The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033925	Chryseobacterium lactis strain G0197 chromosome, complete genome	5618200	139494	148369	5618200		Riemerella_phage(57.14%)	18	NA	NA
AZB02574.1|139494_139899_-	hypothetical protein	NA	U5U4M8	Lactobacillus_phage	40.3	2.7e-10
AZB02575.1|139895_140312_-	hypothetical protein	NA	NA	NA	NA	NA
AZB02576.1|140409_140643_-	hypothetical protein	NA	NA	NA	NA	NA
AZB02577.1|140915_141194_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZB02578.1|141180_141579_-	hypothetical protein	NA	NA	NA	NA	NA
AZB02579.1|141672_142389_-	hypothetical protein	NA	F5A3F0	Riemerella_phage	32.6	1.5e-27
AZB02580.1|142411_143320_-	hypothetical protein	NA	A0A1L2JY26	Aeribacillus_phage	59.8	1.9e-24
AZB02581.1|143390_143600_-	hypothetical protein	NA	NA	NA	NA	NA
AZB02582.1|143596_143854_-	HNH endonuclease	NA	F5A3F4	Riemerella_phage	63.1	1.2e-24
AZB02583.1|143856_144609_-	hypothetical protein	NA	NA	NA	NA	NA
AZB02584.1|144605_144794_-	hypothetical protein	NA	NA	NA	NA	NA
AZB02585.1|144797_144980_-	hypothetical protein	NA	NA	NA	NA	NA
AZB02586.1|144976_145423_-	hypothetical protein	NA	F5A3F5	Riemerella_phage	66.9	1.7e-50
AZB02587.1|145424_145640_-	hypothetical protein	NA	NA	NA	NA	NA
AZB02588.1|145602_145914_-	hypothetical protein	NA	NA	NA	NA	NA
AZB02589.1|145915_146788_-	hypothetical protein	NA	F5A3F6	Riemerella_phage	43.1	1.0e-54
AZB02590.1|146777_147212_-	hypothetical protein	NA	NA	NA	NA	NA
AZB02591.1|147229_148369_-	hypothetical protein	NA	A0A1P8VWA1	Flavobacterium_phage	42.3	1.5e-29
>prophage 2
CP033925	Chryseobacterium lactis strain G0197 chromosome, complete genome	5618200	2229941	2291863	5618200	protease,transposase,bacteriocin	Bacillus_phage(25.0%)	57	NA	NA
AZB04324.1|2229941_2231162_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AZB04325.1|2231411_2234597_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	26.0	4.3e-87
AZB04326.1|2234604_2235666_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AZB04327.1|2235672_2237040_-	TolC family protein	NA	NA	NA	NA	NA
AZB04328.1|2237132_2237726_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZB04329.1|2237979_2238804_-	RNA-binding protein	NA	NA	NA	NA	NA
AZB04330.1|2238938_2239388_+	hypothetical protein	NA	NA	NA	NA	NA
AZB04331.1|2239445_2240237_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AZB04332.1|2240281_2240863_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZB04333.1|2241065_2241905_-	DUF4476 domain-containing protein	NA	NA	NA	NA	NA
AZB04334.1|2242008_2243412_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.9	9.8e-52
AZB04335.1|2243539_2243887_-	hypothetical protein	NA	NA	NA	NA	NA
AZB04336.1|2244198_2245281_-	glycosyltransferase	NA	NA	NA	NA	NA
AZB04337.1|2245443_2247648_-	DNA helicase RecQ	NA	A0A2K9L021	Tupanvirus	39.2	3.6e-85
AZB04338.1|2247805_2248765_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.3	4.3e-35
AZB04339.1|2248775_2249339_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AZB04340.1|2249434_2250121_+	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
AZB07184.1|2250323_2251151_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
AZB04341.1|2251422_2254383_+	T9SS C-terminal target domain-containing protein	NA	NA	NA	NA	NA
AZB04342.1|2254514_2256146_+	M1 family peptidase	NA	NA	NA	NA	NA
AZB04343.1|2256282_2258139_+	peptidase M61	NA	NA	NA	NA	NA
AZB04344.1|2258190_2259357_-	sensor histidine kinase	NA	NA	NA	NA	NA
AZB04345.1|2259363_2260737_-	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
AZB04346.1|2260838_2261687_-	hypothetical protein	NA	NA	NA	NA	NA
AZB04347.1|2261686_2262379_-	dipeptidase PepE	NA	NA	NA	NA	NA
AZB04348.1|2262572_2263133_+	hypothetical protein	NA	NA	NA	NA	NA
