The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033865	Staphylococcus aureus strain FDAARGOS_504 chromosome, complete genome	2894587	183983	191803	2894587		Hokovirus(16.67%)	10	NA	NA
AZB45977.1|183983_185039_-	two-component sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.8	3.6e-14
AZB45978.1|185038_185725_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AZB45979.1|185699_186173_-	DoxX family protein	NA	NA	NA	NA	NA
AZB45980.1|186514_186955_-	hypothetical protein	NA	NA	NA	NA	NA
AZB45981.1|187234_187819_-	hypothetical protein	NA	NA	NA	NA	NA
AZB45982.1|187917_188631_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	6.5e-52
AZB45983.1|188634_189054_-	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	28.7	6.3e-07
AZB45984.1|189055_189724_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	9.6e-66
AZB45985.1|190074_190668_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	44.0	6.8e-39
AZB45986.1|190651_191803_+	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	36.1	2.1e-23
>prophage 2
CP033865	Staphylococcus aureus strain FDAARGOS_504 chromosome, complete genome	2894587	207273	217913	2894587		uncultured_Caudovirales_phage(62.5%)	11	NA	NA
AZB46000.1|207273_208779_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
AZB46001.1|208840_209089_-	hypothetical protein	NA	NA	NA	NA	NA
AZB46002.1|209118_209619_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	66.2	2.7e-52
AZB46003.1|209638_210505_-	DMT family transporter	NA	NA	NA	NA	NA
AZB46004.1|210889_211039_+	ribonucleoside-diphosphate reductase	NA	NA	NA	NA	NA
AZB46005.1|211306_211705_+	protein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
AZB46006.1|211667_213773_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
AZB46007.1|213892_214864_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	4.2e-171
AZB46008.1|215240_216212_+	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	80.2	7.8e-141
AZB46009.1|216198_217155_+	iron ABC transporter permease	NA	A0A2H4J116	uncultured_Caudovirales_phage	60.0	5.5e-06
AZB46010.1|217151_217913_+	ATP-binding cassette domain-containing protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	30.1	7.2e-17
>prophage 3
CP033865	Staphylococcus aureus strain FDAARGOS_504 chromosome, complete genome	2894587	296449	335899	2894587	terminase,integrase,coat,transposase	Staphylococcus_phage(53.12%)	48	311501:311518	333164:333181
AZB46085.1|296449_297535_+|transposase	transposase	transposase	A0A0A8WIF9	Clostridium_phage	28.3	4.5e-12
AZB46086.1|297531_299424_+|integrase	phage integrase family protein	integrase	NA	NA	NA	NA
AZB46087.1|299430_299808_+|transposase	transposase	transposase	NA	NA	NA	NA
AZB46088.1|299958_300741_+	aminoglycoside nucleotidyltransferase ANT(9)	NA	NA	NA	NA	NA
AZB48505.1|304276_304474_+	hypothetical protein	NA	NA	NA	NA	NA
AZB46089.1|304441_305101_-	RibD family protein	NA	A0A1B0RXM8	Streptococcus_phage	100.0	3.1e-125
AZB46090.1|305211_305619_-	WYL domain-containing protein	NA	A0A1B0RXM3	Streptococcus_phage	98.3	1.1e-59
AZB46091.1|305591_305807_-	WYL domain-containing protein	NA	E4ZFP5	Streptococcus_phage	98.6	3.4e-33
AZB46092.1|306438_307233_-	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
AZB46093.1|307325_307868_-	streptothricin N-acetyltransferase Sat4	NA	A0A1B0RXL7	Streptococcus_phage	100.0	8.9e-94
AZB46094.1|307864_308773_-	aminoglycoside nucleotidyltransferase ANT(6)-Ia	NA	E4ZFP8	Streptococcus_phage	100.0	2.8e-177
AZB46095.1|308805_309540_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	100.0	1.5e-141
AZB46096.1|309520_310390_-	nucleotidyltransferase domain-containing protein	NA	A0A1X9I6C9	Streptococcus_phage	95.8	4.3e-159
AZB46097.1|310492_310738_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
311501:311518	attL	AATCTTTTCAAGAAATGG	NA	NA	NA	NA
AZB46098.1|312701_313598_+	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	96.8	1.2e-151
AZB46099.1|313696_313906_+	peptide-binding protein	NA	A0A1X9I6D5	Streptococcus_phage	98.6	1.4e-31
AZB46100.1|313923_314196_+	antitoxin	NA	A0A1X9I6E5	Streptococcus_phage	96.7	5.4e-07
AZB46101.1|314858_315521_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
AZB46102.1|316635_317022_+	topiosmerase	NA	NA	NA	NA	NA
AZB46103.1|317014_317311_+	thioredoxin	NA	NA	NA	NA	NA
AZB46104.1|317560_318586_+	methionine import ATP-binding protein MetN 2	NA	G9BWD6	Planktothrix_phage	36.8	7.2e-28
AZB46105.1|318578_319274_+	ABC transporter permease	NA	NA	NA	NA	NA
AZB46106.1|319291_320113_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZB46107.1|320255_321476_-|integrase	site-specific integrase	integrase	Q4ZE80	Staphylococcus_phage	47.3	1.1e-99
AZB46108.1|321489_322878_-	SAP domain protein	NA	NA	NA	NA	NA
AZB46109.1|322904_323477_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZB46110.1|323648_323870_+	XRE family transcriptional regulator	NA	A0A2H4JFN1	uncultured_Caudovirales_phage	43.5	2.0e-07
AZB46111.1|323870_324143_+	helix-turn-helix domain-containing protein	NA	Q4ZE77	Staphylococcus_phage	84.4	7.7e-38
AZB46112.1|324154_324310_+	pathogenicity island protein	NA	NA	NA	NA	NA
AZB46113.1|324294_324498_+	pathogenicity island protein	NA	A0A1W6JQF4	Staphylococcus_phage	100.0	1.0e-31
AZB46114.1|324499_324883_+	pathogenicity island protein	NA	A0A1W6JQI7	Staphylococcus_phage	90.6	1.0e-56
