The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033924	Chryseobacterium lactis strain KC_1864 chromosome, complete genome	5618212	1014583	1075869	5618212	protease,transposase,integrase	Leuconostoc_phage(20.0%)	53	1016209:1016229	1065278:1065298
AZA81188.1|1014583_1016074_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
1016209:1016229	attL	TTCGAGCCCAGCAGGAGGAGC	NA	NA	NA	NA
AZA81189.1|1016352_1017288_+	hypothetical protein	NA	NA	NA	NA	NA
AZA81190.1|1017485_1017863_+	DNA-binding protein	NA	NA	NA	NA	NA
AZA81191.1|1017850_1019038_+	virulence-associated E family protein	NA	A0A059PAJ6	Leuconostoc_phage	29.2	1.7e-17
AZA81192.1|1019311_1020229_+	DNA primase	NA	NA	NA	NA	NA
AZA81193.1|1021849_1022434_+	hypothetical protein	NA	NA	NA	NA	NA
AZA81194.1|1022928_1023345_+	hypothetical protein	NA	NA	NA	NA	NA
AZA81195.1|1023569_1023953_+	hypothetical protein	NA	NA	NA	NA	NA
AZA81196.1|1023979_1024603_+	DUF3347 domain-containing protein	NA	NA	NA	NA	NA
AZA81197.1|1024617_1025901_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AZA81198.1|1025903_1027862_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AZA81199.1|1027880_1029128_+	TolC family protein	NA	NA	NA	NA	NA
AZA85062.1|1029241_1030375_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AZA81200.1|1030386_1031592_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AZA81201.1|1031593_1032055_+	hypothetical protein	NA	NA	NA	NA	NA
AZA81202.1|1032175_1032745_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZA81203.1|1033078_1033330_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
AZA81204.1|1033560_1033902_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
AZA81205.1|1033978_1035070_+	hypothetical protein	NA	NA	NA	NA	NA
AZA81206.1|1035149_1036181_+	type II glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AZA81207.1|1036386_1037325_+|transposase	IS1595 family transposase ISCrsp1	transposase	NA	NA	NA	NA
AZA81208.1|1037339_1038401_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
AZA81209.1|1038427_1039270_+	ATPase	NA	NA	NA	NA	NA
AZA81210.1|1039282_1040656_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AZA81211.1|1040665_1041226_+	hypothetical protein	NA	NA	NA	NA	NA
AZA85063.1|1041419_1041845_+	DUF305 domain-containing protein	NA	NA	NA	NA	NA
AZA81212.1|1041882_1044009_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	32.7	7.3e-75
AZA81213.1|1044154_1044712_+	hypothetical protein	NA	NA	NA	NA	NA
AZA81214.1|1044695_1046933_+	copper oxidase	NA	NA	NA	NA	NA
AZA81215.1|1047425_1047860_+	hypothetical protein	NA	NA	NA	NA	NA
AZA81216.1|1047893_1049045_+	hypothetical protein	NA	NA	NA	NA	NA
AZA81217.1|1050844_1052056_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AZA81218.1|1052561_1053764_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	33.6	7.6e-29
AZA81219.1|1053818_1056335_+	restriction endonuclease subunit R	NA	NA	NA	NA	NA
AZA81220.1|1056737_1057700_+	AAA family ATPase	NA	Q94MN8	Myxococcus_phage	37.0	1.5e-32
AZA81221.1|1057686_1058910_+	DUF3871 family protein	NA	NA	NA	NA	NA
AZA81222.1|1058924_1059530_-	hypothetical protein	NA	NA	NA	NA	NA
AZA81223.1|1059695_1060658_-	hypothetical protein	NA	NA	NA	NA	NA
AZA85064.1|1060654_1060879_-	hypothetical protein	NA	NA	NA	NA	NA
AZA81224.1|1061325_1061676_+	hypothetical protein	NA	NA	NA	NA	NA
AZA81225.1|1061947_1062394_+	DNA repair protein	NA	NA	NA	NA	NA
AZA81226.1|1062636_1062891_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZA81227.1|1063041_1063506_+	hypothetical protein	NA	NA	NA	NA	NA
AZA81228.1|1063539_1063926_+	hypothetical protein	NA	NA	NA	NA	NA
AZA81229.1|1063991_1064414_+	hypothetical protein	NA	NA	NA	NA	NA
AZA81230.1|1064455_1065190_+	serine/threonine protein phosphatase	NA	S0A0Y6	Cellulophaga_phage	34.7	5.1e-36