AZB04349.1|2263255_2263744_-	DUF1905 domain-containing protein	NA	NA	NA	NA	NA
AZB04350.1|2263967_2264621_+	fructose-6-phosphate aldolase	NA	H8ZMU3	Synechococcus_phage	45.9	4.1e-45
AZB04351.1|2264701_2265259_-	sugar O-acetyltransferase	NA	A0A1V0SJ47	Klosneuvirus	33.1	1.1e-09
AZB04352.1|2265369_2266275_-	GLPGLI family protein	NA	NA	NA	NA	NA
AZB07185.1|2266331_2268227_-	hypothetical protein	NA	NA	NA	NA	NA
AZB04353.1|2268232_2268598_-	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
AZB04354.1|2268929_2269511_+	hypothetical protein	NA	NA	NA	NA	NA
AZB04355.1|2269864_2270311_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AZB07186.1|2270492_2271206_+	prolyl 4-hydroxylase subunit alpha	NA	NA	NA	NA	NA
AZB04356.1|2271282_2271531_+	metal-binding protein	NA	NA	NA	NA	NA
AZB04357.1|2272329_2272941_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AZB04358.1|2273028_2273667_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AZB07187.1|2273671_2274430_+	peroxide stress protein YaaA	NA	NA	NA	NA	NA
AZB04359.1|2274430_2275279_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AZB04360.1|2275343_2275703_+	DUF4180 domain-containing protein	NA	NA	NA	NA	NA
AZB04361.1|2276283_2276859_+	hypothetical protein	NA	NA	NA	NA	NA
AZB04362.1|2276866_2278423_+	hypothetical protein	NA	NA	NA	NA	NA
AZB04363.1|2278430_2279405_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
AZB04364.1|2279448_2280234_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AZB04365.1|2280392_2281481_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZB04366.1|2281512_2282166_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
AZB07188.1|2282171_2284757_-	DNA gyrase/topoisomerase IV subunit A	NA	A0A127AYR4	Bacillus_phage	39.8	2.4e-27
AZB04367.1|2284731_2285241_-	hypothetical protein	NA	NA	NA	NA	NA
AZB04368.1|2285336_2287223_-	type IIA DNA topoisomerase subunit B	NA	A0A172JHT4	Bacillus_phage	31.9	1.9e-66
AZB04369.1|2287507_2288656_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AZB04370.1|2288914_2289208_+	hypothetical protein	NA	NA	NA	NA	NA
AZB04371.1|2289321_2290086_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AZB04372.1|2290173_2291112_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AZB04373.1|2291256_2291448_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
AZB04374.1|2291491_2291683_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
AZB04375.1|2291701_2291863_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 3
CP033925	Chryseobacterium lactis strain G0197 chromosome, complete genome	5618200	3333138	3341483	5618200		Pelagibacter_phage(16.67%)	9	NA	NA
AZB05257.1|3333138_3333933_-	NAD(+) synthase	NA	M1IPF8	Pelagibacter_phage	52.6	3.2e-60
AZB05258.1|3333944_3334475_-	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	50.3	1.0e-41
AZB05259.1|3334475_3335003_-	N-acetyltransferase	NA	G9BWD5	Planktothrix_phage	35.3	4.2e-16
AZB05260.1|3335012_3335651_-	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
AZB05261.1|3335703_3336690_+	gliding motility protein GldB	NA	NA	NA	NA	NA
AZB05262.1|3336764_3337667_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.9	7.2e-40
AZB05263.1|3337673_3339875_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	38.2	8.2e-05
AZB05264.1|3339899_3340223_+	gliding motility protein GldC	NA	NA	NA	NA	NA
AZB05265.1|3340343_3341483_+	cystathionine gamma-synthase	NA	A0A0B5JD48	Pandoravirus	33.8	9.8e-26
>prophage 4
CP033925	Chryseobacterium lactis strain G0197 chromosome, complete genome	5618200	4517907	4579192	5618200	protease,integrase,transposase	Leuconostoc_phage(20.0%)	52	4519533:4519553	4568602:4568622