AZB46115.1|324883_325177_+	DUF1474 family protein	NA	A0A1W6JQH0	Staphylococcus_phage	100.0	1.3e-43
AZB46116.1|325264_326134_+	mobile element-associated protein	NA	Q4ZE74	Staphylococcus_phage	95.2	1.1e-162
AZB46117.1|326147_327857_+	DUF927 domain-containing protein	NA	Q4ZE73	Staphylococcus_phage	95.8	0.0e+00
AZB46118.1|328186_328567_+	hypothetical protein	NA	Q4ZE71	Staphylococcus_phage	98.4	1.5e-68
AZB46119.1|328563_329205_+	pathogenicity island protein	NA	Q4ZE67	Staphylococcus_phage	91.5	3.0e-109
AZB46120.1|329740_330082_+	pathogenicity island protein	NA	Q4ZE66	Staphylococcus_phage	99.1	1.4e-57
AZB46121.1|330093_330672_+	pathogenicity island protein	NA	A0A2H4JBG0	uncultured_Caudovirales_phage	38.4	1.4e-28
AZB46122.1|330689_330908_+	hypothetical protein	NA	NA	NA	NA	NA
AZB46123.1|330958_331486_+|coat	spore coat protein	coat	Q4ZE87	Staphylococcus_phage	96.0	1.6e-87
AZB48506.1|331617_331830_+	pathogenicity island family protein	NA	Q4ZE86	Staphylococcus_phage	91.4	1.7e-29
AZB46124.1|331826_332396_+|terminase	terminase small subunit	terminase	A0A1W6JQF0	Staphylococcus_phage	97.4	6.0e-101
AZB46125.1|332596_333619_+	hypothetical protein	NA	NA	NA	NA	NA
333164:333181	attR	CCATTTCTTGAAAAGATT	NA	NA	NA	NA
AZB46126.1|333637_334201_+	hypothetical protein	NA	NA	NA	NA	NA
AZB46127.1|334449_335004_-	DUF4888 domain-containing protein	NA	A0A1W6JQE5	Staphylococcus_phage	75.5	1.2e-72
AZB46128.1|335378_335531_+	hypothetical protein	NA	A0A0F6N3H2	Staphylococcus_phage	100.0	3.1e-20
AZB46129.1|335601_335712_+	hypothetical protein	NA	W5R8J7	Staphylococcus_phage	97.2	3.8e-12
AZB46130.1|335698_335899_+	hypothetical protein	NA	W5R9N2	Staphylococcus_phage	100.0	3.7e-29
>prophage 4
CP033865	Staphylococcus aureus strain FDAARGOS_504 chromosome, complete genome	2894587	423290	475236	2894587	bacteriocin,transposase,protease,holin,tRNA	Bacillus_virus(25.0%)	46	NA	NA
AZB46212.1|423290_424238_-|transposase	IS30-like element ISSau1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	100.0	1.1e-184
AZB46213.1|424352_425822_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AZB46214.1|425872_426859_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.0	1.8e-15
AZB46215.1|426861_427842_+	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.1	2.7e-16
AZB46216.1|427834_428797_+	ABC transporter permease	NA	NA	NA	NA	NA
AZB46217.1|428808_429636_+	ABC transporter permease	NA	NA	NA	NA	NA
AZB46218.1|429657_431225_-|transposase	IS3-like element ISSau2 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	51.8	1.0e-49
AZB46219.1|433192_434182_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AZB46220.1|434476_434872_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
AZB46221.1|435242_435962_+	adaptor protein MecA	NA	NA	NA	NA	NA
AZB46222.1|436083_437070_+	competence protein CoiA	NA	NA	NA	NA	NA
AZB46223.1|437117_438926_+	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.5	9.3e-47
AZB46224.1|439385_440192_-	DsbA family protein	NA	NA	NA	NA	NA
AZB46225.1|440214_440580_-	globin	NA	NA	NA	NA	NA
AZB46226.1|440683_441277_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
AZB46227.1|441462_441810_+	hypothetical protein	NA	NA	NA	NA	NA
AZB46228.1|441826_442462_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
AZB46229.1|442478_443288_+	NAD(+) kinase	NA	NA	NA	NA	NA
AZB46230.1|443284_444139_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
AZB46231.1|444159_445545_+	magnesium transporter	NA	NA	NA	NA	NA
AZB46232.1|445554_447399_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AZB46233.1|447676_448447_+	enoyl-[acyl-carrier-protein] reductase FabI	NA	NA	NA	NA	NA
AZB46234.1|448642_449728_-	AI-2E family transporter	NA	NA	NA	NA	NA
AZB46235.1|450069_451638_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
AZB46236.1|451780_452539_+	esterase family protein	NA	NA	NA	NA	NA
AZB46237.1|452704_453430_+	hypothetical protein	NA	NA	NA	NA	NA
AZB46238.1|453431_454283_+	base excision DNA repair protein	NA	NA	NA	NA	NA
AZB46239.1|455025_455535_+	hypothetical protein	NA	NA	NA	NA	NA
AZB46240.1|455647_456856_-	MFS transporter	NA	NA	NA	NA	NA
AZB46241.1|456815_457991_-	diacylglycerol beta-glucosyltransferase	NA	NA	NA	NA	NA
AZB46242.1|458422_459907_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L- lysine ligase	NA	NA	NA	NA	NA
AZB46243.1|459887_460148_+	hypothetical protein	NA	NA	NA	NA	NA
AZB46244.1|460147_461710_+	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.2	9.9e-37
AZB46245.1|462011_462815_+	hypothetical protein	NA	S5MAL1	Bacillus_phage	40.5	1.6e-30
AZB46246.1|463033_465358_+	PDZ domain-containing protein	NA	W5SAB9	Pithovirus	26.8	4.0e-10
AZB46247.1|465374_466733_+	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
AZB46248.1|466871_468383_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
AZB46249.1|468871_469441_-	competence protein ComK	NA	NA	NA	NA	NA
AZB46250.1|469650_469869_+	IDEAL domain-containing protein	NA	NA	NA	NA	NA
AZB46251.1|469949_470936_-	lipoate--protein ligase	NA	NA	NA	NA	NA
AZB46252.1|471134_471311_+	DUF2187 domain-containing protein	NA	NA	NA	NA	NA
AZB46253.1|471325_471928_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AZB48508.1|472228_472306_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AZB46254.1|472844_472946_+	hypothetical protein	NA	NA	NA	NA	NA
