The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033835	Pseudomonas aeruginosa strain FDAARGOS_570 chromosome, complete genome	7119105	239028	316661	7119105	portal,protease,head,integrase,holin,capsid,terminase	Pseudomonas_phage(60.98%)	82	245881:245897	292839:292855
AYZ81573.1|239028_239967_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
AYZ81574.1|240039_240924_+	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
AYZ81575.1|240974_241940_+	L-carnitine dehydrogenase	NA	NA	NA	NA	NA
AYZ81576.1|241990_242470_+	thioesterase	NA	NA	NA	NA	NA
AYZ81577.1|242475_243441_+	alpha/beta hydrolase	NA	A0A0G2Y6Q1	Acanthamoeba_polyphaga_mimivirus	33.3	1.5e-19
AYZ81578.1|243414_244482_-	YeiH family protein	NA	NA	NA	NA	NA
AYZ81579.1|244589_245483_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYZ81580.1|245622_246000_+	hypothetical protein	NA	NA	NA	NA	NA
245881:245897	attL	CGCGCCCAGGCGCTGCG	NA	NA	NA	NA
AYZ81581.1|246046_247150_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
AYZ81582.1|247569_248946_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AYZ81583.1|249409_250348_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
AYZ81584.1|250389_251229_+|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
AYZ81585.1|251232_252411_+|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	35.1	1.9e-24
AYZ81586.1|252628_254179_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.5	5.8e-21
AYZ81587.1|254433_254550_-	transcriptional regulator	NA	NA	NA	NA	NA
AYZ81588.1|254511_255105_+	transcriptional regulator	NA	NA	NA	NA	NA
AYZ81589.1|255165_256638_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AYZ81590.1|256773_258459_+|holin	oxygen-dependent choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	7.8e-56
AYZ81591.1|258504_258909_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
AYZ81592.1|259196_260513_+	MFS transporter	NA	NA	NA	NA	NA
AYZ81593.1|266638_267610_+	phosphate-binding protein	NA	NA	NA	NA	NA
AYZ87826.1|268032_270066_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
AYZ81594.1|270085_271762_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
AYZ81595.1|271777_272611_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.8	3.8e-11
AYZ81596.1|272706_273435_+	phosphate-specific transport system accessory protein PhoU	NA	NA	NA	NA	NA
AYZ81597.1|273553_274456_+	response regulator	NA	NA	NA	NA	NA
AYZ81598.1|274571_275471_+	DUF4124 domain-containing protein	NA	U5PY92	Bacillus_phage	38.4	3.5e-10
AYZ81599.1|275505_276846_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
AYZ81600.1|276948_278280_-	PAS domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	33.5	2.2e-29
AYZ81601.1|278352_279042_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	39.5	9.7e-37
AYZ81602.1|279146_279602_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ81603.1|279625_280516_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
AYZ81604.1|280542_281079_-	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
AYZ81605.1|281158_281914_-	transcriptional regulator GlcC	NA	NA	NA	NA	NA
AYZ81606.1|282118_283618_+	glycolate oxidase subunit GlcD	NA	NA	NA	NA	NA
AYZ81607.1|283617_284697_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
AYZ81608.1|284706_285933_+	glycolate oxidase iron-sulfur subunit	NA	NA	NA	NA	NA
AYZ81609.1|285937_286339_+	heme-binding protein	NA	NA	NA	NA	NA
AYZ81610.1|286472_286640_+	Rubredoxin-1	NA	NA	NA	NA	NA
AYZ81611.1|286823_286991_+	Rubredoxin-2	NA	NA	NA	NA	NA
AYZ81612.1|287042_288197_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AYZ81613.1|288193_288406_+	rubredoxin reductase	NA	NA	NA	NA	NA
AYZ81614.1|288398_288671_+	DNA-binding protein HU-alpha	NA	B5TA87	Burkholderia_phage	51.1	3.1e-15
AYZ87827.1|288783_289833_-|integrase	integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	55.1	8.5e-101
AYZ81615.1|289832_290075_-	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	60.3	8.7e-17
AYZ87828.1|290058_290415_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ81616.1|290419_291109_-	hypothetical protein	NA	A0A0A0YUE3	Pseudomonas_phage	97.4	1.0e-123
AYZ81617.1|291105_291297_-	hypothetical protein	NA	A0A0A0YQ21	Pseudomonas_phage	100.0	9.2e-30
AYZ81618.1|291415_292123_-	hypothetical protein	NA	A0A0A0YUE9	Pseudomonas_phage	96.0	1.2e-45
AYZ81619.1|292119_292455_-	hypothetical protein	NA	A0A1W6JTA6	Pseudomonas_phage	89.2	1.3e-47
AYZ81620.1|292457_292688_-	Arc family DNA-binding protein	NA	A0A1W6JTB4	Pseudomonas_phage	92.1	5.3e-32
AYZ81621.1|292729_293566_-	prohibitin family protein	NA	A0A0A0YRT7	Pseudomonas_phage	100.0	1.0e-128
292839:292855	attR	CGCAGCGCCTGGGCGCG	NA	NA	NA	NA
AYZ81622.1|293562_293817_-	hypothetical protein	NA	A0A0A0YUF2	Pseudomonas_phage	100.0	3.8e-39
AYZ81623.1|293916_294150_-	hypothetical protein	NA	A0A0A0YQ28	Pseudomonas_phage	100.0	6.6e-38
AYZ81624.1|294152_294539_-	helix-turn-helix transcriptional regulator	NA	A0A0A0YWH0	Pseudomonas_phage	96.8	2.7e-60
AYZ81625.1|294993_295500_-	nuclease	NA	NA	NA	NA	NA
AYZ81626.1|295500_296241_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ87829.1|296344_296800_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	71.3	2.0e-59
AYZ81627.1|298152_298398_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ81628.1|298412_298685_+	hypothetical protein	NA	A0A1W6JTC3	Pseudomonas_phage	88.0	7.4e-33
AYZ81629.1|298987_299266_+	hypothetical protein	NA	A0A0A0YR77	Pseudomonas_phage	80.4	1.4e-31
AYZ81630.1|299258_299492_+	hypothetical protein	NA	A0A0A0YRU7	Pseudomonas_phage	96.1	4.9e-33
AYZ81631.1|299488_300253_+	hypothetical protein	NA	A0A1W6JTB2	Pseudomonas_phage	98.0	5.9e-136
AYZ81632.1|300249_300480_+	hypothetical protein	NA	A0A1W6JTF8	Pseudomonas_phage	97.4	2.6e-39
AYZ81633.1|300476_301316_+	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	93.2	3.1e-146
AYZ81634.1|301491_302112_+	AAA family ATPase	NA	A0A1W6JTD8	Pseudomonas_phage	99.5	2.9e-109
AYZ81635.1|302108_303506_+	replicative DNA helicase	NA	A0A1W6JTB3	Pseudomonas_phage	98.9	8.0e-264
AYZ81636.1|303502_303781_+	hypothetical protein	NA	A0A1W6JTC1	Pseudomonas_phage	98.9	1.5e-44
AYZ81637.1|303777_304167_+	antitermination protein Q	NA	A0A1W6JTD2	Pseudomonas_phage	99.2	2.2e-70
AYZ87830.1|305934_306459_+	Rha protein	NA	A0A0P0ZFJ1	Escherichia_phage	42.1	1.4e-27
AYZ81638.1|306543_306876_+|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	95.5	5.5e-54
AYZ81639.1|306872_307490_+	glycoside hydrolase family 19 protein	NA	A0A0U4JP23	Pseudomonas_phage	90.6	8.2e-104
AYZ81640.1|307495_307786_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ81641.1|308462_309209_+	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	46.7	1.5e-43
AYZ81642.1|309374_309641_-	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
AYZ81643.1|309874_310420_+	DNA-packaging protein	NA	A0A1W6JT69	Pseudomonas_phage	68.3	4.8e-63
AYZ81644.1|310391_312332_+|terminase	phage terminase large subunit family protein	terminase	A0A1B0Z2K0	Pseudomonas_phage	54.7	1.8e-213
AYZ81645.1|312347_312572_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ81646.1|312571_314047_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	70.4	7.3e-199
AYZ81647.1|314043_315240_+|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	60.6	6.5e-121
AYZ81648.1|315239_315599_+|head	head decoration protein	head	A0A2H4JF15	uncultured_Caudovirales_phage	52.3	4.4e-17
AYZ81649.1|315665_316661_+|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	69.9	5.7e-131
>prophage 2
CP033835	Pseudomonas aeruginosa strain FDAARGOS_570 chromosome, complete genome	7119105	546871	554175	7119105	capsid	Pseudomonas_phage(50.0%)	9	NA	NA
AYZ81850.1|546871_547381_+	hypothetical protein	NA	A0A1B0VP73	Pseudomonas_phage	56.5	8.5e-14