AZB06189.1|4517907_4519398_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
4519533:4519553	attL	TTCGAGCCCAGCAGGAGGAGC	NA	NA	NA	NA
AZB06190.1|4519676_4520612_+	hypothetical protein	NA	NA	NA	NA	NA
AZB06191.1|4520809_4521187_+	DNA-binding protein	NA	NA	NA	NA	NA
AZB06192.1|4521174_4522362_+	virulence-associated E family protein	NA	A0A059PAJ6	Leuconostoc_phage	29.2	1.7e-17
AZB06193.1|4522635_4523553_+	DNA primase	NA	NA	NA	NA	NA
AZB06194.1|4525173_4525758_+	hypothetical protein	NA	NA	NA	NA	NA
AZB06195.1|4526252_4526669_+	hypothetical protein	NA	NA	NA	NA	NA
AZB06196.1|4526893_4527277_+	hypothetical protein	NA	NA	NA	NA	NA
AZB06197.1|4527303_4527927_+	DUF3347 domain-containing protein	NA	NA	NA	NA	NA
AZB06198.1|4527941_4529225_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AZB06199.1|4529227_4531186_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
AZB06200.1|4531204_4532452_+	TolC family protein	NA	NA	NA	NA	NA
AZB07290.1|4532565_4533699_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AZB06201.1|4533710_4534916_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AZB06202.1|4534917_4535379_+	hypothetical protein	NA	NA	NA	NA	NA
AZB06203.1|4535499_4536069_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AZB06204.1|4536402_4536654_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
AZB06205.1|4536884_4537226_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
AZB06206.1|4537302_4538394_+	hypothetical protein	NA	NA	NA	NA	NA
AZB06207.1|4538473_4539505_+	type II glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
AZB06208.1|4539710_4540649_+|transposase	IS1595 family transposase ISCrsp1	transposase	NA	NA	NA	NA
AZB06209.1|4540663_4541725_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
AZB06210.1|4541751_4542594_+	ATPase	NA	NA	NA	NA	NA
AZB06211.1|4542606_4543980_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AZB06212.1|4543989_4544550_+	hypothetical protein	NA	NA	NA	NA	NA
AZB07291.1|4544743_4545169_+	DUF305 domain-containing protein	NA	NA	NA	NA	NA
AZB06213.1|4545206_4547333_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	32.7	7.3e-75
AZB06214.1|4547478_4548036_+	hypothetical protein	NA	NA	NA	NA	NA
AZB06215.1|4548019_4550257_+	copper oxidase	NA	NA	NA	NA	NA
AZB06216.1|4550749_4551184_+	hypothetical protein	NA	NA	NA	NA	NA
AZB06217.1|4551217_4552369_+	hypothetical protein	NA	NA	NA	NA	NA
AZB06218.1|4554168_4555380_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AZB06219.1|4555885_4557088_+|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	33.6	7.6e-29
AZB06220.1|4557142_4559659_+	restriction endonuclease subunit R	NA	NA	NA	NA	NA
AZB06221.1|4560061_4561024_+	AAA family ATPase	NA	Q94MN8	Myxococcus_phage	37.0	1.5e-32
AZB06222.1|4561010_4562234_+	DUF3871 family protein	NA	NA	NA	NA	NA
AZB06223.1|4562248_4562854_-	hypothetical protein	NA	NA	NA	NA	NA
AZB06224.1|4563019_4563982_-	hypothetical protein	NA	NA	NA	NA	NA
AZB07292.1|4563978_4564203_-	hypothetical protein	NA	NA	NA	NA	NA
AZB06225.1|4564649_4565000_+	hypothetical protein	NA	NA	NA	NA	NA
AZB06226.1|4565271_4565718_+	DNA repair protein	NA	NA	NA	NA	NA
AZB06227.1|4565960_4566215_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AZB06228.1|4566365_4566830_+	hypothetical protein	NA	NA	NA	NA	NA
AZB06229.1|4566863_4567250_+	hypothetical protein	NA	NA	NA	NA	NA
AZB06230.1|4567315_4567738_+	hypothetical protein	NA	NA	NA	NA	NA
AZB06231.1|4567779_4568514_+	serine/threonine protein phosphatase	NA	S0A0Y6	Cellulophaga_phage	34.7	5.1e-36
AZB06232.1|4572603_4575171_+	carboxypeptidase-like regulatory domain-containing protein	NA	NA	NA	NA	NA
4568602:4568622	attR	TTCGAGCCCAGCAGGAGGAGC	NA	NA	NA	NA
AZB06233.1|4575913_4576171_+	hypothetical protein	NA	NA	NA	NA	NA