AZB48509.1|472955_473228_+|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
AZB46255.1|473271_475236_+|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
>prophage 5
CP033865	Staphylococcus aureus strain FDAARGOS_504 chromosome, complete genome	2894587	509289	517762	2894587		Synechococcus_phage(33.33%)	9	NA	NA
AZB46290.1|509289_509772_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	8.0e-22
AZB46291.1|509758_510883_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AZB46292.1|510886_511591_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	41.6	7.3e-48
AZB46293.1|511590_511854_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
AZB46294.1|511855_512527_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AZB46295.1|512519_514709_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.2	5.1e-140
AZB46296.1|514687_516172_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.7	8.5e-46
AZB46297.1|516164_517193_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.4	7.6e-62
AZB46298.1|517195_517762_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	3.6e-29
>prophage 6
CP033865	Staphylococcus aureus strain FDAARGOS_504 chromosome, complete genome	2894587	1084488	1092800	2894587	tRNA	Staphylococcus_phage(16.67%)	7	NA	NA
AZB46819.1|1084488_1085274_-	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	8.0e-19
AZB46820.1|1085399_1086290_-	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	33.1	2.0e-26
AZB46821.1|1086299_1087646_-	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	34.0	1.4e-55
AZB46822.1|1087759_1088860_-	Nif3-like dinuclear metal center hexameric protein	NA	A0A1S5V250	Saudi_moumouvirus	30.6	3.0e-08
AZB46823.1|1088862_1089540_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
AZB46824.1|1089670_1090777_-	RNA polymerase sigma factor SigA	NA	A0A2I7SAT0	Vibrio_phage	38.1	1.1e-37
AZB46825.1|1091000_1092800_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.0	3.5e-54
>prophage 7
CP033865	Staphylococcus aureus strain FDAARGOS_504 chromosome, complete genome	2894587	1162236	1171279	2894587	tRNA	uncultured_Mediterranean_phage(50.0%)	7	NA	NA
AZB46892.1|1162236_1162755_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	5.6e-29
AZB46893.1|1162776_1165050_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	6.2e-64
AZB46894.1|1165252_1167532_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.8e-31
AZB46895.1|1167806_1168067_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
AZB46896.1|1168085_1169225_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
AZB46897.1|1169247_1170273_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
AZB46898.1|1170274_1171279_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
>prophage 8
CP033865	Staphylococcus aureus strain FDAARGOS_504 chromosome, complete genome	2894587	1184215	1190163	2894587		Streptococcus_phage(100.0%)	7	NA	NA
AZB46914.1|1184215_1184875_-	RibD family protein	NA	A0A1B0RXM8	Streptococcus_phage	100.0	3.1e-125
AZB46915.1|1184985_1185393_-	WYL domain-containing protein	NA	A0A1B0RXM3	Streptococcus_phage	98.3	1.1e-59
AZB46916.1|1185365_1185581_-	WYL domain-containing protein	NA	E4ZFP5	Streptococcus_phage	98.6	3.4e-33
AZB46917.1|1186212_1187007_-	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
AZB46918.1|1187099_1187642_-	streptothricin N-acetyltransferase Sat4	NA	A0A1B0RXL7	Streptococcus_phage	100.0	8.9e-94
AZB46919.1|1187638_1188547_-	aminoglycoside nucleotidyltransferase ANT(6)-Ia	NA	E4ZFP8	Streptococcus_phage	100.0	2.8e-177
AZB46920.1|1189293_1190163_-	nucleotidyltransferase domain-containing protein	NA	A0A1X9I6C9	Streptococcus_phage	95.8	4.3e-159
>prophage 9
CP033865	Staphylococcus aureus strain FDAARGOS_504 chromosome, complete genome	2894587	1312504	1452586	2894587	terminase,integrase,tail,transposase,portal,capsid,protease,holin,tRNA,head	Staphylococcus_phage(75.0%)	168	1401581:1401598	1456965:1456982
AZB47021.1|1312504_1313773_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	99.1	5.9e-56
AZB47022.1|1313889_1320459_-	DUF1542 domain-containing protein	NA	A0A2H4PQU6	Staphylococcus_phage	86.8	3.6e-298
AZB47023.1|1320622_1320742_+	hypothetical protein	NA	NA	NA	NA	NA
AZB47024.1|1320764_1321079_+	DUF961 domain-containing protein	NA	A0A1S5SF38	Streptococcus_phage	100.0	5.2e-54
AZB47025.1|1321094_1321481_+	DUF961 domain-containing protein	NA	A0A1S5SF96	Streptococcus_phage	100.0	3.0e-64
AZB47026.1|1321509_1322895_+	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	100.0	1.1e-265
AZB47027.1|1322897_1323050_+	conjugal transfer protein	NA	NA	NA	NA	NA
AZB47028.1|1323072_1324278_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	100.0	2.8e-233
AZB47029.1|1324320_1324542_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	100.0	4.3e-31
AZB47030.1|1324658_1325156_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	100.0	1.7e-91
AZB47031.1|1325130_1325637_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	100.0	8.6e-91
AZB47032.1|1325620_1328068_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	100.0	0.0e+00
AZB47033.1|1328070_1330248_+	YtxH domain-containing protein	NA	A0A1S5SF30	Streptococcus_phage	100.0	0.0e+00