AYZ81851.1|547377_547605_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ87843.1|547745_547988_+	DNA-binding protein	NA	NA	NA	NA	NA
AYZ81852.1|548052_548619_+	hypothetical protein	NA	Q775A9	Bordetella_phage	60.0	2.0e-08
AYZ81853.1|548615_549626_+	DNA primase	NA	A0A088F8A2	Idiomarinaceae_phage	39.1	2.3e-26
AYZ81854.1|549622_551410_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	54.0	4.0e-167
AYZ81855.1|551501_551795_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ81856.1|552622_552895_-	transcriptional regulator	NA	U3PB63	Vibrio_phage	38.8	8.0e-11
AYZ81857.1|553149_554175_+|capsid	phage major capsid protein, P2 family	capsid	A0A0U4K5I9	Pseudomonas_phage	80.3	3.2e-153
>prophage 3
CP033835	Pseudomonas aeruginosa strain FDAARGOS_570 chromosome, complete genome	7119105	1518388	1593706	7119105	portal,tail,protease,lysis,head,integrase,tRNA,capsid,terminase	Pseudomonas_phage(73.91%)	86	1550468:1550488	1577822:1577842
AYZ87870.1|1518388_1519867_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
AYZ82712.1|1519940_1521395_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
AYZ82713.1|1521407_1521698_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
AYZ82714.1|1521937_1522975_+	rod shape-determining protein	NA	NA	NA	NA	NA
AYZ82715.1|1523006_1524047_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
AYZ82716.1|1524046_1524541_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
AYZ82717.1|1524630_1525236_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
AYZ82718.1|1525269_1526727_+	ribonuclease G	NA	NA	NA	NA	NA
AYZ87871.1|1526741_1530572_+	TIGR02099 family protein	NA	NA	NA	NA	NA
AYZ82719.1|1530621_1531470_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AYZ82720.1|1531472_1532915_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AYZ82721.1|1532945_1533548_-	ribosome-associated protein	NA	NA	NA	NA	NA
AYZ82722.1|1533568_1534918_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
AYZ82723.1|1535065_1535461_+	FagA protein	NA	NA	NA	NA	NA
AYZ82724.1|1535453_1536830_+	class II fumarate hydratase	NA	NA	NA	NA	NA
AYZ82725.1|1536857_1537307_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ82726.1|1537319_1537931_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	72.3	9.7e-81
AYZ82727.1|1537949_1538882_+	ZIP family metal transporter	NA	NA	NA	NA	NA
AYZ82728.1|1539424_1539607_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0U4KLG1	Pseudomonas_phage	100.0	3.7e-28
AYZ82729.1|1539634_1540039_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0U4ISP5	Pseudomonas_phage	100.0	4.2e-72
AYZ82730.1|1540081_1541053_-	hypothetical protein	NA	A0A0U4IBV2	Pseudomonas_phage	100.0	1.4e-182
AYZ82731.1|1541037_1541736_-	hypothetical protein	NA	A0A1D9CA29	Salinivibrio_phage	36.9	9.5e-40
AYZ82732.1|1541735_1542275_-	DNA-binding protein	NA	A0A0U4J942	Pseudomonas_phage	100.0	8.0e-95
AYZ82733.1|1542271_1543192_-	hypothetical protein	NA	A5X9J6	Aeromonas_virus	34.2	2.3e-17
AYZ82734.1|1543188_1543899_-|tail	phage tail protein	tail	A0A0U4JEJ6	Pseudomonas_phage	100.0	4.7e-135
AYZ82735.1|1543912_1545877_-|tail	phage tail protein	tail	A0A0U4K5K2	Pseudomonas_phage	100.0	0.0e+00
AYZ82736.1|1545888_1546413_-|tail	phage tail protein	tail	A0A0U4JVX3	Pseudomonas_phage	100.0	5.7e-98
AYZ82737.1|1546405_1547578_-	hypothetical protein	NA	A0A0U4JJ14	Pseudomonas_phage	100.0	1.5e-223
AYZ82738.1|1547574_1547895_-	DUF2590 family protein	NA	A0A0U4B0N5	Pseudomonas_phage	100.0	4.2e-51
AYZ82739.1|1547891_1549946_-|tail	phage tail tape measure protein	tail	A0A0U4IJ81	Pseudomonas_phage	100.0	0.0e+00
AYZ82740.1|1550124_1550412_-	hypothetical protein	NA	A0A0U4B0P2	Pseudomonas_phage	100.0	2.0e-44
AYZ82741.1|1550408_1550894_-|lysis	lysis protein	lysis	A0A0U4JXC2	Pseudomonas_phage	100.0	4.2e-79
1550468:1550488	attL	CCTGCAGGGCCAGCACCATGC	NA	NA	NA	NA
AYZ82742.1|1550890_1551352_-	lysozyme	NA	A0A0U4JP67	Pseudomonas_phage	100.0	1.4e-79
AYZ82743.1|1551348_1551654_-	hypothetical protein	NA	A0A0H5AUD7	Pseudomonas_phage	40.4	7.6e-10
AYZ82744.1|1551653_1551863_-	TraR/DksA family transcriptional regulator	NA	A0A0U4IIN4	Pseudomonas_phage	100.0	5.2e-34
AYZ82745.1|1551862_1552312_-	DUF2597 family protein	NA	A0A0U3TH58	Pseudomonas_phage	100.0	8.7e-79
AYZ82746.1|1552315_1553431_-	DUF2586 family protein	NA	A0A0U4KLE6	Pseudomonas_phage	100.0	5.0e-208
AYZ82747.1|1553442_1554108_-	virion morphogenesis protein	NA	A0A0U4ISN1	Pseudomonas_phage	100.0	2.7e-121
AYZ82748.1|1554100_1554538_-|tail	phage tail protein	tail	A0A0U4IBS7	Pseudomonas_phage	100.0	8.5e-79
AYZ82749.1|1554539_1555001_-|head	head completion/stabilization protein	head	A0A0U4J933	Pseudomonas_phage	96.7	2.0e-78
AYZ82750.1|1555098_1555836_-|terminase	terminase	terminase	A0A0U4JEJ1	Pseudomonas_phage	89.8	2.0e-117
AYZ82751.1|1555832_1556855_-|capsid	phage major capsid protein, P2 family	capsid	A0A0U4K5I9	Pseudomonas_phage	100.0	1.1e-193
AYZ82752.1|1556854_1558000_-|capsid	capsid scaffolding protein	capsid	A0A0U4JVV6	Pseudomonas_phage	100.0	4.3e-146
AYZ82753.1|1557965_1560014_+|terminase	terminase	terminase	A0A0U4JIZ9	Pseudomonas_phage	99.6	0.0e+00
AYZ82754.1|1559853_1560780_+|portal	phage portal protein	portal	A0A0U4B0L9	Pseudomonas_phage	98.7	9.1e-131
AYZ82755.1|1560824_1561082_+	transcriptional regulator	NA	R9TNQ2	Vibrio_phage	42.9	3.6e-13
AYZ82756.1|1561647_1561926_-	hypothetical protein	NA	A0A0U4B0R1	Pseudomonas_phage	98.9	1.6e-46
AYZ82757.1|1561922_1562153_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ82758.1|1562149_1562395_-	Arc family DNA-binding protein	NA	A0A0U4B0M9	Pseudomonas_phage	100.0	1.0e-36
AYZ82759.1|1562387_1562654_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ82760.1|1562723_1563083_-	hypothetical protein	NA	A0A0U4JXA4	Pseudomonas_phage	99.2	1.0e-61
AYZ82761.1|1563112_1563460_-	hypothetical protein	NA	A0A0U4JP55	Pseudomonas_phage	96.5	6.5e-58
AYZ82762.1|1563474_1563876_-	hypothetical protein	NA	A0A0U4IIM6	Pseudomonas_phage	94.7	2.5e-69
AYZ82763.1|1564313_1567004_-	hypothetical protein	NA	A0A0U3TH43	Pseudomonas_phage	86.1	0.0e+00
AYZ82764.1|1567014_1567245_-	hypothetical protein	NA	A0A0U4KLD7	Pseudomonas_phage	78.9	6.3e-25
AYZ82765.1|1567351_1567603_+	XRE family transcriptional regulator	NA	A0A0U4ISL7	Pseudomonas_phage	83.5	4.4e-32
AYZ82766.1|1567599_1568151_+	WYL domain-containing protein	NA	NA	NA	NA	NA
AYZ82767.1|1568155_1569271_+|integrase	integrase	integrase	A0A0U4IBS1	Pseudomonas_phage	60.2	1.1e-119
AYZ82768.1|1569301_1569574_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
AYZ82769.1|1569603_1570464_-	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	31.9	1.0e-06
AYZ82770.1|1570465_1570930_-	nitrogen regulatory protein	NA	NA	NA	NA	NA
AYZ82771.1|1570943_1571252_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AYZ82772.1|1571329_1572823_-	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
AYZ82773.1|1573048_1573774_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.5	1.1e-22
AYZ82774.1|1573773_1574301_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
AYZ82775.1|1574287_1574860_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AYZ82776.1|1574868_1575408_-	HAD family hydrolase	NA	A0A140XBD6	Dickeya_phage	52.3	3.4e-29
AYZ82777.1|1575407_1576382_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	32.5	2.6e-35
AYZ82778.1|1576801_1577611_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	8.5e-24
AYZ82779.1|1577610_1578408_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
1577822:1577842	attR	GCATGGTGCTGGCCCTGCAGG	NA	NA	NA	NA
AYZ82780.1|1578408_1578882_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
AYZ82781.1|1578893_1579541_+	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