AZB06234.1|4576191_4576449_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
AZB06235.1|4576461_4577040_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
AZB06236.1|4577226_4578114_+|protease	metalloprotease	protease	NA	NA	NA	NA
AZB06237.1|4578301_4579192_+|protease	metalloprotease	protease	NA	NA	NA	NA
>prophage 5
CP033925	Chryseobacterium lactis strain G0197 chromosome, complete genome	5618200	5481926	5528104	5618200	protease,transposase	Tupanvirus(40.0%)	40	NA	NA
AZB06962.1|5481926_5483147_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AZB06963.1|5483368_5485666_-	glycoside hydrolase family 92 protein	NA	NA	NA	NA	NA
AZB06964.1|5485792_5486674_+	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	37.4	4.7e-44
AZB07327.1|5486752_5488951_+	M1 family peptidase	NA	NA	NA	NA	NA
AZB06965.1|5489047_5489875_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
AZB06966.1|5489879_5490566_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.2	8.2e-28
AZB06967.1|5490578_5491907_-	sensor histidine kinase	NA	NA	NA	NA	NA
AZB06968.1|5492025_5492859_+	GLPGLI family protein	NA	NA	NA	NA	NA
AZB06969.1|5493035_5495405_+	TonB-dependent receptor	NA	NA	NA	NA	NA
AZB06970.1|5495513_5497379_+	M1 family peptidase	NA	NA	NA	NA	NA
AZB06971.1|5497414_5498800_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AZB06972.1|5498935_5499934_-|protease	zinc metalloprotease	protease	A0A2K9L5D3	Tupanvirus	30.6	1.4e-20
AZB06973.1|5500284_5501295_-|protease	zinc metalloprotease	protease	A0A2K9KZL9	Tupanvirus	29.7	3.8e-21
AZB06974.1|5501541_5502183_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AZB06975.1|5502179_5502965_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
AZB06976.1|5502943_5503588_-	hypothetical protein	NA	NA	NA	NA	NA
AZB06977.1|5503608_5504130_-	hypothetical protein	NA	NA	NA	NA	NA
AZB06978.1|5504636_5507231_-	ATP-dependent chaperone ClpB	NA	A0A223W0B1	Agrobacterium_phage	33.9	4.1e-120
AZB06979.1|5507590_5508169_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AZB06980.1|5508155_5508866_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AZB06981.1|5508955_5510272_+	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
AZB06982.1|5510271_5511357_+	phenylacetate-CoA oxygenase	NA	NA	NA	NA	NA
AZB07328.1|5511440_5512379_+	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
AZB06983.1|5512386_5512989_+	hypothetical protein	NA	NA	NA	NA	NA
AZB06984.1|5513005_5513287_+	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
AZB06985.1|5513395_5514145_+	phenylacetate-CoA oxygenase subunit PaaI	NA	NA	NA	NA	NA
AZB06986.1|5514227_5514692_+	phenylacetate-CoA oxygenase subunit PaaJ	NA	NA	NA	NA	NA
AZB06987.1|5514790_5516623_+	hypothetical protein	NA	NA	NA	NA	NA
AZB06988.1|5516823_5517624_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AZB06989.1|5517749_5518880_+	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
AZB06990.1|5518963_5519281_+	hypothetical protein	NA	NA	NA	NA	NA
AZB07329.1|5519289_5519703_+	hotdog fold thioesterase	NA	NA	NA	NA	NA
AZB06991.1|5519717_5520425_+	hypothetical protein	NA	NA	NA	NA	NA
AZB06992.1|5520484_5521183_+	hypothetical protein	NA	NA	NA	NA	NA
AZB06993.1|5521240_5522446_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
AZB06994.1|5522541_5523135_+	transferase hexapeptide repeat family protein	NA	NA	NA	NA	NA
AZB06995.1|5523229_5523808_+|transposase	transposase	transposase	NA	NA	NA	NA
AZB06996.1|5523869_5524697_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AZB06997.1|5524839_5527335_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
AZB06998.1|5527477_5528104_+|transposase	transposase	transposase	NA	NA	NA	NA