AZB47034.1|1330244_1331246_+	peptidase P60	NA	A0A1S5SEZ8	Streptococcus_phage	100.0	5.0e-191
AZB47035.1|1331242_1332175_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	99.4	3.1e-171
AZB47036.1|1332449_1332536_+	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
AZB47037.1|1332551_1334471_+	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	99.5	0.0e+00
AZB47038.1|1334571_1334757_+	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	67.9	3.9e-17
AZB47039.1|1334845_1336237_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.1	2.9e-125
AZB47040.1|1336398_1336752_-	XRE family transcriptional regulator	NA	A0A1S5SFA6	Streptococcus_phage	100.0	1.3e-58
AZB48536.1|1336956_1337028_+	hypothetical protein	NA	NA	NA	NA	NA
AZB47041.1|1337256_1337679_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	100.0	2.5e-72
AZB47042.1|1337675_1337906_+	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	100.0	2.7e-36
AZB47043.1|1338131_1338383_-	hypothetical protein	NA	NA	NA	NA	NA
AZB47044.1|1338366_1338570_+	excisionase	NA	A0A1S5SF07	Streptococcus_phage	100.0	4.0e-31
AZB47045.1|1338651_1339869_+|integrase	site-specific integrase	integrase	A0A1S5SEW7	Streptococcus_phage	100.0	3.7e-233
AZB47046.1|1340382_1340694_-	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	96.1	4.5e-50
AZB47047.1|1340715_1343133_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	98.8	0.0e+00
AZB47048.1|1343421_1344603_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	99.7	9.6e-218
AZB47049.1|1344712_1345666_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	99.3	6.4e-79
AZB47050.1|1345662_1346226_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	95.7	1.1e-99
AZB47051.1|1346344_1346746_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AZB47052.1|1347319_1348147_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZB47053.1|1348149_1348269_-	hypothetical protein	NA	NA	NA	NA	NA
AZB47054.1|1348280_1348472_-	hypothetical protein	NA	NA	NA	NA	NA
AZB47055.1|1348380_1349382_+	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	99.1	5.0e-183
AZB47056.1|1349503_1349968_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	98.1	4.9e-69
AZB47057.1|1349980_1351162_-	riboflavin biosynthesis protein RibBA	NA	A0A2H4PQS2	Staphylococcus_phage	99.7	6.6e-227
AZB47058.1|1351172_1351805_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	99.0	8.4e-112
AZB48537.1|1351811_1352843_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	98.3	5.8e-195
AZB47059.1|1353335_1354838_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2H4PQX2	Staphylococcus_phage	98.6	5.0e-30
AZB47060.1|1355480_1355795_+	ArsR family transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	98.1	1.3e-52
AZB47061.1|1355794_1357087_+	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	95.1	2.6e-216
AZB47062.1|1357173_1358028_-	autolysin	NA	Q4ZCC7	Staphylococcus_virus	38.6	9.8e-39
AZB47063.1|1358303_1358528_-	hypothetical protein	NA	NA	NA	NA	NA
AZB47064.1|1358726_1359197_+	RNA polymerase sigma factor	NA	A0A2H4PQT5	Staphylococcus_phage	85.2	2.2e-69
AZB47065.1|1359309_1359753_+	competence protein ComK	NA	NA	NA	NA	NA
AZB47066.1|1359739_1360183_-	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	77.4	2.4e-49
AZB47067.1|1360480_1361116_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AZB47068.1|1361282_1361903_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AZB47069.1|1362360_1363074_-	transaldolase	NA	M1PR54	Cyanophage	35.3	5.5e-19
AZB47070.1|1363332_1363635_+	hypothetical protein	NA	NA	NA	NA	NA
AZB47071.1|1363889_1364255_+	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	100.0	3.6e-59
AZB47072.1|1364251_1364605_+	CrcB family protein	NA	A0A2H4PQQ7	Staphylococcus_phage	97.4	4.2e-20
AZB47073.1|1364854_1365688_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	99.3	6.0e-158
AZB47074.1|1365899_1366808_-	NERD domain-containing protein	NA	A0A2H4PQQ8	Staphylococcus_phage	99.7	9.8e-138
AZB47075.1|1366932_1368126_-	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	99.5	4.3e-218
AZB47076.1|1368497_1370090_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	99.8	0.0e+00
AZB48538.1|1370382_1371129_-	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	97.2	3.3e-139
AZB47077.1|1371133_1371607_-	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	98.1	9.5e-84
AZB47078.1|1371672_1371930_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	100.0	7.2e-46
AZB47079.1|1371926_1372928_-	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	96.7	8.5e-183
AZB47080.1|1372932_1374411_-	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	97.2	2.4e-282
AZB48539.1|1374569_1375025_-	DUF4909 domain-containing protein	NA	A0A2H4PQN7	Staphylococcus_phage	94.5	3.5e-75
AZB47081.1|1375327_1375978_+	calcium-binding protein	NA	A0A2H4PQM8	Staphylococcus_phage	88.4	1.0e-51
AZB47082.1|1376058_1377054_+	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	97.2	3.8e-74
AZB47083.1|1377129_1377756_+	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	84.1	4.5e-81
AZB47084.1|1377796_1378141_+	DUF3969 family protein	NA	A0A2H4PQN6	Staphylococcus_phage	94.7	5.1e-55
AZB47085.1|1378238_1378811_+	hypothetical protein	NA	A0A2H4PQN4	Staphylococcus_phage	94.8	3.2e-25
AZB47086.1|1378959_1380327_-	FRG domain-containing protein	NA	NA	NA	NA	NA