AYZ82782.1|1579537_1579846_+	STAS domain-containing protein	NA	NA	NA	NA	NA
AYZ82783.1|1579962_1580202_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
AYZ82784.1|1580222_1581488_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AYZ82785.1|1581505_1582141_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
AYZ82786.1|1582266_1583589_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
AYZ82787.1|1583591_1584647_+	histidinol-phosphate aminotransferase 1	NA	A0A1X6WGT4	Pacmanvirus	26.0	6.7e-21
AYZ82788.1|1584689_1585859_-	PDZ domain-containing protein	NA	W5SAB9	Pithovirus	28.9	3.2e-08
AYZ82789.1|1585975_1586734_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
AYZ82790.1|1586720_1587824_-	murein transglycosylase B	NA	NA	NA	NA	NA
AYZ82791.1|1588167_1589085_+	sulfate adenylyltransferase subunit 2	NA	NA	NA	NA	NA
AYZ82792.1|1589096_1590998_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	26.1	5.2e-32
AYZ82793.1|1591071_1591518_-	DUF1043 family protein	NA	NA	NA	NA	NA
AYZ82794.1|1591662_1592292_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYZ82795.1|1592359_1593706_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 4
CP033835	Pseudomonas aeruginosa strain FDAARGOS_570 chromosome, complete genome	7119105	1836311	1881219	7119105	portal,tail,plate,coat,lysis,head,integrase,holin,capsid,terminase	Pseudomonas_virus(67.31%)	64	1835398:1835426	1845177:1845205
1835398:1835426	attL	TCTGGAGCGGGCGAAGGGAATCGAACCCT	NA	NA	NA	NA
AYZ82996.1|1836311_1836734_-	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	39.6	3.4e-08
AYZ82997.1|1836834_1837050_+	DNA-binding protein	NA	NA	NA	NA	NA
AYZ82998.1|1837051_1837264_+	hypothetical protein	NA	Q56VP8	Pseudomonas_phage	95.7	4.4e-33
AYZ82999.1|1837267_1837558_+	hypothetical protein	NA	Q56VP7	Pseudomonas_phage	95.8	2.1e-54
AYZ83000.1|1837561_1837939_+	hypothetical protein	NA	Q56VP6	Pseudomonas_phage	96.8	1.2e-60
AYZ83001.1|1838073_1838508_+	DNA-binding protein	NA	Q56VP5	Pseudomonas_phage	98.6	3.2e-62
AYZ83002.1|1838524_1838617_+	hypothetical protein	NA	Q56VP4	Pseudomonas_phage	96.7	2.8e-08
AYZ83003.1|1838629_1838881_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ83004.1|1838893_1839142_+|coat	phage coat protein B	coat	Q56VP2	Pseudomonas_phage	92.7	2.0e-32
AYZ83005.1|1839293_1840616_+	attachment protein	NA	Q56VP1	Pseudomonas_phage	58.7	3.1e-55
AYZ83006.1|1840620_1840977_+	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	100.0	7.9e-59
AYZ83007.1|1840980_1842255_+	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	88.2	5.1e-201
AYZ83008.1|1842484_1843777_+	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	93.5	1.5e-245
AYZ83009.1|1843776_1844763_+|integrase	integrase	integrase	Q56VN7	Pseudomonas_phage	52.8	1.2e-93
AYZ83010.1|1845390_1846593_+	DUF4102 domain-containing protein	NA	A0A248SL35	Klebsiella_phage	30.9	2.2e-36
1845177:1845205	attR	TCTGGAGCGGGCGAAGGGAATCGAACCCT	NA	NA	NA	NA
AYZ83011.1|1846599_1846803_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AYZ83012.1|1846795_1846999_-	hypothetical protein	NA	A0A2H4J958	uncultured_Caudovirales_phage	50.0	5.6e-09
AYZ83013.1|1846991_1847234_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ83014.1|1847221_1848079_-	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	65.2	8.2e-102
AYZ83015.1|1848075_1848261_-	hypothetical protein	NA	Q38017	Pseudomonas_virus	73.5	4.4e-05
AYZ83016.1|1848262_1850173_-	DNA cytosine methyltransferase	NA	A0A0U1T6D1	Pseudomonas_phage	86.7	3.4e-257
AYZ83017.1|1850165_1850417_-	hypothetical protein	NA	Q9ZXI5	Pseudomonas_virus	91.6	5.6e-35
AYZ83018.1|1850476_1850683_-	TraR/DksA family transcriptional regulator	NA	Q9ZXI6	Pseudomonas_virus	95.6	4.0e-31
AYZ83019.1|1850694_1851423_-	hypothetical protein	NA	X5IGG9	Pseudomonas_phage	32.9	3.9e-28
AYZ83020.1|1851486_1851870_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ83021.1|1851923_1852706_-	hypothetical protein	NA	Q9ZXI8	Pseudomonas_virus	31.1	4.8e-24
AYZ83022.1|1852750_1855471_-	bifunctional DNA primase/helicase	NA	Q9ZXI8	Pseudomonas_virus	99.4	0.0e+00
AYZ83023.1|1855467_1855701_-	hypothetical protein	NA	Q9ZXI9	Pseudomonas_virus	100.0	7.8e-39
AYZ83024.1|1855771_1856122_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ83025.1|1856118_1856412_-	transcriptional regulator	NA	Q9ZXJ1	Pseudomonas_virus	99.0	1.1e-50
AYZ83026.1|1856414_1856606_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ83027.1|1856637_1856823_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ87881.1|1856830_1857304_-	hypothetical protein	NA	Q9ZXJ2	Pseudomonas_virus	69.5	3.3e-52
AYZ83028.1|1857333_1857564_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ87882.1|1857679_1858069_+	transcriptional regulator	NA	NA	NA	NA	NA
AYZ83029.1|1858103_1858979_-	hypothetical protein	NA	A0A0M3LR56	Mannheimia_phage	39.7	4.9e-25
AYZ83030.1|1858998_1859400_-	transcriptional regulator	NA	NA	NA	NA	NA
AYZ83031.1|1859408_1859693_-	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
AYZ83032.1|1859766_1861041_-	phage late control D family protein	NA	Q9ZXJ8	Pseudomonas_virus	97.2	2.1e-234
AYZ83033.1|1861037_1861478_-|tail	phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	100.0	6.1e-77
AYZ83034.1|1861483_1864243_-|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	89.6	0.0e+00
AYZ83035.1|1864232_1864352_-|tail	GpE family phage tail protein	tail	Q9ZXK1	Pseudomonas_virus	97.4	4.0e-15
AYZ83036.1|1864360_1864699_-|tail	phage tail assembly protein	tail	Q9ZXK2	Pseudomonas_virus	84.3	1.7e-39
AYZ83037.1|1864752_1865268_-|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	94.2	2.8e-89
AYZ83038.1|1865324_1866500_-|tail	phage tail sheath protein	tail	Q9ZXK4	Pseudomonas_virus	98.0	7.3e-218
AYZ83039.1|1866590_1867052_-|tail	phage tail protein	tail	Q9ZXK5	Pseudomonas_virus	63.2	1.7e-45
AYZ83040.1|1867051_1869481_-|tail	phage tail protein	tail	Q9ZXK6	Pseudomonas_virus	61.1	2.1e-259
AYZ83041.1|1869482_1870019_-|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	100.0	1.4e-99
AYZ83042.1|1870018_1870933_-|plate	baseplate assembly protein	plate	Q9ZXK8	Pseudomonas_virus	99.0	2.1e-164
AYZ83043.1|1870929_1871274_-|plate	baseplate assembly protein	plate	Q9ZXK9	Pseudomonas_virus	97.4	4.6e-56
AYZ83044.1|1871270_1871843_-|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	98.9	3.6e-93
AYZ83045.1|1871912_1872371_-	phage virion morphogenesis protein	NA	Q9ZXL2	Pseudomonas_virus	89.3	1.7e-66
AYZ83046.1|1872363_1872900_-|tail	phage tail protein	tail	Q9ZXL3	Pseudomonas_virus	98.9	7.9e-95
AYZ83047.1|1872977_1873439_-|lysis	LysB family phage lysis regulatory protein	lysis	Q9ZXL5	Pseudomonas_virus	98.0	1.1e-71
AYZ83048.1|1873435_1874242_-	DUF3380 domain-containing protein	NA	Q9ZXL6	Pseudomonas_virus	98.9	7.6e-150
AYZ83049.1|1874238_1874511_-|holin	phage holin family protein	holin	Q9ZXL7	Pseudomonas_virus	98.9	1.2e-38
AYZ83050.1|1874512_1874866_-	hypothetical protein	NA	Q9ZXL8	Pseudomonas_virus	100.0	6.0e-59
AYZ83051.1|1874890_1875103_-|tail	phage tail protein	tail	Q9ZXL9	Pseudomonas_virus	92.6	1.1e-31
AYZ83052.1|1875102_1875564_-|head	head completion/stabilization protein	head	Q9ZXM1	Pseudomonas_virus	96.7	6.8e-79
AYZ83053.1|1875667_1876369_-|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	99.1	4.8e-124
AYZ83054.1|1876374_1877391_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	98.5	9.5e-190
AYZ83055.1|1877426_1878248_-|capsid	GPO family capsid scaffolding protein	capsid	Q9ZXM4	Pseudomonas_virus	99.6	3.4e-129
AYZ87883.1|1878403_1880164_+|terminase	terminase	terminase	Q9ZXM5	Pseudomonas_virus	99.8	0.0e+00
AYZ83056.1|1880163_1881219_+|portal	phage portal protein	portal	Q9ZXM6	Pseudomonas_virus	96.3	2.0e-195
>prophage 5