AZA81231.1|1065499_1068673_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
1065278:1065298	attR	TTCGAGCCCAGCAGGAGGAGC	NA	NA	NA	NA
AZA81232.1|1069280_1071848_+	carboxypeptidase-like regulatory domain-containing protein	NA	NA	NA	NA	NA
AZA81233.1|1072590_1072848_+	hypothetical protein	NA	NA	NA	NA	NA
AZA81234.1|1072868_1073126_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
AZA81235.1|1073138_1073717_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
AZA81236.1|1073903_1074791_+|protease	metalloprotease	protease	NA	NA	NA	NA
AZA81237.1|1074978_1075869_+|protease	metalloprotease	protease	NA	NA	NA	NA
>prophage 2
CP033924	Chryseobacterium lactis strain KC_1864 chromosome, complete genome	5618212	1978604	2024782	5618212	protease,transposase	Tupanvirus(40.0%)	40	NA	NA
AZA81964.1|1978604_1979825_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AZA81965.1|1980046_1982344_-	glycoside hydrolase family 92 protein	NA	NA	NA	NA	NA
AZA81966.1|1982470_1983352_+	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	37.4	4.7e-44
AZA85099.1|1983430_1985629_+	M1 family peptidase	NA	NA	NA	NA	NA
AZA81967.1|1985725_1986553_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
AZA81968.1|1986557_1987244_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.2	8.2e-28
AZA81969.1|1987256_1988585_-	sensor histidine kinase	NA	NA	NA	NA	NA
AZA81970.1|1988703_1989537_+	GLPGLI family protein	NA	NA	NA	NA	NA
AZA81971.1|1989713_1992083_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AZA81972.1|1992191_1994057_+	M1 family peptidase	NA	NA	NA	NA	NA
AZA81973.1|1994092_1995478_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AZA81974.1|1995613_1996612_-|protease	zinc metalloprotease	protease	A0A2K9L5D3	Tupanvirus	30.6	1.4e-20
AZA81975.1|1996962_1997973_-|protease	zinc metalloprotease	protease	A0A2K9KZL9	Tupanvirus	29.7	3.8e-21
AZA81976.1|1998219_1998861_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AZA81977.1|1998857_1999643_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AZA81978.1|1999621_2000266_-	hypothetical protein	NA	NA	NA	NA	NA
AZA81979.1|2000286_2000808_-	hypothetical protein	NA	NA	NA	NA	NA
AZA81980.1|2001314_2003909_-	ATP-dependent chaperone ClpB	NA	A0A223W0B1	Agrobacterium_phage	33.9	4.1e-120
AZA81981.1|2004268_2004847_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZA81982.1|2004833_2005544_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AZA81983.1|2005633_2006950_+	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
AZA81984.1|2006949_2008035_+	phenylacetate-CoA oxygenase	NA	NA	NA	NA	NA
AZA85100.1|2008118_2009057_+	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
AZA81985.1|2009064_2009667_+	hypothetical protein	NA	NA	NA	NA	NA
AZA81986.1|2009683_2009965_+	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
AZA81987.1|2010073_2010823_+	phenylacetate-CoA oxygenase subunit PaaI	NA	NA	NA	NA	NA
AZA81988.1|2010905_2011370_+	phenylacetate-CoA oxygenase subunit PaaJ	NA	NA	NA	NA	NA
AZA81989.1|2011468_2013301_+	hypothetical protein	NA	NA	NA	NA	NA
AZA81990.1|2013501_2014302_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AZA81991.1|2014427_2015558_+	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AZA81992.1|2015641_2015959_+	hypothetical protein	NA	NA	NA	NA	NA
AZA85101.1|2015967_2016381_+	hotdog fold thioesterase	NA	NA	NA	NA	NA
AZA81993.1|2016395_2017103_+	hypothetical protein	NA	NA	NA	NA	NA
AZA81994.1|2017162_2017861_+	hypothetical protein	NA	NA	NA	NA	NA
AZA81995.1|2017918_2019124_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
AZA81996.1|2019219_2019813_+	transferase hexapeptide repeat family protein	NA	NA	NA	NA	NA