AZB47087.1|1380326_1380896_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4PQN8	Staphylococcus_phage	54.8	2.2e-39
AZB47088.1|1381088_1381535_-	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
AZB47089.1|1381616_1381841_-	hypothetical protein	NA	NA	NA	NA	NA
AZB47090.1|1381985_1382081_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
AZB47091.1|1382203_1382305_+	hypothetical protein	NA	NA	NA	NA	NA
AZB47092.1|1382479_1382923_-	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
AZB47093.1|1382922_1383366_-	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
AZB47094.1|1384331_1386752_+	hyaluronate lyase	NA	NA	NA	NA	NA
AZB48540.1|1386877_1387237_-	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
AZB47095.1|1387464_1387914_-	DUF1433 domain-containing protein	NA	NA	NA	NA	NA
AZB47096.1|1387956_1389567_+	lipase	NA	NA	NA	NA	NA
AZB47097.1|1389581_1389881_+	secretion protein	NA	NA	NA	NA	NA
AZB47098.1|1390142_1391972_-	NTPase	NA	NA	NA	NA	NA
AZB47099.1|1392008_1393163_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	36.3	7.8e-39
AZB47100.1|1393155_1394895_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	98.6	3.2e-286
AZB47101.1|1395074_1395794_-|protease	serine protease SplF	protease	A0A2H4PQP1	Staphylococcus_phage	97.9	1.7e-129
AZB47102.1|1395963_1396680_-|protease	serine protease SplE	protease	A0A2H4PQN5	Staphylococcus_phage	96.6	2.5e-128
AZB47103.1|1396843_1397560_-|protease	serine protease	protease	A0A2H4PQN5	Staphylococcus_phage	64.7	2.4e-86
AZB47104.1|1397726_1398443_-|protease	serine protease	protease	A0A2H4PQN5	Staphylococcus_phage	62.6	5.5e-83
AZB47105.1|1398566_1399286_-|protease	serine protease SplC	protease	A0A2H4PQP7	Staphylococcus_phage	93.3	3.2e-123
AZB47106.1|1399585_1399831_+	hypothetical protein	NA	NA	NA	NA	NA
AZB47107.1|1400299_1400815_+	hypothetical protein	NA	NA	NA	NA	NA
AZB47108.1|1401061_1402408_+	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	51.3	6.7e-66
1401581:1401598	attL	TTATTTAATGCTGAAACT	NA	NA	NA	NA
AZB47109.1|1402994_1403231_+	hypothetical protein	NA	NA	NA	NA	NA
AZB47110.1|1404175_1404367_+	hypothetical protein	NA	NA	NA	NA	NA
AZB47111.1|1404602_1405379_-	exotoxin	NA	NA	NA	NA	NA
AZB47112.1|1405662_1406418_-	exotoxin	NA	A0A075M4C7	Staphylococcus_phage	40.8	1.8e-39
AZB47113.1|1406456_1407242_-	exotoxin	NA	A0A097PAT7	Streptococcus_pyogenes_phage	42.7	2.9e-45
AZB47114.1|1407395_1408124_-	exotoxin	NA	A0A1X9H080	Staphylococcus_phage	39.8	1.3e-28
AZB47115.1|1408158_1408878_-	exotoxin	NA	A0A1X9H080	Staphylococcus_phage	34.6	4.9e-23
AZB47116.1|1409159_1409924_-	exotoxin	NA	A0A1X9H080	Staphylococcus_phage	40.8	2.5e-33
AZB47117.1|1410579_1410780_-	hypothetical protein	NA	W5R9N2	Staphylococcus_phage	97.0	4.0e-28
AZB47118.1|1410766_1410877_-	hypothetical protein	NA	W5R8J7	Staphylococcus_phage	91.7	3.9e-09
AZB47119.1|1410947_1411100_-	hypothetical protein	NA	A0A0F6N3H2	Staphylococcus_phage	100.0	3.1e-20
AZB47120.1|1411343_1412789_-	CHAP domain-containing protein	NA	A0EWV1	Staphylococcus_virus	98.8	2.2e-293
AZB47121.1|1412769_1413207_-|holin	phage holin	holin	B2ZZ05	Staphylococcus_phage	98.6	2.0e-72
AZB47122.1|1413262_1413658_-	hypothetical protein	NA	Q4ZBP5	Staphylococcus_phage	100.0	2.7e-68
AZB47123.1|1413662_1414901_-	DUF2479 domain-containing protein	NA	A7YGX6	Staphylococcus_virus	100.0	4.2e-192
AZB47124.1|1414913_1416788_-	CHAP domain-containing protein	NA	Q4ZBX1	Staphylococcus_virus	100.0	0.0e+00
AZB47125.1|1416924_1417224_-	DUF2951 domain-containing protein	NA	A0A2I6PER2	Staphylococcus_phage	100.0	2.0e-31
AZB48541.1|1417264_1417438_-	XkdX family protein	NA	A0A059T7K6	Staphylococcus_phage	100.0	1.3e-27
AZB47126.1|1417447_1417825_-	DUF2977 domain-containing protein	NA	Q4ZAU9	Staphylococcus_virus	100.0	9.0e-61
AZB47127.1|1417824_1419648_-	DUF2479 domain-containing protein	NA	A7YGW7	Staphylococcus_virus	99.7	0.0e+00
AZB47128.1|1419647_1421546_-	hypothetical protein	NA	Q4ZBX7	Staphylococcus_virus	99.8	0.0e+00
AZB47129.1|1421558_1423445_-	peptidase	NA	Q4ZBQ3	Staphylococcus_phage	100.0	0.0e+00
AZB47130.1|1423455_1424397_-|tail	phage tail protein	tail	Q4ZBQ4	Staphylococcus_phage	100.0	5.2e-182
AZB47131.1|1424411_1427555_-|terminase	terminase	terminase	Q4ZBY3	Staphylococcus_virus	98.6	0.0e+00
AZB47132.1|1427558_1427843_-	hypothetical protein	NA	A0A0N7E0V9	Staphylococcus_phage	100.0	8.8e-45
AZB47133.1|1427887_1428394_-	hypothetical protein	NA	Q4ZBQ7	Staphylococcus_phage	100.0	2.7e-92
AZB47134.1|1428460_1429018_-|tail	phage tail protein	tail	Q4ZBQ8	Staphylococcus_phage	100.0	8.2e-103
AZB47135.1|1429018_1429444_-	DUF3168 domain-containing protein	NA	Q4ZBQ9	Staphylococcus_phage	100.0	5.5e-75
AZB47136.1|1429456_1429870_-	HK97 gp10 family phage protein	NA	A0A0N9BAY5	Staphylococcus_phage	100.0	1.1e-75
AZB47137.1|1429856_1430192_-|head,tail	phage head-tail adapter protein	head,tail	A0A0E3TAH8	Staphylococcus_phage	100.0	8.8e-60
AZB47138.1|1430203_1430554_-|head,tail	phage head-tail adapter protein	head,tail	A0A0H3U2R5	Staphylococcus_phage	100.0	1.9e-60
AZB47139.1|1430714_1431629_-|capsid	phage major capsid protein	capsid	A0A0H3U2U7	Staphylococcus_phage	100.0	1.2e-170
AZB47140.1|1431645_1432230_-	DUF4355 domain-containing protein	NA	A0A0N7E0U8	Staphylococcus_phage	100.0	1.3e-77