CP033835	Pseudomonas aeruginosa strain FDAARGOS_570 chromosome, complete genome	7119105	1983835	2030392	7119105	portal,tail,protease,lysis,holin,integrase,terminase	Pseudomonas_phage(91.23%)	66	1986912:1986940	2027276:2027304
AYZ83152.1|1983835_1984537_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	47.6	6.6e-49
AYZ83153.1|1984533_1985052_-	Rhs element Vgr protein	NA	NA	NA	NA	NA
AYZ83154.1|1985225_1985561_-	TM2 domain-containing protein	NA	A0A240F358	Aeromonas_phage	41.7	5.6e-06
AYZ83155.1|1985803_1986442_-	hypothetical protein	NA	NA	NA	NA	NA
1986912:1986940	attL	GTTTGGTGGAGCCGGGGGGATTTGAACCC	NA	NA	NA	NA
AYZ83156.1|1987002_1987416_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ83157.1|1987425_1987869_-	DUF4065 domain-containing protein	NA	I6R0L8	Salmonella_phage	56.8	4.3e-46
AYZ83158.1|1987935_1989114_-|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	96.3	8.7e-211
AYZ83159.1|1988993_1989269_-	excisionase	NA	NA	NA	NA	NA
AYZ83160.1|1989256_1989601_-	hypothetical protein	NA	A0A1W6JT94	Pseudomonas_phage	97.2	3.2e-57
AYZ83161.1|1989578_1990298_-	hypothetical protein	NA	A0A1W6JTE0	Pseudomonas_phage	92.1	1.1e-120
AYZ83162.1|1990294_1990486_-	hypothetical protein	NA	A0A0A0YQ21	Pseudomonas_phage	100.0	2.7e-29
AYZ83163.1|1990598_1991126_-	hypothetical protein	NA	A0A0A0YRT2	Pseudomonas_phage	98.0	1.2e-50
AYZ83164.1|1991939_1992275_-	hypothetical protein	NA	A0A1W6JTA6	Pseudomonas_phage	90.1	2.7e-48
AYZ83165.1|1992277_1992508_-	Arc family DNA-binding protein	NA	A0A1W6JTB4	Pseudomonas_phage	92.1	2.2e-30
AYZ83166.1|1992605_1992839_-	hypothetical protein	NA	A0A0A0YQ28	Pseudomonas_phage	96.1	2.1e-36
AYZ83167.1|1992841_1993231_-	helix-turn-helix transcriptional regulator	NA	A0A0A0YWH0	Pseudomonas_phage	100.0	3.6e-65
AYZ83168.1|1993351_1994200_-	XRE family transcriptional regulator	NA	A0A0A0YR73	Pseudomonas_phage	100.0	6.1e-158
AYZ83169.1|1994644_1994983_+	hypothetical protein	NA	A0A1W6JTA4	Pseudomonas_phage	99.1	5.6e-54
AYZ83170.1|1995324_1995675_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ83171.1|1995671_1995950_+	hypothetical protein	NA	A0A1W6JTC3	Pseudomonas_phage	97.8	4.9e-40
AYZ83172.1|1995946_1996255_+	hypothetical protein	NA	A0A0A0YWH5	Pseudomonas_phage	98.0	4.2e-48
AYZ87887.1|1996338_1996530_+	hypothetical protein	NA	A0A0A0YR77	Pseudomonas_phage	74.2	1.3e-15
AYZ83173.1|1996522_1996756_+	hypothetical protein	NA	A0A0A0YRU7	Pseudomonas_phage	97.4	9.8e-34
AYZ87888.1|1996881_1997244_+	hypothetical protein	NA	A0A0A0YUG0	Pseudomonas_phage	100.0	1.9e-63
AYZ83174.1|1997240_1998005_+	hypothetical protein	NA	A0A0A0YQ39	Pseudomonas_phage	35.6	3.0e-23
AYZ83175.1|1998001_1998358_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ83176.1|1998492_1998807_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ83177.1|1999858_2001670_+	bifunctional DNA primase/helicase	NA	A0A0U4B0G9	Pseudomonas_phage	70.4	2.2e-261
AYZ83178.1|2001666_2001945_+	hypothetical protein	NA	A0A1W6JTC1	Pseudomonas_phage	100.0	2.3e-45
AYZ83179.1|2001941_2002331_+	antitermination protein Q	NA	A0A1W6JTD2	Pseudomonas_phage	100.0	1.3e-70
AYZ83180.1|2002698_2003397_+	Rha protein	NA	S5MQL6	Escherichia_phage	61.2	4.1e-27
AYZ83181.1|2003481_2003814_+|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	96.4	1.9e-54
AYZ83182.1|2003810_2004428_+	glycoside hydrolase family 19 protein	NA	A0A1W6JTC9	Pseudomonas_phage	93.6	3.6e-107
AYZ83183.1|2004424_2004667_+	hypothetical protein	NA	A0A0H5AWC3	Pseudomonas_phage	51.9	3.2e-19
AYZ83184.1|2004663_2005134_+|lysis	lysis protein	lysis	A0A1B0Z001	Pseudomonas_phage	93.6	2.6e-73
AYZ83185.1|2005130_2005874_+	hypothetical protein	NA	A0A1W6JTE1	Pseudomonas_phage	99.2	1.9e-134
AYZ83186.1|2006025_2006571_+	DNA-packaging protein	NA	A0A1W6JT69	Pseudomonas_phage	100.0	3.1e-94
AYZ83187.1|2006542_2008522_+|terminase	phage terminase large subunit family protein	terminase	A0A1W6JT68	Pseudomonas_phage	99.1	0.0e+00
AYZ83188.1|2008512_2008728_+	primosomal replication protein PriB/PriC domain protein	NA	A0A1B0YZU1	Pseudomonas_phage	98.6	1.9e-31
AYZ83189.1|2008727_2010374_+|portal	phage portal protein	portal	A0A0A0YUB7	Pseudomonas_phage	99.5	0.0e+00
AYZ83190.1|2010333_2012427_+|protease	Clp protease ClpP	protease	A0A1B0YZU0	Pseudomonas_phage	98.6	0.0e+00
AYZ83191.1|2012493_2012811_+	DUF2190 family protein	NA	A0A1W6JT93	Pseudomonas_phage	100.0	4.6e-50
AYZ83192.1|2012807_2013137_+	hypothetical protein	NA	A0A1W6JT71	Pseudomonas_phage	100.0	3.1e-57
AYZ83193.1|2013133_2013604_+	hypothetical protein	NA	A0A1W6JT75	Pseudomonas_phage	98.7	1.2e-86
AYZ83194.1|2013607_2013802_+	hypothetical protein	NA	A0A1W6JT79	Pseudomonas_phage	98.4	1.5e-27
AYZ83195.1|2013803_2014556_+	hypothetical protein	NA	A0A1B0YZT8	Pseudomonas_phage	98.8	2.6e-136
AYZ87889.1|2014637_2015159_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	A0A1B0YZT9	Pseudomonas_phage	99.4	1.8e-91
AYZ83196.1|2015230_2015758_+	DUF4124 domain-containing protein	NA	A0A1B0Z2K9	Pseudomonas_phage	98.9	4.3e-93
AYZ83197.1|2015822_2016125_+	hypothetical protein	NA	A0A1B0YZV7	Pseudomonas_phage	99.0	7.0e-48
AYZ83198.1|2016227_2018711_+|tail	tail length tape measure protein	tail	A0A1B0YZV6	Pseudomonas_phage	98.7	0.0e+00
AYZ83199.1|2018750_2019272_+	hypothetical protein	NA	A0A1W6JT98	Pseudomonas_phage	100.0	3.3e-98
AYZ83200.1|2019271_2020969_+	hypothetical protein	NA	A0A1W6JTA3	Pseudomonas_phage	98.4	0.0e+00
AYZ83201.1|2020971_2021382_+	hypothetical protein	NA	A0A1B0YZV0	Pseudomonas_phage	87.4	6.5e-57
AYZ83202.1|2021381_2021927_+	hypothetical protein	NA	A0A1B0YZV4	Pseudomonas_phage	96.1	5.0e-97
AYZ83203.1|2021937_2022342_+	hypothetical protein	NA	A0A0A0YR47	Pseudomonas_phage	98.5	3.4e-66
AYZ83204.1|2022338_2023997_+	hypothetical protein	NA	A0A0A0YRR5	Pseudomonas_phage	97.4	0.0e+00
AYZ83205.1|2024026_2024614_+	hypothetical protein	NA	A0A1B0Z051	Pseudomonas_phage	93.8	6.6e-103
AYZ83206.1|2024606_2024798_+	hypothetical protein	NA	A0A1B0Z2L3	Pseudomonas_phage	96.8	7.8e-29
AYZ83207.1|2024802_2025363_+	hypothetical protein	NA	A0A1B0YZW5	Pseudomonas_phage	98.4	3.2e-99
AYZ83208.1|2025362_2025644_+	hypothetical protein	NA	A0A0A0YR51	Pseudomonas_phage	96.8	2.5e-44
AYZ87890.1|2026220_2026523_+	hypothetical protein	NA	A0A0S2SY61	Pseudomonas_phage	97.0	1.4e-48
AYZ83209.1|2026519_2026759_+	hypothetical protein	NA	A0A0A0YQ17	Pseudomonas_phage	88.3	3.6e-31
AYZ83210.1|2026831_2027056_+	hypothetical protein	NA	A0A1W6JT95	Pseudomonas_phage	98.6	4.7e-33
AYZ83211.1|2027692_2028571_-	hypothetical protein	NA	NA	NA	NA	NA
2027276:2027304	attR	GTTTGGTGGAGCCGGGGGGATTTGAACCC	NA	NA	NA	NA
AYZ83212.1|2028658_2029342_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AYZ83213.1|2029450_2030392_+	alpha/beta hydrolase	NA	A0A1D8EUH4	Mycobacterium_phage	33.3	4.4e-08
>prophage 6
CP033835	Pseudomonas aeruginosa strain FDAARGOS_570 chromosome, complete genome	7119105	2323712	2384704	7119105	terminase,tail,holin,integrase	Pseudomonas_phage(78.48%)	86	2309277:2309336	2383309:2383372
2309277:2309336	attL	ACGGATTCGAAATCCGTTGAGTCAGCAATGGCTCCTAGGGTTCAAATCCCTATCTCTCCG	NA	NA	NA	NA
AYZ83488.1|2323712_2323862_+|integrase	integrase	integrase	W6MYA3	Pseudomonas_phage	95.7	3.7e-18
AYZ83489.1|2323858_2324104_-	hypothetical protein	NA	W6MVE5	Pseudomonas_phage	97.5	6.7e-41
AYZ83490.1|2324207_2324549_-	hypothetical protein	NA	B5WZV0	Pseudomonas_phage	62.5	7.4e-14
AYZ83491.1|2324545_2324854_-	hypothetical protein	NA	A0A125RNP7	Pseudomonas_phage	68.3	6.7e-30
AYZ83492.1|2324850_2325150_-	hypothetical protein	NA	A0A125RNP8	Pseudomonas_phage	55.8	2.8e-33
AYZ83493.1|2325787_2326069_-	hypothetical protein	NA	H2BDE3	Pseudomonas_virus	65.6	4.4e-28
AYZ83494.1|2326071_2326557_-	hypothetical protein	NA	H2BDE5	Pseudomonas_virus	99.4	1.2e-89