AZA81997.1|2019907_2020486_+|transposase	transposase	transposase	NA	NA	NA	NA
AZA81998.1|2020547_2021375_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZA81999.1|2021517_2024013_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
AZA82000.1|2024155_2024782_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
CP033924	Chryseobacterium lactis strain KC_1864 chromosome, complete genome	5618212	2254372	2263247	5618212		Riemerella_phage(57.14%)	18	NA	NA
AZA82193.1|2254372_2254777_-	hypothetical protein	NA	U5U4M8	Lactobacillus_phage	40.3	2.7e-10
AZA82194.1|2254773_2255190_-	hypothetical protein	NA	NA	NA	NA	NA
AZA82195.1|2255287_2255521_-	hypothetical protein	NA	NA	NA	NA	NA
AZA82196.1|2255793_2256072_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZA82197.1|2256058_2256457_-	hypothetical protein	NA	NA	NA	NA	NA
AZA82198.1|2256550_2257267_-	hypothetical protein	NA	F5A3F0	Riemerella_phage	32.6	1.5e-27
AZA82199.1|2257289_2258198_-	hypothetical protein	NA	A0A1L2JY26	Aeribacillus_phage	59.8	1.9e-24
AZA82200.1|2258268_2258478_-	hypothetical protein	NA	NA	NA	NA	NA
AZA82201.1|2258474_2258732_-	HNH endonuclease	NA	F5A3F4	Riemerella_phage	63.1	1.2e-24
AZA82202.1|2258734_2259487_-	hypothetical protein	NA	NA	NA	NA	NA
AZA82203.1|2259483_2259672_-	hypothetical protein	NA	NA	NA	NA	NA
AZA82204.1|2259675_2259858_-	hypothetical protein	NA	NA	NA	NA	NA
AZA82205.1|2259854_2260301_-	hypothetical protein	NA	F5A3F5	Riemerella_phage	66.9	1.7e-50
AZA82206.1|2260302_2260518_-	hypothetical protein	NA	NA	NA	NA	NA
AZA82207.1|2260480_2260792_-	hypothetical protein	NA	NA	NA	NA	NA
AZA82208.1|2260793_2261666_-	hypothetical protein	NA	F5A3F6	Riemerella_phage	43.1	1.0e-54
AZA82209.1|2261655_2262090_-	hypothetical protein	NA	NA	NA	NA	NA
AZA82210.1|2262107_2263247_-	hypothetical protein	NA	A0A1P8VWA1	Flavobacterium_phage	42.3	1.5e-29
>prophage 4
CP033924	Chryseobacterium lactis strain KC_1864 chromosome, complete genome	5618212	4344825	4406747	5618212	protease,transposase,bacteriocin	Bacillus_phage(25.0%)	57	NA	NA
AZA83938.1|4344825_4346046_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AZA83939.1|4346295_4349481_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	26.0	4.3e-87
AZA83940.1|4349488_4350550_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AZA83941.1|4350556_4351924_-	TolC family protein	NA	NA	NA	NA	NA
AZA83942.1|4352016_4352610_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZA83943.1|4352863_4353688_-	RNA-binding protein	NA	NA	NA	NA	NA
AZA83944.1|4353822_4354272_+	hypothetical protein	NA	NA	NA	NA	NA
AZA83945.1|4354329_4355121_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AZA83946.1|4355165_4355747_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZA83947.1|4355949_4356789_-	DUF4476 domain-containing protein	NA	NA	NA	NA	NA
AZA83948.1|4356892_4358296_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.9	9.8e-52
AZA83949.1|4358423_4358771_-	hypothetical protein	NA	NA	NA	NA	NA
AZA83950.1|4359082_4360165_-	glycosyltransferase	NA	NA	NA	NA	NA
AZA83951.1|4360327_4362532_-	DNA helicase RecQ	NA	A0A2K9L021	Tupanvirus	39.2	3.6e-85
AZA83952.1|4362689_4363649_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.3	4.3e-35
AZA83953.1|4363659_4364223_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AZA83954.1|4364318_4365005_+	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
AZA85236.1|4365207_4366035_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
AZA83955.1|4366306_4369267_+	T9SS C-terminal target domain-containing protein	NA	NA	NA	NA	NA
AZA83956.1|4369398_4371030_+	M1 family peptidase	NA	NA	NA	NA	NA
AZA83957.1|4371166_4373023_+	peptidase M61	NA	NA	NA	NA	NA
AZA83958.1|4373074_4374241_-	sensor histidine kinase	NA	NA	NA	NA	NA