AZB47141.1|1432332_1432539_-	hypothetical protein	NA	A0A0N9BB04	Staphylococcus_phage	100.0	3.2e-28
AZB47142.1|1432540_1433494_-|head	phage head morphogenesis protein	head	A0A0N7E0U6	Staphylococcus_phage	99.7	6.6e-177
AZB47143.1|1433462_1434887_-|portal	phage portal protein	portal	Q4ZBZ7	Staphylococcus_virus	99.8	1.8e-271
AZB47144.1|1434883_1436107_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0N9BAX9	Staphylococcus_phage	99.8	2.2e-241
AZB47145.1|1436099_1436594_-|terminase	terminase	terminase	A0A0N9BAX3	Staphylococcus_phage	99.4	2.2e-83
AZB47146.1|1436945_1437347_-	hypothetical protein	NA	A0A2H4PQK5	Staphylococcus_phage	100.0	5.6e-69
AZB47147.1|1437347_1437521_-	transcriptional regulator	NA	A0A0H3U4U1	Staphylococcus_phage	96.5	3.7e-22
AZB47148.1|1437513_1437750_-	hypothetical protein	NA	A7TWB3	Staphylococcus_phage	100.0	1.9e-37
AZB47149.1|1437774_1438011_-	DUF1381 domain-containing protein	NA	M1T303	Staphylococcus_phage	100.0	9.6e-37
AZB47150.1|1438007_1438253_-	hypothetical protein	NA	A0A2I6PDW7	Staphylococcus_phage	100.0	5.0e-36
AZB47151.1|1438289_1438826_-	dUTPase	NA	B5WZN1	Staphylococcus_phage	100.0	5.5e-96
AZB47152.1|1438818_1439013_-	hypothetical protein	NA	M1SVE4	Staphylococcus_phage	95.1	5.9e-24
AZB47153.1|1438975_1439230_-	DUF1024 family protein	NA	A0A1W6JQ06	Staphylococcus_phage	100.0	1.9e-38
AZB47154.1|1439222_1439612_-	acetyltransferase	NA	A0A1W6JPV7	Staphylococcus_phage	100.0	3.5e-68
AZB47155.1|1439608_1439956_-	hypothetical protein	NA	A0A1W6JPZ1	Staphylococcus_phage	100.0	5.9e-59
AZB47156.1|1440019_1440262_-	hypothetical protein	NA	A0A2H4PQJ3	Staphylococcus_phage	98.8	3.3e-40
AZB47157.1|1440265_1440634_-	hypothetical protein	NA	Q9B0F5	Staphylococcus_virus	91.8	2.2e-51
AZB47158.1|1440634_1440820_-	DUF3113 family protein	NA	A0A1W6JPY2	Staphylococcus_phage	98.4	1.9e-27
AZB47159.1|1440824_1441229_-	DUF1064 domain-containing protein	NA	A7TWN5	Staphylococcus_phage	97.8	8.7e-70
AZB47160.1|1441239_1441461_-	DUF3269 family protein	NA	Q9G021	Staphylococcus_phage	98.6	8.4e-35
AZB47161.1|1441473_1441632_-	hypothetical protein	NA	A0A2I6PDX0	Staphylococcus_phage	96.2	2.9e-21
AZB47162.1|1441625_1442399_-	AAA family ATPase	NA	A0A2H4PQI3	Staphylococcus_phage	98.4	1.2e-141
AZB47163.1|1442408_1443194_-	replication protein	NA	A0A2H4PQI2	Staphylococcus_phage	96.9	7.2e-113
AZB47164.1|1443258_1444107_+	DUF4393 domain-containing protein	NA	W5R9J9	Staphylococcus_phage	96.8	2.4e-154
AZB47165.1|1444203_1444887_-	hypothetical protein	NA	R4IH15	Staphylococcus_phage	98.2	3.8e-126
AZB47166.1|1444900_1445329_-	single-stranded DNA-binding protein	NA	D2JGK2	Staphylococcus_phage	100.0	6.2e-66
AZB47167.1|1445328_1445967_-	single-stranded DNA-binding protein	NA	D2JGK1	Staphylococcus_phage	100.0	2.2e-115
AZB47168.1|1445966_1446446_-	siphovirus Gp157 family protein	NA	D2JGK0	Staphylococcus_phage	100.0	5.3e-82
AZB47169.1|1446438_1446675_-	hypothetical protein	NA	D2JGJ9	Staphylococcus_phage	100.0	2.7e-39
AZB47170.1|1446682_1446943_-	DUF1108 family protein	NA	A0A059T5A3	Staphylococcus_phage	100.0	1.2e-43
AZB47171.1|1447036_1447357_-	hypothetical protein	NA	S4V968	Staphylococcus_phage	100.0	4.8e-55
AZB47172.1|1447357_1447525_-	DUF1270 family protein	NA	S4V7J2	Staphylococcus_phage	98.2	2.1e-22
AZB47173.1|1447539_1447755_-	DUF771 domain-containing protein	NA	B7T098	Staphylococcus_virus	100.0	6.3e-35
AZB47174.1|1447805_1448024_-	hypothetical protein	NA	B5WZL5	Staphylococcus_phage	94.4	2.5e-31
AZB47175.1|1448039_1448816_-	phage antirepressor	NA	M1RZB2	Staphylococcus_phage	95.0	1.9e-137
AZB47176.1|1448872_1449082_+	hypothetical protein	NA	W5R9J5	Staphylococcus_phage	100.0	1.2e-30
AZB47177.1|1449071_1449215_-	hypothetical protein	NA	A0A2I6PDG0	Staphylococcus_phage	93.5	2.1e-15
AZB47178.1|1449248_1449479_-	XRE family transcriptional regulator	NA	A0A2K9VBT6	Staphylococcus_phage	100.0	1.6e-36
AZB47179.1|1449642_1449966_+	XRE family transcriptional regulator	NA	A0A0H3U2V8	Staphylococcus_phage	100.0	2.0e-53
AZB47180.1|1449978_1450440_+	toxin	NA	A0A2K9VBR7	Staphylococcus_phage	99.3	3.5e-83
AZB47181.1|1450623_1451328_+	hypothetical protein	NA	U5U4R0	Staphylococcus_phage	99.6	6.7e-126
AZB47182.1|1451521_1452586_+|integrase	site-specific integrase	integrase	B7T092	Staphylococcus_virus	97.5	1.5e-198
1456965:1456982	attR	TTATTTAATGCTGAAACT	NA	NA	NA	NA
>prophage 10
CP033865	Staphylococcus aureus strain FDAARGOS_504 chromosome, complete genome	2894587	1534276	1630063	2894587	terminase,integrase,tail,transposase,portal,capsid,protease,holin,tRNA,head	Staphylococcus_phage(87.34%)	117	1530718:1530739	1632355:1632376
1530718:1530739	attL	CCAACTTGCATTGTCTGTAGAA	NA	NA	NA	NA
AZB47253.1|1534276_1534579_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
AZB47254.1|1534945_1536484_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
AZB47255.1|1536572_1537772_-	CamS family sex pheromone protein	NA	NA	NA	NA	NA
AZB47256.1|1537784_1539788_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.1	9.8e-114
AZB47257.1|1539791_1541984_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.2	1.0e-135
AZB47258.1|1541980_1542673_-	geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
AZB47259.1|1542844_1543147_-	hypothetical protein	NA	NA	NA	NA	NA