AYZ83495.1|2327151_2327604_-	hypothetical protein	NA	A0A0A1IVN5	Pseudomonas_phage	52.7	8.9e-23
AYZ83496.1|2329291_2329495_-	hypothetical protein	NA	D4FUM3	Pseudomonas_phage	100.0	1.0e-31
AYZ83497.1|2329531_2329870_-	hypothetical protein	NA	A0A125RNR1	Pseudomonas_phage	100.0	2.7e-56
AYZ83498.1|2329866_2330493_-	exonuclease	NA	A0A125RNR2	Pseudomonas_phage	100.0	6.4e-120
AYZ87903.1|2330496_2331117_-	single-stranded DNA-binding protein	NA	A0A125RNR3	Pseudomonas_phage	100.0	1.8e-106
AYZ83499.1|2331257_2332322_-	hypothetical protein	NA	A0A0S2SYC7	Pseudomonas_phage	98.0	1.7e-72
AYZ83500.1|2332363_2332552_-	hypothetical protein	NA	H2BDF9	Pseudomonas_virus	95.2	2.4e-30
AYZ83501.1|2332564_2332777_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ83502.1|2333057_2333273_-	hypothetical protein	NA	H2BDF4	Pseudomonas_virus	54.9	1.4e-13
AYZ83503.1|2333269_2333482_-	hypothetical protein	NA	A0A2H4J1K8	uncultured_Caudovirales_phage	50.8	9.0e-10
AYZ83504.1|2333588_2333954_-	hypothetical protein	NA	B5WZX0	Pseudomonas_phage	90.9	5.1e-61
AYZ83505.1|2333950_2334154_-	hypothetical protein	NA	B5WZX1	Pseudomonas_phage	86.6	1.0e-26
AYZ83506.1|2334445_2334760_-	hypothetical protein	NA	U6C867	Ralstonia_phage	47.1	7.6e-13
AYZ83507.1|2334776_2335016_-	DUF551 domain-containing protein	NA	A0A0S2SY95	Pseudomonas_phage	37.9	1.2e-05
AYZ83508.1|2335308_2335953_-	hypothetical protein	NA	A0A0U4IID7	Pseudomonas_phage	93.9	2.2e-115
AYZ83509.1|2336065_2337307_-	hypothetical protein	NA	A0A0U4B0I3	Pseudomonas_phage	81.6	1.6e-69
AYZ83510.1|2337409_2337616_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ83511.1|2337703_2338225_-	HNH endonuclease	NA	V5YTE7	Pseudomonas_phage	43.0	2.5e-29
AYZ83512.1|2338816_2339491_-	helix-turn-helix transcriptional regulator	NA	A0A125RNS6	Pseudomonas_phage	100.0	2.2e-126
AYZ83513.1|2339578_2339800_+	transcriptional regulator	NA	A0A125RNS7	Pseudomonas_phage	100.0	5.8e-36
AYZ83514.1|2339801_2340113_+	transcriptional regulator	NA	H6WRX6	Salmonella_phage	50.6	3.0e-14
AYZ83515.1|2340303_2341293_+	phage replication protein	NA	H2BDH8	Pseudomonas_virus	97.9	1.3e-175
AYZ83516.1|2341289_2342630_+	replicative DNA helicase	NA	A0A0S2SYB4	Pseudomonas_phage	99.8	1.3e-250
AYZ83517.1|2342629_2343316_+	hypothetical protein	NA	A0A0S2SYE7	Pseudomonas_phage	100.0	5.1e-131
AYZ83518.1|2343428_2343938_+	hypothetical protein	NA	H2BDI1	Pseudomonas_virus	97.0	3.2e-85
AYZ83519.1|2343939_2344152_+	TraR/DksA family transcriptional regulator	NA	H2BDI2	Pseudomonas_virus	82.9	1.5e-25
AYZ83520.1|2344141_2344774_+	hypothetical protein	NA	Q9MC50	Pseudomonas_phage	99.5	1.8e-122
AYZ83521.1|2344766_2345354_+	DUF1367 family protein	NA	Q9MC49	Pseudomonas_phage	99.0	3.6e-109
AYZ83522.1|2345350_2345620_+	hypothetical protein	NA	A0A0S2SYB2	Pseudomonas_phage	45.5	2.5e-09
AYZ83523.1|2345780_2346419_+	hypothetical protein	NA	A0A0S2SY91	Pseudomonas_phage	98.6	4.5e-113
AYZ83524.1|2346415_2347102_+	hypothetical protein	NA	A0A0S2SYA9	Pseudomonas_phage	100.0	2.1e-132
AYZ83525.1|2347846_2348050_+	hypothetical protein	NA	A0A0S2SY93	Pseudomonas_phage	100.0	1.0e-26
AYZ83526.1|2348410_2348815_+	hypothetical protein	NA	Q9MC43	Pseudomonas_phage	95.5	1.2e-66
AYZ83527.1|2348807_2349092_+|holin	phage holin family protein	holin	A0A0U4J8T9	Pseudomonas_phage	100.0	5.0e-48
AYZ83528.1|2349091_2349325_+	hypothetical protein	NA	A0A0U4JED1	Pseudomonas_phage	90.9	3.7e-33
AYZ83529.1|2349324_2349522_+	hypothetical protein	NA	A0A0S2SYN9	Pseudomonas_phage	100.0	1.4e-33
AYZ83530.1|2349629_2350016_-	hypothetical protein	NA	A0A0S2SYH9	Pseudomonas_phage	100.0	2.8e-65
AYZ83531.1|2350070_2350277_-	hypothetical protein	NA	A0A0S2SYV3	Pseudomonas_phage	100.0	5.4e-28
AYZ83532.1|2350361_2350958_+	hypothetical protein	NA	A0A0S2SYA5	Pseudomonas_phage	100.0	1.9e-113
AYZ83533.1|2350990_2351467_+	DUF2280 domain-containing protein	NA	A0A0S2SY97	Pseudomonas_phage	100.0	2.3e-82
AYZ83534.1|2351441_2352761_+|terminase	terminase	terminase	A0A0S2SYF1	Pseudomonas_phage	100.0	1.5e-264
AYZ83535.1|2352765_2354154_+	DUF4055 domain-containing protein	NA	A0A0S2SYJ5	Pseudomonas_phage	100.0	2.6e-270
AYZ83536.1|2354150_2355230_+	hypothetical protein	NA	A0A0S2SY77	Pseudomonas_phage	100.0	5.5e-204
AYZ83537.1|2355346_2356132_+	hypothetical protein	NA	A0A0S2SY92	Pseudomonas_phage	100.0	1.7e-114
AYZ83538.1|2356236_2357217_+	hypothetical protein	NA	A0A0S2SYD2	Pseudomonas_phage	99.7	1.2e-178
AYZ83539.1|2357735_2357999_+	hypothetical protein	NA	A0A0S2SY74	Pseudomonas_phage	100.0	3.2e-41
AYZ83540.1|2357995_2358379_+	hypothetical protein	NA	A0A0S2SYB7	Pseudomonas_phage	100.0	3.9e-64
AYZ83541.1|2358382_2358733_+	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	100.0	4.1e-60
AYZ83542.1|2358735_2359410_+	hypothetical protein	NA	A0A0S2SY81	Pseudomonas_phage	98.7	5.8e-119
AYZ83543.1|2359406_2359817_+	hypothetical protein	NA	A0A1B0VMI0	Pseudomonas_phage	43.4	1.9e-24
AYZ83544.1|2359884_2360538_+|tail	phage tail protein	tail	A0A2H4IZV5	uncultured_Caudovirales_phage	52.8	1.3e-59
AYZ83545.1|2360547_2360928_+	hypothetical protein	NA	A0A2H4IYQ5	uncultured_Caudovirales_phage	51.2	7.0e-29
AYZ83546.1|2360990_2361254_+	hypothetical protein	NA	A0A2R3UAE2	Siphoviridae_environmental_samples	46.0	1.4e-15
AYZ83547.1|2361250_2364439_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	41.3	1.6e-158
AYZ83548.1|2364440_2364719_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ83549.1|2364721_2365060_+|tail	phage tail protein	tail	A0A0S2SYI2	Pseudomonas_phage	99.1	1.0e-60
AYZ83550.1|2365056_2365806_+|tail	phage minor tail protein L	tail	A0A0S2SY57	Pseudomonas_phage	100.0	1.0e-148
AYZ83551.1|2365808_2366558_+|tail	phage tail protein	tail	A0A0S2SY75	Pseudomonas_phage	100.0	4.1e-150
AYZ83552.1|2366724_2366928_-	hypothetical protein	NA	A0A0S2SY70	Pseudomonas_phage	100.0	2.0e-30
AYZ87904.1|2367633_2367882_+	hypothetical protein	NA	A0A0S2SYE8	Pseudomonas_phage	97.6	9.1e-38
AYZ83553.1|2367865_2368096_-	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	46.9	5.0e-14
AYZ83554.1|2368152_2368566_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
AYZ83555.1|2368694_2368850_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
AYZ87905.1|2368923_2369865_+	ORF6N domain-containing protein	NA	Q8VNP5	Enterobacteria_phage	60.3	3.7e-31
AYZ83556.1|2371238_2371841_+|tail	tail assembly protein	tail	A0A0S2SYS2	Pseudomonas_phage	79.3	1.5e-78
AYZ83557.1|2372423_2373041_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ83558.1|2373182_2376749_+	DUF1983 domain-containing protein	NA	A0A0S2SYC5	Pseudomonas_phage	88.7	0.0e+00
AYZ83559.1|2377728_2378520_+	hypothetical protein	NA	A0A0S2SY45	Pseudomonas_phage	99.6	1.7e-141
AYZ83560.1|2378519_2378822_+	hypothetical protein	NA	A0A0S2SY61	Pseudomonas_phage	100.0	1.5e-50
AYZ83561.1|2378818_2379058_+	hypothetical protein	NA	A0A0S2SY98	Pseudomonas_phage	97.5	1.4e-35
AYZ83562.1|2379191_2380052_-	hypothetical protein	NA	A0A0S2SY56	Pseudomonas_phage	100.0	1.4e-165
AYZ83563.1|2380327_2380762_+	hypothetical protein	NA	A0A0S2SY43	Pseudomonas_phage	100.0	3.9e-68
AYZ83564.1|2381091_2381526_+	lysozyme	NA	A0A0S2SYD0	Pseudomonas_phage	100.0	5.1e-76
AYZ83565.1|2381522_2381891_+	hypothetical protein	NA	A0A0S2SY58	Pseudomonas_phage	96.7	5.5e-55
AYZ83566.1|2381911_2382154_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
AYZ83567.1|2382154_2382472_-	hypothetical protein	NA	A0A0S2SY86	Pseudomonas_phage	100.0	1.6e-55
AYZ83568.1|2382610_2382883_+	hypothetical protein	NA	A0A0S2SYC6	Pseudomonas_phage	94.4	1.8e-39
AYZ83569.1|2382918_2383182_+	hypothetical protein	NA	J7I447	Pseudomonas_phage	94.3	1.3e-42
AYZ83570.1|2383711_2384704_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	34.0	1.1e-09
2383309:2383372	attR	ACGGATTCGAAATCCGTTGAGTCAGCAATGGCTCCTAGGGTTCAAATCCCTATCTCTCCGCCAT	NA	NA	NA	NA