AZA83959.1|4374247_4375621_-	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
AZA83960.1|4375722_4376571_-	hypothetical protein	NA	NA	NA	NA	NA
AZA83961.1|4376570_4377263_-	dipeptidase PepE	NA	NA	NA	NA	NA
AZA83962.1|4377456_4378017_+	hypothetical protein	NA	NA	NA	NA	NA
AZA83963.1|4378139_4378628_-	DUF1905 domain-containing protein	NA	NA	NA	NA	NA
AZA83964.1|4378851_4379505_+	fructose-6-phosphate aldolase	NA	H8ZMU3	Synechococcus_phage	45.9	4.1e-45
AZA83965.1|4379585_4380143_-	sugar O-acetyltransferase	NA	A0A1V0SJ47	Klosneuvirus	33.1	1.1e-09
AZA83966.1|4380253_4381159_-	GLPGLI family protein	NA	NA	NA	NA	NA
AZA85237.1|4381215_4383111_-	hypothetical protein	NA	NA	NA	NA	NA
AZA83967.1|4383116_4383482_-	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
AZA83968.1|4383813_4384395_+	hypothetical protein	NA	NA	NA	NA	NA
AZA83969.1|4384748_4385195_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZA85238.1|4385376_4386090_+	prolyl 4-hydroxylase subunit alpha	NA	NA	NA	NA	NA
AZA83970.1|4386166_4386415_+	metal-binding protein	NA	NA	NA	NA	NA
AZA83971.1|4387213_4387825_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AZA83972.1|4387912_4388551_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AZA85239.1|4388555_4389314_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
AZA83973.1|4389314_4390163_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AZA83974.1|4390227_4390587_+	DUF4180 domain-containing protein	NA	NA	NA	NA	NA
AZA83975.1|4391167_4391743_+	hypothetical protein	NA	NA	NA	NA	NA
AZA83976.1|4391750_4393307_+	hypothetical protein	NA	NA	NA	NA	NA
AZA83977.1|4393314_4394289_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
AZA83978.1|4394332_4395118_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AZA83979.1|4395276_4396365_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZA83980.1|4396396_4397050_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AZA85240.1|4397055_4399641_-	DNA gyrase/topoisomerase IV subunit A	NA	A0A127AYR4	Bacillus_phage	39.8	2.4e-27
AZA83981.1|4399615_4400125_-	hypothetical protein	NA	NA	NA	NA	NA
AZA83982.1|4400220_4402107_-	type IIA DNA topoisomerase subunit B	NA	A0A172JHT4	Bacillus_phage	31.9	1.9e-66
AZA83983.1|4402391_4403540_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AZA83984.1|4403798_4404092_+	hypothetical protein	NA	NA	NA	NA	NA
AZA83985.1|4404205_4404970_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AZA83986.1|4405057_4405996_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZA83987.1|4406140_4406332_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
AZA83988.1|4406375_4406567_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
AZA83989.1|4406585_4406747_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 5
CP033924	Chryseobacterium lactis strain KC_1864 chromosome, complete genome	5618212	5448025	5456370	5618212		Pelagibacter_phage(16.67%)	9	NA	NA
AZA84869.1|5448025_5448820_-	NAD(+) synthase	NA	M1IPF8	Pelagibacter_phage	52.6	3.2e-60
AZA84870.1|5448831_5449362_-	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	50.3	1.0e-41
AZA84871.1|5449362_5449890_-	N-acetyltransferase	NA	G9BWD5	Planktothrix_phage	35.3	4.2e-16
AZA84872.1|5449899_5450538_-	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
AZA84873.1|5450590_5451577_+	gliding motility protein GldB	NA	NA	NA	NA	NA
AZA84874.1|5451651_5452554_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.9	7.2e-40
AZA84875.1|5452560_5454762_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	38.2	8.2e-05
AZA84876.1|5454786_5455110_+	gliding motility protein GldC	NA	NA	NA	NA	NA
AZA84877.1|5455230_5456370_+	cystathionine gamma-synthase	NA	A0A0B5JD48	Pandoravirus	33.8	9.8e-26
