	A0A2H4J875	uncultured_Caudovirales_phage	59.6	3.5e-89
AZC43663.1|2910347_2910554_+|tail	Phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	68.7	9.3e-20
AZC43664.1|2910610_2911663_+|tail	Phage tail protein D	tail	A0A2H4JBF6	uncultured_Caudovirales_phage	75.2	8.4e-149
AZC43665.1|2911686_2912238_+	Phage endolysin	NA	A0A2H4JHX4	uncultured_Caudovirales_phage	68.1	7.2e-67
AZC43666.1|2912237_2912780_+	hypothetical protein	NA	A0A2H4JBH9	uncultured_Caudovirales_phage	47.6	1.4e-27
>prophage 4
CP027709	Pseudomonas chlororaphis subsp. piscium strain ATCC 17809 chromosome, complete genome	7218893	4506605	4512863	7218893	tRNA	uncultured_Caudovirales_phage(83.33%)	8	NA	NA
AZC45061.1|4506605_4506998_+|tRNA	tRNA 5-methylaminomethyl-2-thiouridine synthase subunit TusD	tRNA	A0A2H4JA39	uncultured_Caudovirales_phage	83.8	2.5e-58
AZC45062.1|4506999_4507362_+|tRNA	tRNA 5-methylaminomethyl-2-thiouridine synthase subunit TusC	tRNA	A0A2H4J8C0	uncultured_Caudovirales_phage	75.0	1.9e-44
AZC45063.1|4507361_4507661_+|tRNA	tRNA 5-methylaminomethyl-2-thiouridine synthase subunit TusB	tRNA	A0A2H4JG28	uncultured_Caudovirales_phage	70.7	4.8e-33
AZC45064.1|4507657_4507993_+|tRNA	tRNA 2-thiouridine synthesis protein TusE	tRNA	A0A2H4J8B6	uncultured_Caudovirales_phage	81.1	7.2e-46
AZC45065.1|4507989_4508991_+	Anthranilate phosphoribosyltransferase like	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	84.8	2.7e-165
AZC45066.1|4509080_4510088_+	Glutathione S-transferase, omega	NA	NA	NA	NA	NA
AZC45067.1|4510187_4511582_-	Precorrin-2 oxidase	NA	NA	NA	NA	NA
AZC45068.1|4511582_4512863_-|tRNA	Seryl-tRNA synthetase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	55.1	2.1e-101