>prophage 7
CP033835	Pseudomonas aeruginosa strain FDAARGOS_570 chromosome, complete genome	7119105	3208690	3259510	7119105	protease,head,integrase,tRNA,terminase	Pseudomonas_phage(77.78%)	65	3216043:3216102	3265939:3265999
AYZ87938.1|3208690_3210022_-|protease	membrane protease subunit, stomatin/prohibitin	protease	A0A0F6WCV7	Sinorhizobium_phage	28.1	6.9e-39
AYZ84334.1|3210155_3210878_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
AYZ84335.1|3210882_3211380_-	peptidyl-prolyl cis-trans isomerase	NA	A0A076FI46	Aureococcus_anophage	32.9	1.4e-13
AYZ84336.1|3211502_3213173_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	60.3	4.8e-199
AYZ84337.1|3213182_3214565_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	31.6	6.9e-42
AYZ84338.1|3214622_3215477_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	33.9	6.6e-27
3216043:3216102	attL	GGATTTAGGTTCCAGCGCCGCAAGGCGTGAGAGTTCGAGTCTCTCCGTCCGCACCACCTT	NA	NA	NA	NA
AYZ84339.1|3216107_3217217_-|integrase	site-specific integrase	integrase	Q9T1P3	Pseudomonas_phage	99.2	6.7e-213
AYZ84340.1|3217102_3217444_-	DNA-binding protein	NA	Q9MC86	Pseudomonas_phage	99.0	2.7e-48
AYZ84341.1|3217591_3217933_-	hypothetical protein	NA	B5WZV0	Pseudomonas_phage	62.5	7.4e-14
AYZ84342.1|3217929_3218238_-	hypothetical protein	NA	A0A125RNP7	Pseudomonas_phage	68.3	6.7e-30
AYZ84343.1|3218234_3218534_-	hypothetical protein	NA	A0A125RNP8	Pseudomonas_phage	55.8	2.8e-33
AYZ84344.1|3219171_3219453_-	hypothetical protein	NA	H2BDE3	Pseudomonas_virus	65.6	4.4e-28
AYZ84345.1|3219455_3219941_-	hypothetical protein	NA	H2BDE5	Pseudomonas_virus	99.4	1.2e-89
AYZ84346.1|3220535_3220988_-	hypothetical protein	NA	A0A0A1IVN5	Pseudomonas_phage	52.7	8.9e-23
AYZ84347.1|3222675_3222879_-	hypothetical protein	NA	D4FUM3	Pseudomonas_phage	100.0	1.0e-31
AYZ84348.1|3222915_3223254_-	hypothetical protein	NA	A0A125RNR1	Pseudomonas_phage	100.0	2.7e-56
AYZ84349.1|3223250_3223877_-	exonuclease	NA	A0A125RNR2	Pseudomonas_phage	100.0	6.4e-120
AYZ87939.1|3223880_3224501_-	single-stranded DNA-binding protein	NA	A0A125RNR3	Pseudomonas_phage	100.0	1.8e-106
AYZ84350.1|3224641_3225706_-	hypothetical protein	NA	Q9MC69	Pseudomonas_phage	93.5	7.6e-81
AYZ84351.1|3226012_3226198_-	hypothetical protein	NA	A0A0S2SY66	Pseudomonas_phage	100.0	7.3e-24
AYZ84352.1|3226304_3226670_-	hypothetical protein	NA	W6MYA8	Pseudomonas_phage	96.7	5.8e-65
AYZ84353.1|3226961_3227276_-	hypothetical protein	NA	U6C867	Ralstonia_phage	47.1	7.6e-13
AYZ84354.1|3227292_3227532_-	DUF551 domain-containing protein	NA	A0A0S2SY95	Pseudomonas_phage	37.9	1.2e-05
AYZ84355.1|3227824_3228469_-	hypothetical protein	NA	A0A0U4IID7	Pseudomonas_phage	93.9	2.2e-115
AYZ84356.1|3228581_3229607_-	hypothetical protein	NA	A0A0U4B0I3	Pseudomonas_phage	98.2	4.0e-79
AYZ84357.1|3229905_3230112_-	hypothetical protein	NA	A0A0U4ISE6	Pseudomonas_phage	98.5	5.6e-33
AYZ84358.1|3230122_3230329_-	hypothetical protein	NA	A0A0U4IBH8	Pseudomonas_phage	97.1	3.4e-30
AYZ84359.1|3231038_3231527_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ84360.1|3231574_3232240_-	helix-turn-helix transcriptional regulator	NA	H2BDH4	Pseudomonas_virus	40.2	1.8e-43
AYZ84361.1|3232329_3232527_+	hypothetical protein	NA	A0A1B0Z2M2	Pseudomonas_phage	86.2	1.6e-24
AYZ84362.1|3232529_3232841_+	transcriptional regulator	NA	H6WRX6	Salmonella_phage	49.4	6.8e-14
AYZ84363.1|3233031_3234021_+	phage replication protein	NA	Q9MC55	Pseudomonas_phage	99.4	6.2e-178
AYZ84364.1|3234017_3235358_+	replicative DNA helicase	NA	Q9MC54	Pseudomonas_phage	98.4	1.9e-246
AYZ84365.1|3235357_3236044_+	hypothetical protein	NA	A0A0S2SYE7	Pseudomonas_phage	93.9	8.0e-124
AYZ84366.1|3236156_3236666_+	hypothetical protein	NA	H2BDI1	Pseudomonas_virus	97.0	3.2e-85
AYZ84367.1|3236667_3236880_+	TraR/DksA family transcriptional regulator	NA	H2BDI2	Pseudomonas_virus	82.9	1.5e-25
AYZ84368.1|3236869_3237502_+	hypothetical protein	NA	Q9MC50	Pseudomonas_phage	99.5	1.8e-122
AYZ84369.1|3237494_3238082_+	DUF1367 family protein	NA	Q9MC49	Pseudomonas_phage	99.0	3.6e-109
AYZ84370.1|3238078_3238348_+	hypothetical protein	NA	A0A0S2SYB2	Pseudomonas_phage	45.5	2.5e-09
AYZ84371.1|3238508_3239147_+	hypothetical protein	NA	A0A0S2SY91	Pseudomonas_phage	97.6	5.0e-112
AYZ84372.1|3239146_3239464_+	hypothetical protein	NA	Q9MC45	Pseudomonas_phage	93.3	6.8e-46
AYZ84373.1|3239531_3240110_+	hypothetical protein	NA	Q9MC44	Pseudomonas_phage	97.4	8.5e-103
AYZ84374.1|3241109_3241442_+	peptidase M48, Ste24p	NA	A0A125RNL3	Pseudomonas_phage	100.0	2.6e-56
AYZ84375.1|3241444_3241717_+	hypothetical protein	NA	A0A125RNL4	Pseudomonas_phage	97.8	3.1e-39
AYZ84376.1|3241707_3242292_+|terminase	terminase small subunit	terminase	A0A2P9HY59	Yersinia_phage	67.0	1.8e-60
AYZ84377.1|3242281_3243745_+	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	84.2	2.4e-242
AYZ84378.1|3243744_3243942_+	aldehyde dehydrogenase	NA	H2BD77	Pseudomonas_phage	100.0	2.3e-28
AYZ84379.1|3243944_3245315_+	DUF1073 domain-containing protein	NA	H2BD78	Pseudomonas_phage	98.5	1.7e-263
AYZ84380.1|3245271_3246201_+|head	phage head morphogenesis protein	head	H2BD79	Pseudomonas_phage	99.0	2.6e-170
AYZ84381.1|3246204_3247482_+	hypothetical protein	NA	A0A125RNM1	Pseudomonas_phage	99.1	1.2e-213
AYZ84382.1|3247485_3247935_+	hypothetical protein	NA	A0A125RNM2	Pseudomonas_phage	100.0	5.6e-78
AYZ84383.1|3247950_3249042_+	hypothetical protein	NA	H2BD82	Pseudomonas_phage	90.7	5.6e-188
AYZ84384.1|3249052_3249511_+	hypothetical protein	NA	A0A125RNM4	Pseudomonas_phage	71.7	1.2e-48
AYZ84385.1|3249593_3249836_+	hypothetical protein	NA	A0A125RNM5	Pseudomonas_phage	96.2	3.1e-38
AYZ84386.1|3249822_3250224_+	hypothetical protein	NA	J7HX89	Pseudomonas_phage	98.5	7.8e-71
AYZ84387.1|3250220_3250559_+	hypothetical protein	NA	A0A125RNM7	Pseudomonas_phage	99.1	8.0e-61
AYZ84388.1|3250560_3250965_+	hypothetical protein	NA	J7I0Q5	Pseudomonas_phage	97.8	5.3e-67
AYZ84389.1|3250961_3251336_+	hypothetical protein	NA	J7I407	Pseudomonas_phage	96.0	2.0e-65
AYZ84390.1|3251350_3252346_+	Ig domain-containing protein	NA	H2BD89	Pseudomonas_phage	94.3	1.9e-163
AYZ84391.1|3252342_3252960_+	glycoprotein	NA	A0A125RNN1	Pseudomonas_phage	99.0	7.4e-113
AYZ84392.1|3252959_3255458_+	hypothetical protein	NA	J7HXG0	Pseudomonas_phage	97.7	0.0e+00
AYZ84393.1|3255454_3255922_+	hypothetical protein	NA	H2BD92	Pseudomonas_phage	99.4	1.4e-92
AYZ84394.1|3255905_3256397_+	DUF1833 domain-containing protein	NA	J7I404	Pseudomonas_phage	96.3	3.0e-88
AYZ84395.1|3256401_3256809_+	hypothetical protein	NA	J7HX80	Pseudomonas_phage	94.1	7.9e-71
AYZ84396.1|3256780_3259510_+	hypothetical protein	NA	A0A127KNI3	Pseudomonas_phage	98.2	0.0e+00
3265939:3265999	attR	GGATTTAGGTTCCAGCGCCGCAAGGCGTGAGAGTTCGAGTCTCTCCGTCCGCACCACCTTC	NA	NA	NA	NA
>prophage 8
CP033835	Pseudomonas aeruginosa strain FDAARGOS_570 chromosome, complete genome	7119105	3263519	3270069	7119105		Pseudomonas_phage(83.33%)	9	NA	NA
AYZ84397.1|3263519_3264149_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	95.2	1.0e-109
AYZ84398.1|3264145_3264514_+	hypothetical protein	NA	A0A0S2SY58	Pseudomonas_phage	94.3	2.7e-54
AYZ84399.1|3264534_3264777_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
AYZ84400.1|3264777_3265095_-	hypothetical protein	NA	A0A0S2SY86	Pseudomonas_phage	100.0	1.6e-55
AYZ84401.1|3265233_3265509_+	hypothetical protein	NA	A0A0S2SYC6	Pseudomonas_phage	100.0	2.1e-43
AYZ84402.1|3265544_3265808_+	hypothetical protein	NA	J7I447	Pseudomonas_phage	98.9	2.2e-45
AYZ84403.1|3266325_3266547_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ84404.1|3266833_3268678_-	class A beta-lactamase-related serine hydrolase	NA	NA	NA	NA	NA