AZB47260.1|1543255_1544551_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.9	1.6e-16
AZB47261.1|1545401_1546568_+|protease	cysteine protease staphopain A	protease	NA	NA	NA	NA
AZB47262.1|1546598_1546922_+	staphostatin A	NA	NA	NA	NA	NA
AZB47263.1|1547215_1547389_-	NETI motif-containing protein	NA	NA	NA	NA	NA
AZB47264.1|1547369_1547972_-	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
AZB47265.1|1548241_1549063_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.7	2.3e-69
AZB47266.1|1549055_1550525_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.5	8.5e-107
AZB47267.1|1550708_1551785_+	nitric oxide synthase oxygenase	NA	NA	NA	NA	NA
AZB47268.1|1551804_1552599_+	prephenate dehydratase	NA	NA	NA	NA	NA
AZB47269.1|1552670_1552778_+	hypothetical protein	NA	NA	NA	NA	NA
AZB47270.1|1552788_1554351_-	sodium-dependent dicarboxylate transporter SdcS	NA	NA	NA	NA	NA
AZB47271.1|1554555_1555653_-	pectate lyase	NA	U5PWM6	Bacillus_phage	34.6	8.7e-48
AZB47272.1|1556025_1556586_+	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.2	2.0e-32
AZB47273.1|1556638_1557568_+	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
AZB47274.1|1557761_1557935_-	hypothetical protein	NA	NA	NA	NA	NA
AZB47275.1|1557986_1559366_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AZB47276.1|1559485_1560514_-	hypothetical protein	NA	NA	NA	NA	NA
AZB47277.1|1560784_1561186_+	YolD-like family protein	NA	U3PG23	Staphylococcus_phage	42.9	6.0e-23
AZB47278.1|1561242_1561416_-	hypothetical protein	NA	NA	NA	NA	NA
AZB47279.1|1561866_1562907_+	linear amide C-N hydrolase	NA	NA	NA	NA	NA
AZB47280.1|1562963_1563806_-	hypothetical protein	NA	NA	NA	NA	NA
AZB47281.1|1563802_1564360_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
AZB47282.1|1564419_1564944_-	hypothetical protein	NA	NA	NA	NA	NA
AZB47283.1|1565064_1565628_+	thioredoxin family protein	NA	NA	NA	NA	NA
AZB47284.1|1565691_1566432_-	phenol-soluble modulin export ABC transporter permease subunit PmtD	NA	NA	NA	NA	NA
AZB47285.1|1566431_1567304_-	phenol-soluble modulin export ABC transporter ATP-binding protein PmtC	NA	A0A2H4PQG7	Staphylococcus_phage	35.2	6.1e-28
AZB47286.1|1567300_1567981_-	phenol-soluble modulin export ABC transporter permease subunit PmtB	NA	NA	NA	NA	NA
AZB47287.1|1567981_1568878_-	phenol-soluble modulin export ABC transporter ATP-binding protein PmtA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	1.1e-16
AZB47288.1|1568874_1569255_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AZB47289.1|1569512_1569689_-	hypothetical protein	NA	NA	NA	NA	NA
AZB47290.1|1569930_1570029_-	hypothetical protein	NA	NA	NA	NA	NA
AZB47291.1|1570228_1571515_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AZB47292.1|1571785_1573855_-	protein map	NA	NA	NA	NA	NA
AZB47293.1|1574240_1574441_+	hypothetical protein	NA	A0A1P8L6A7	Staphylococcus_phage	95.4	3.8e-26
AZB47294.1|1574812_1574992_+	hypothetical protein	NA	A0A1W6JQ29	Staphylococcus_phage	100.0	2.2e-25
AZB47295.1|1575309_1575570_+	hypothetical protein	NA	M9NS66	Staphylococcus_phage	100.0	2.3e-23
AZB47296.1|1575622_1575973_-	inhibitor	NA	A7TWS0	Staphylococcus_phage	100.0	7.5e-54
AZB47297.1|1576655_1577105_+	chemotaxis inhibitory protein	NA	A0A075LZI2	Staphylococcus_phage	100.0	8.7e-79
AZB47298.1|1578180_1578672_-	staphylokinase	NA	A0A075LYD3	Staphylococcus_phage	100.0	8.0e-86
AZB47299.1|1578862_1579618_-	CHAP domain-containing protein	NA	A0A075LZV3	Staphylococcus_phage	100.0	1.2e-152
AZB47300.1|1579629_1579884_-|holin	phage holin	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
AZB47301.1|1579935_1580043_+	hypothetical protein	NA	NA	NA	NA	NA
AZB48545.1|1580095_1580272_-|holin	putative holin-like toxin	holin	D2JLG3	Staphylococcus_phage	98.3	2.2e-22
AZB47302.1|1580474_1581203_-	exotoxin	NA	A0A075M4C7	Staphylococcus_phage	99.6	5.8e-141
AZB47303.1|1581667_1582042_-	hypothetical protein	NA	G4KNR3	Staphylococcus_phage	100.0	3.3e-39
AZB47304.1|1582097_1582385_-	hypothetical protein	NA	A0A1X9H0N7	Staphylococcus_phage	100.0	7.6e-44
AZB47305.1|1582430_1582583_-	hypothetical protein	NA	A0A1W6JPL6	Staphylococcus_phage	100.0	7.6e-19
AZB47306.1|1582575_1586358_-	hypothetical protein	NA	A0A068A201	Staphylococcus_phage	99.6	0.0e+00
AZB47307.1|1586373_1587858_-|tail	phage tail protein	tail	A0A2I6PDJ0	Staphylococcus_phage	99.6	3.8e-296
AZB47308.1|1587854_1592384_-|tail	phage tail tape measure protein	tail	A0EX03	Staphylococcus_phage	97.0	0.0e+00
AZB47309.1|1592628_1592979_-	hypothetical protein	NA	G4KNQ8	Staphylococcus_phage	100.0	7.8e-59
AZB47310.1|1593028_1593253_-	hypothetical protein	NA	A0A075LYE8	Staphylococcus_phage	100.0	3.0e-32
AZB47311.1|1593294_1593939_-|tail	phage tail protein	tail	G4KNQ7	Staphylococcus_phage	100.0	6.5e-120
AZB47312.1|1593939_1594347_-	hypothetical protein	NA	G4KNQ6	Staphylococcus_phage	100.0	7.1e-72
AZB47313.1|1594343_1594748_-	hypothetical protein	NA	G4KNQ5	Staphylococcus_phage	100.0	4.3e-69
AZB47314.1|1594744_1595107_-|head,tail	phage head-tail adapter protein	head,tail	G4KNQ4	Staphylococcus_phage	100.0	4.4e-65
AZB47315.1|1595090_1595375_-|head,tail	phage head-tail adapter protein	head,tail	A0A2I6PDJ5	Staphylococcus_phage	100.0	2.3e-45
AZB47316.1|1595364_1595649_-	hypothetical protein	NA	A0A2I6PDJ3	Staphylococcus_phage	100.0	1.8e-45