AYZ84405.1|3268782_3270069_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	26.0	6.1e-16
>prophage 9
CP033835	Pseudomonas aeruginosa strain FDAARGOS_570 chromosome, complete genome	7119105	3515966	3548118	7119105	terminase	Pseudomonas_phage(87.18%)	39	NA	NA
AYZ84611.1|3515966_3516251_-	Pyocin activator protein PrtN	NA	A0A2K8HN48	Pseudomonas_phage	100.0	8.0e-46
AYZ84612.1|3516326_3516713_-	hypothetical protein	NA	A0A2K8HZQ6	Pseudomonas_phage	99.2	1.4e-64
AYZ87947.1|3516824_3517997_-	hypothetical protein	NA	A0A0U1UNM2	Pseudomonas_phage	77.0	5.1e-203
AYZ84613.1|3518106_3519873_-	DEAD/DEAH box helicase	NA	A0A0U1UNQ7	Pseudomonas_phage	99.8	0.0e+00
AYZ84614.1|3519869_3520250_-	hypothetical protein	NA	A0A2K8HNT1	Pseudomonas_phage	100.0	9.3e-66
AYZ84615.1|3520246_3520570_-	DUF4406 domain-containing protein	NA	A0A2K8I958	Pseudomonas_phage	99.1	1.0e-57
AYZ87949.1|3520566_3521061_-	DUF550 domain-containing protein	NA	H2BD43	Pseudomonas_phage	91.5	4.3e-87
AYZ84616.1|3521210_3521654_-	hypothetical protein	NA	A0A2K8HVL6	Pseudomonas_phage	98.0	1.5e-78
AYZ87948.1|3521650_3523567_-	DNA cytosine methyltransferase	NA	A0A0U1T6D1	Pseudomonas_phage	92.9	3.6e-275
AYZ84617.1|3523582_3525013_-	phosphoadenosine phosphosulfate reductase	NA	R9TRT5	Rhizobium_phage	72.3	1.1e-175
AYZ84618.1|3525173_3525383_-	hypothetical protein	NA	A0A0U1UNR9	Pseudomonas_phage	97.1	1.2e-30
AYZ84619.1|3525379_3526600_-	recombination-associated protein RdgC	NA	L7TP07	Pseudomonas_virus	98.0	1.5e-162
AYZ84620.1|3526626_3527124_-	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	99.4	2.2e-91
AYZ84621.1|3527127_3527733_-	3'-5' exonuclease	NA	A0A0U1W072	Pseudomonas_phage	100.0	7.3e-113
AYZ84622.1|3527862_3528879_-	DUF1351 domain-containing protein	NA	A0A0U1UNR0	Pseudomonas_phage	98.8	5.5e-121
AYZ84623.1|3528883_3529639_-	hypothetical protein	NA	A0A0U1UNQ9	Pseudomonas_phage	100.0	5.3e-145
AYZ84624.1|3529900_3530272_-	hypothetical protein	NA	A0A2K8HNX4	Pseudomonas_phage	98.4	9.7e-60
AYZ84625.1|3530268_3530490_-	hypothetical protein	NA	A0A2K8I9C2	Pseudomonas_phage	97.3	9.3e-34
AYZ84626.1|3530747_3531119_-	carbon storage regulator	NA	A0A0U1UNS3	Pseudomonas_phage	100.0	2.7e-62
AYZ84627.1|3531153_3531366_-	hypothetical protein	NA	A0A0U1VYM8	Pseudomonas_phage	94.3	7.1e-31
AYZ84628.1|3533059_3533299_+	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	54.1	3.2e-11
AYZ84629.1|3533336_3534305_+	hypothetical protein	NA	A0A0U1UNR4	Pseudomonas_phage	99.4	1.3e-84
AYZ84630.1|3534291_3535149_+	hypothetical protein	NA	A0A2K8HNW6	Pseudomonas_phage	99.6	8.4e-147
AYZ84631.1|3535141_3535693_+	hypothetical protein	NA	A0A2K8I9A9	Pseudomonas_phage	99.5	1.7e-100
AYZ84632.1|3535748_3536363_+	ninG protein	NA	A0A0U1VZM0	Pseudomonas_phage	98.5	9.0e-111
AYZ84633.1|3536441_3536936_+	hypothetical protein	NA	A0A0U1VYN2	Pseudomonas_phage	99.4	3.2e-82
AYZ84634.1|3536938_3537163_-	hypothetical protein	NA	A0A0U1UNS7	Pseudomonas_phage	98.6	2.7e-33
AYZ84635.1|3537315_3537882_+	hypothetical protein	NA	A0A2K8HN72	Pseudomonas_phage	94.7	4.2e-94
AYZ84636.1|3537878_3539162_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2K8HZU7	Pseudomonas_phage	99.5	5.4e-259
AYZ84637.1|3539171_3541490_+	hypothetical protein	NA	A0A2K8HKC3	Pseudomonas_phage	99.9	0.0e+00
AYZ87950.1|3541636_3542767_+	hypothetical protein	NA	Q5QF43	Pseudomonas_virus	97.9	1.9e-178
AYZ84638.1|3542779_3544072_+	DUF4043 family protein	NA	A0A2K8IBP1	Pseudomonas_phage	100.0	2.2e-252
AYZ84639.1|3544130_3544610_+	hypothetical protein	NA	A0A2K8HNV7	Pseudomonas_phage	99.4	2.1e-78
AYZ84640.1|3544674_3545547_+	hypothetical protein	NA	A0A0U1UNM5	Pseudomonas_phage	99.3	1.2e-164
AYZ84641.1|3545543_3546221_+	hypothetical protein	NA	A0A0U1UNR8	Pseudomonas_phage	99.6	2.5e-130
AYZ84642.1|3546217_3546424_+	hypothetical protein	NA	A0A0U1SXT5	Pseudomonas_phage	100.0	1.3e-29
AYZ84643.1|3546404_3546812_+	hypothetical protein	NA	A0A0U1UNR7	Pseudomonas_phage	100.0	8.7e-70
AYZ84644.1|3546835_3547261_+	hypothetical protein	NA	A0A2K8HN63	Pseudomonas_phage	99.3	2.9e-84
AYZ84645.1|3547260_3548118_+	hypothetical protein	NA	A0A0U1VYN7	Pseudomonas_phage	100.0	4.0e-157
>prophage 10
CP033835	Pseudomonas aeruginosa strain FDAARGOS_570 chromosome, complete genome	7119105	4376382	4383276	7119105	tRNA	uncultured_Caudovirales_phage(83.33%)	9	NA	NA
AYZ85300.1|4376382_4377051_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
AYZ85301.1|4377161_4377557_+	sulfurtransferase TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	72.1	1.6e-47
AYZ85302.1|4377553_4377913_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
AYZ85303.1|4377912_4378218_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
AYZ85304.1|4378214_4378550_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	1.5e-38
AYZ85305.1|4378546_4379530_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.0	3.5e-141
AYZ85306.1|4379617_4380592_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AYZ85307.1|4380596_4381994_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
AYZ85308.1|4381995_4383276_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	8.2e-98
>prophage 11
CP033835	Pseudomonas aeruginosa strain FDAARGOS_570 chromosome, complete genome	7119105	4607786	4663754	7119105	terminase,holin	Pseudomonas_phage(73.33%)	51	NA	NA
AYZ85527.1|4607786_4608992_+	ImmA/IrrE family metallo-endopeptidase	NA	B6SBZ6	Clostridium_virus	33.3	2.7e-42
AYZ85528.1|4609192_4609438_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ85529.1|4609434_4609824_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ85530.1|4610051_4610645_-	DUF1737 domain-containing protein	NA	A0A0U1VYP2	Pseudomonas_phage	91.4	1.2e-70
AYZ85531.1|4610655_4611177_-	hypothetical protein	NA	L7THB0	Pseudomonas_virus	85.5	5.0e-62
AYZ85532.1|4611180_4611708_-	lysozyme	NA	L7TJR2	Pseudomonas_virus	96.0	5.4e-96
AYZ85533.1|4611691_4611949_-|holin	holin	holin	A0A0U1UNM6	Pseudomonas_phage	100.0	2.1e-37
AYZ85534.1|4612043_4623380_-	class I SAM-dependent methyltransferase	NA	L7TID4	Pseudomonas_virus	92.1	0.0e+00
AYZ85535.1|4623364_4625452_-	hypothetical protein	NA	Q5QF54	Pseudomonas_virus	97.6	0.0e+00
AYZ85536.1|4625533_4627426_-	hypothetical protein	NA	A0A0U1SZM6	Pseudomonas_phage	99.3	4.7e-182
AYZ87977.1|4627426_4628032_-	hypothetical protein	NA	Q5QF56	Pseudomonas_virus	99.5	1.9e-108
AYZ85537.1|4628582_4631180_-	hypothetical protein	NA	A0A0U1W0G7	Pseudomonas_phage	99.3	0.0e+00
AYZ85538.1|4631184_4631775_-	hypothetical protein	NA	A0A0U1VYN6	Pseudomonas_phage	100.0	1.3e-101
AYZ85539.1|4631842_4633033_-	hypothetical protein	NA	A0A0U1UNT0	Pseudomonas_phage	99.7	2.8e-225
AYZ85540.1|4633032_4635996_-	hypothetical protein	NA	A0A2K8HKA1	Pseudomonas_phage	97.1	0.0e+00
AYZ85541.1|4635998_4636856_-	hypothetical protein	NA	A0A0U1VYN7	Pseudomonas_phage	100.0	4.0e-157
AYZ85542.1|4636855_4637281_-	hypothetical protein	NA	A0A2K8HN63	Pseudomonas_phage	99.3	2.9e-84
AYZ85543.1|4637304_4637712_-	hypothetical protein	NA	A0A0U1UNR7	Pseudomonas_phage	100.0	8.7e-70
AYZ85544.1|4637692_4637899_-	hypothetical protein	NA	A0A0U1SXT5	Pseudomonas_phage	100.0	1.3e-29
AYZ85545.1|4637895_4638573_-	hypothetical protein	NA	A0A0U1UNR8	Pseudomonas_phage	99.6	2.5e-130
AYZ85546.1|4638569_4639442_-	hypothetical protein	NA	A0A0U1UNM5	Pseudomonas_phage	99.3	1.2e-164
AYZ85547.1|4639506_4639986_-	hypothetical protein	NA	A0A2K8HNV7	Pseudomonas_phage	99.4	2.1e-78
AYZ85548.1|4640044_4641337_-	DUF4043 family protein	NA	A0A2K8IBP1	Pseudomonas_phage	100.0	2.2e-252
AYZ87978.1|4641349_4642480_-	hypothetical protein	NA	Q5QF43	Pseudomonas_virus	97.9	1.9e-178
AYZ85549.1|4642626_4644945_-	hypothetical protein	NA	A0A2K8HKC3	Pseudomonas_phage	99.9	0.0e+00