AZB47317.1|1595668_1596814_-|capsid	phage major capsid protein	capsid	G4KNQ3	Staphylococcus_phage	100.0	9.6e-215
AZB47318.1|1596837_1597575_-|protease	Clp protease ClpP	protease	G4KNQ2	Staphylococcus_phage	100.0	1.8e-129
AZB47319.1|1597558_1598746_-|portal	phage portal protein	portal	A0A2I6PDI1	Staphylococcus_phage	100.0	1.0e-219
AZB47320.1|1598761_1600423_-|terminase	terminase large subunit	terminase	A0A2I6PDJ8	Staphylococcus_phage	100.0	0.0e+00
AZB47321.1|1600419_1600764_-	hypothetical protein	NA	G4KNP9	Staphylococcus_phage	100.0	9.4e-57
AZB47322.1|1600893_1601193_-	HNH endonuclease	NA	A0A2I6PDH9	Staphylococcus_phage	100.0	3.5e-52
AZB47323.1|1601424_1601841_-	transcriptional regulator	NA	G4KNP7	Staphylococcus_phage	100.0	1.3e-76
AZB47324.1|1601868_1602069_-	DUF1514 domain-containing protein	NA	D2JLD9	Staphylococcus_phage	98.5	5.3e-28
AZB47325.1|1602068_1602218_-	transcriptional regulator	NA	A0A1W6JPZ2	Staphylococcus_phage	100.0	4.8e-18
AZB47326.1|1602214_1602421_-	DUF1381 domain-containing protein	NA	A0A2I6PEA2	Staphylococcus_phage	94.1	1.1e-17
AZB47327.1|1602417_1602663_-	hypothetical protein	NA	A0A2I6PDW7	Staphylococcus_phage	98.8	2.5e-35
AZB47328.1|1602699_1603236_-	dUTPase	NA	Q9MBR0	Staphylococcus_prophage	100.0	1.6e-95
AZB47329.1|1603232_1603478_-	DUF1024 family protein	NA	Q8SDV5	Staphylococcus_phage	95.1	1.7e-36
AZB47330.1|1603492_1603741_-	hypothetical protein	NA	A0A0K1LL46	Staphylococcus_phage	95.1	2.8e-39
AZB47331.1|1603737_1603995_-	DUF3310 domain-containing protein	NA	A0A1X9H067	Staphylococcus_phage	98.8	6.3e-42
AZB47332.1|1603994_1604366_-	hypothetical protein	NA	A0A2I6PDG3	Staphylococcus_phage	91.1	1.4e-50
AZB47333.1|1604378_1604783_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A075M042	Staphylococcus_phage	100.0	8.4e-73
AZB47334.1|1604791_1605010_-	hypothetical protein	NA	A0A1P8L6E4	Staphylococcus_phage	100.0	1.4e-37
AZB47335.1|1605016_1605910_-	DnaD domain protein	NA	A0A1P8L6F0	Staphylococcus_phage	100.0	3.2e-141
AZB47336.1|1605939_1606410_-	single-stranded DNA-binding protein	NA	A0A1P8L6D9	Staphylococcus_phage	99.4	6.3e-80
AZB47337.1|1606410_1607028_-	MBL fold metallo-hydrolase	NA	A0A1P8L6F7	Staphylococcus_phage	100.0	1.2e-86
AZB47338.1|1607108_1608029_-	recombinase	NA	A0A1P8L6F6	Staphylococcus_phage	100.0	5.1e-166
AZB47339.1|1608030_1609974_-	ATPase	NA	A0A1P8L6F1	Staphylococcus_phage	100.0	0.0e+00
AZB47340.1|1609982_1610246_-	hypothetical protein	NA	A0A2I6PDG2	Staphylococcus_phage	100.0	7.7e-43
AZB47341.1|1610254_1610515_-	DUF1108 family protein	NA	A0A1P8L6F5	Staphylococcus_phage	100.0	5.2e-44
AZB47342.1|1610519_1610822_-	DUF2482 family protein	NA	A0A1P8L6F8	Staphylococcus_phage	100.0	7.0e-48
AZB47343.1|1610916_1611078_-	DUF1270 family protein	NA	A0A1P8L6G0	Staphylococcus_phage	100.0	1.9e-20
AZB47344.1|1611074_1611398_-	DUF771 domain-containing protein	NA	A0A075LYF5	Staphylococcus_phage	100.0	3.0e-57
AZB47345.1|1611452_1611833_+	DUF2513 domain-containing protein	NA	Q9T1Z5	Staphylococcus_phage	100.0	1.2e-68
AZB47346.1|1611819_1612017_-	hypothetical protein	NA	O80075	Staphylococcus_phage	100.0	2.5e-30
AZB47347.1|1612032_1612785_-	oxidoreductase	NA	M9NTH5	Staphylococcus_phage	100.0	1.1e-139
AZB47348.1|1612835_1613165_+	hypothetical protein	NA	M9NS98	Staphylococcus_phage	98.2	5.1e-52
AZB47349.1|1613153_1613369_-	DUF2829 domain-containing protein	NA	A0A0H3U4C7	Staphylococcus_phage	100.0	4.8e-35
AZB47350.1|1613384_1613648_-	XRE family transcriptional regulator	NA	A0A2I6PF09	Staphylococcus_phage	100.0	7.2e-41
AZB47351.1|1613781_1614495_+	XRE family transcriptional regulator	NA	M9NUL0	Staphylococcus_phage	100.0	1.2e-130
AZB47352.1|1614510_1615443_+	ATP-dependent helicase	NA	A0A2I6PEZ7	Staphylococcus_phage	100.0	5.7e-173
AZB47353.1|1615448_1615790_+	hypothetical protein	NA	A0A2I6PF04	Staphylococcus_phage	100.0	4.6e-56
AZB47354.1|1615993_1616176_+	hypothetical protein	NA	A0A2I6PDF8	Staphylococcus_phage	100.0	6.9e-27
AZB47355.1|1616275_1617259_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AZB47356.1|1617269_1617512_+	hypothetical protein	NA	NA	NA	NA	NA
AZB47357.1|1617574_1618612_+|integrase	site-specific integrase	integrase	Q38086	Staphylococcus_phage	98.6	1.4e-175
AZB47358.1|1619749_1620769_-	beta-channel forming cytolysin	NA	A0A2I6PEU3	Staphylococcus_phage	39.6	3.4e-54
AZB47359.1|1620790_1621846_-	succinyl-diaminopimelate desuccinylase	NA	A0A2I6PER8	Staphylococcus_phage	34.6	7.9e-38
AZB47360.1|1622277_1623501_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
AZB47361.1|1623939_1625247_+	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
AZB47362.1|1625582_1625804_+|transposase	transposase	transposase	NA	NA	NA	NA
AZB47363.1|1625823_1626165_-	hypothetical protein	NA	C8CH40	Staphylococcus_phage	46.0	4.1e-20
AZB47364.1|1626154_1626451_-	hypothetical protein	NA	C8CH40	Staphylococcus_phage	40.4	6.7e-11
AZB47365.1|1626447_1626627_-	hypothetical protein	NA	NA	NA	NA	NA
AZB47366.1|1627168_1628785_-	molecular chaperone GroEL	NA	A0A240F779	uncultured_virus	54.7	2.6e-157
AZB47367.1|1628860_1629145_-	co-chaperone GroES	NA	A0A221S386	uncultured_virus	46.2	4.7e-14
AZB47368.1|1629319_1630063_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
1632355:1632376	attR	CCAACTTGCATTGTCTGTAGAA	NA	NA	NA	NA