AYZ85550.1|4644954_4646238_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2K8HZU7	Pseudomonas_phage	99.8	1.4e-259
AYZ85551.1|4646234_4646801_-	hypothetical protein	NA	A0A2K8HN72	Pseudomonas_phage	94.7	4.2e-94
AYZ85552.1|4646953_4647178_+	hypothetical protein	NA	A0A0U1UNS7	Pseudomonas_phage	100.0	3.2e-34
AYZ85553.1|4647180_4647675_-	hypothetical protein	NA	A0A0U1VYN2	Pseudomonas_phage	99.4	4.2e-82
AYZ85554.1|4647753_4648368_-	ninG protein	NA	A0A0U1VZM0	Pseudomonas_phage	99.5	9.7e-113
AYZ85555.1|4648367_4648919_-	hypothetical protein	NA	A0A2K8I9A9	Pseudomonas_phage	98.9	4.9e-100
AYZ85556.1|4648911_4649769_-	hypothetical protein	NA	L7TP27	Pseudomonas_virus	99.3	4.9e-147
AYZ85557.1|4649755_4650781_-	phage replication protein	NA	A0A2K8IBQ0	Pseudomonas_phage	95.6	2.2e-149
AYZ85558.1|4650859_4651060_-	hypothetical protein	NA	A0A0U1UNM4	Pseudomonas_phage	100.0	2.8e-29
AYZ85559.1|4651168_4651954_+	helix-turn-helix domain-containing protein	NA	A0A0U1SXS9	Pseudomonas_phage	99.6	1.2e-147
AYZ85560.1|4652001_4652271_-	DUF1654 domain-containing protein	NA	A0A0U1VYM6	Pseudomonas_phage	100.0	7.8e-43
AYZ85561.1|4652887_4653103_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ85562.1|4653165_4653378_+	hypothetical protein	NA	L7TKR9	Pseudomonas_virus	97.1	2.0e-33
AYZ85563.1|4653412_4653784_+	carbon storage regulator	NA	L7TH77	Pseudomonas_virus	98.4	3.6e-62
AYZ85564.1|4653931_4654162_+	hypothetical protein	NA	V5YUQ9	Pseudomonas_phage	59.5	6.5e-06
AYZ85565.1|4654315_4654537_+	hypothetical protein	NA	A0A0U1SZL8	Pseudomonas_phage	95.9	1.2e-33
AYZ85566.1|4654533_4654905_+	hypothetical protein	NA	A0A2K8HNX4	Pseudomonas_phage	98.4	1.3e-59
AYZ85567.1|4655166_4655922_+	hypothetical protein	NA	A0A0U1UNQ9	Pseudomonas_phage	99.6	9.0e-145
AYZ85568.1|4655926_4656943_+	DUF1351 domain-containing protein	NA	A0A0U1UNR0	Pseudomonas_phage	98.8	5.5e-121
AYZ85569.1|4657072_4657678_+	3'-5' exonuclease	NA	A0A0U1W072	Pseudomonas_phage	99.5	4.7e-112
AYZ85570.1|4657681_4658179_+	single-stranded DNA-binding protein	NA	L7TJL2	Pseudomonas_virus	100.0	9.9e-92
AYZ85571.1|4658205_4659426_+	recombination-associated protein RdgC	NA	L7TP07	Pseudomonas_virus	98.0	1.5e-162
AYZ85572.1|4659531_4659846_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ85573.1|4660167_4660707_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ85574.1|4661283_4661544_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ85575.1|4661663_4663754_+	DNA cytosine methyltransferase	NA	J7HXB9	Pseudomonas_phage	80.9	0.0e+00
>prophage 12
CP033835	Pseudomonas aeruginosa strain FDAARGOS_570 chromosome, complete genome	7119105	5619006	5628035	7119105		Bacillus_phage(33.33%)	9	NA	NA
AYZ86431.1|5619006_5620047_-	DNA recombination/repair protein RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
AYZ86432.1|5620180_5620687_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	8.1e-57
AYZ86433.1|5620834_5621842_+	TolB-like translocation protein	NA	NA	NA	NA	NA
AYZ86434.1|5621823_5621988_-	TolB-like translocation protein	NA	NA	NA	NA	NA
AYZ86435.1|5621967_5624535_+	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	3.2e-24
AYZ86436.1|5624601_5624925_+	Ferredoxin 1	NA	NA	NA	NA	NA
AYZ86437.1|5625351_5626356_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
AYZ86438.1|5626460_5627354_-	lipoprotein NlpD/LppB	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
AYZ88012.1|5627399_5628035_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
>prophage 13
CP033835	Pseudomonas aeruginosa strain FDAARGOS_570 chromosome, complete genome	7119105	5944471	5979602	7119105	protease,tail,head,transposase	Pseudomonas_phage(76.6%)	47	NA	NA
AYZ86724.1|5944471_5944696_-	hypothetical protein	NA	Q5ZQV7	Pseudomonas_phage	98.6	5.5e-34
AYZ86725.1|5944774_5945062_-	hypothetical protein	NA	B7SE14	Pseudomonas_virus	97.9	2.1e-46
AYZ86726.1|5945058_5946207_-	DUF2793 domain-containing protein	NA	B7SE13	Pseudomonas_virus	96.9	6.9e-221
AYZ86727.1|5946203_5948411_-	hypothetical protein	NA	A0SMQ8	Pseudomonas_virus	98.9	0.0e+00
AYZ86728.1|5948400_5948619_-	hypothetical protein	NA	A0A076FR11	Pseudomonas_phage	100.0	5.7e-36
AYZ86729.1|5948615_5948855_-	hypothetical protein	NA	A0A076FRB9	Pseudomonas_phage	100.0	2.1e-39
AYZ86730.1|5948863_5949685_-	DUF2163 domain-containing protein	NA	A0A076FSS7	Pseudomonas_phage	99.3	2.6e-161
AYZ86731.1|5949674_5951378_-	hypothetical protein	NA	L7P7V0	Pseudomonas_phage	98.1	0.0e+00
AYZ86732.1|5951377_5952301_-	hypothetical protein	NA	A0A125RNJ1	Pseudomonas_phage	93.8	2.4e-176
AYZ86733.1|5952302_5953259_-	hypothetical protein	NA	A0A0A7DK02	Pseudomonas_phage	94.7	2.4e-182
AYZ86734.1|5953266_5956965_-|tail	phage tail protein	tail	B7SE05	Pseudomonas_virus	98.3	0.0e+00
AYZ86735.1|5957091_5957610_-	hypothetical protein	NA	B7SE04	Pseudomonas_virus	97.4	9.7e-82
AYZ86736.1|5957613_5958384_-	hypothetical protein	NA	Q6TM61	Pseudomonas_phage	99.6	4.7e-141
AYZ86737.1|5958416_5958596_-	hypothetical protein	NA	A0A0U5G7J8	unidentified_phage	100.0	2.9e-25
AYZ86738.1|5958583_5959057_-	hypothetical protein	NA	I6PBW6	Pseudomonas_phage	100.0	5.0e-85
AYZ86739.1|5959053_5959470_-	DUF1320 domain-containing protein	NA	L7P7K2	Pseudomonas_phage	100.0	3.9e-73
AYZ86740.1|5959633_5960074_-	hypothetical protein	NA	A0A125RNI2	Pseudomonas_phage	99.3	9.5e-46
AYZ86741.1|5960140_5961055_-|head	head protein	head	I6PBD3	Pseudomonas_phage	100.0	9.2e-176
AYZ86742.1|5961058_5962156_-|protease	protease	protease	A0A125RNI0	Pseudomonas_phage	99.7	6.4e-200
AYZ86743.1|5962358_5962826_-	phage virion morphogenesis protein	NA	B7SDZ4	Pseudomonas_virus	97.4	1.1e-79
AYZ86744.1|5962825_5964112_-|head	phage head morphogenesis protein	head	B7SDZ3	Pseudomonas_virus	99.5	5.9e-245
AYZ86745.1|5964111_5965692_-	DUF935 domain-containing protein	NA	A0A0A1IVG5	Pseudomonas_phage	99.6	8.4e-302
AYZ86746.1|5965701_5967354_-	hypothetical protein	NA	A0SMN6	Pseudomonas_virus	99.8	0.0e+00
AYZ86747.1|5967352_5967889_+	hypothetical protein	NA	Q6TM77	Pseudomonas_phage	100.0	2.4e-99
AYZ86748.1|5967890_5968391_-	DUF1804 family protein	NA	A0A0A1IX73	Pseudomonas_phage	98.8	8.5e-83
AYZ86749.1|5968398_5968587_-	hypothetical protein	NA	A0A0A1IVG3	Pseudomonas_phage	100.0	1.0e-25
AYZ86750.1|5968697_5969099_-	hypothetical protein	NA	A0A125RNB4	Pseudomonas_phage	100.0	9.2e-64
AYZ86751.1|5969214_5969631_-	structural protein	NA	I6P8D9	Pseudomonas_phage	100.0	2.1e-74
AYZ86752.1|5969630_5970053_-	hypothetical protein	NA	A0A0A1IVG1	Pseudomonas_phage	98.6	1.3e-71
AYZ86753.1|5970045_5970393_-	hypothetical protein	NA	A0A0A1IVZ8	Pseudomonas_phage	99.1	5.5e-57
AYZ86754.1|5970495_5970945_-	hypothetical protein	NA	I6PBD0	Pseudomonas_phage	100.0	4.6e-80
AYZ86755.1|5970931_5971339_-	regulatory protein GemA	NA	H6V8M4	Pseudomonas_phage	99.3	5.1e-70
AYZ86756.1|5971643_5971913_-	hypothetical protein	NA	A0A0A7DJS6	Pseudomonas_phage	98.9	1.6e-43
AYZ86757.1|5971915_5972122_-	hypothetical protein	NA	A0A0A1IWY9	Pseudomonas_phage	100.0	2.2e-29
AYZ86758.1|5972123_5972405_-	hypothetical protein	NA	A0A0A1IUY5	Pseudomonas_phage	98.9	4.6e-46
AYZ86759.1|5972407_5972716_-	hypothetical protein	NA	A0A1C6ZDJ5	Pseudomonas_phage	100.0	1.1e-48
AYZ86760.1|5972717_5972921_-	hypothetical protein	NA	I6PBV7	Pseudomonas_phage	97.0	6.3e-29
AYZ86761.1|5972920_5973439_-	host-nuclease inhibitor protein Gam	NA	L7P7I4	Pseudomonas_phage	99.4	3.3e-90
AYZ86762.1|5973455_5973767_-	hypothetical protein	NA	A0A1C6ZDI6	Pseudomonas_phage	100.0	6.3e-52
AYZ86763.1|5973729_5974143_-	hypothetical protein	NA	A0A0U5KQ28	unidentified_phage	100.0	7.3e-72
AYZ86764.1|5974243_5974891_-	hypothetical protein	NA	L7P7W4	Pseudomonas_phage	100.0	3.7e-123
AYZ86765.1|5974887_5975658_-	ATP-binding protein	NA	A0A125RN40	Pseudomonas_phage	99.6	1.4e-137
AYZ86766.1|5975654_5977724_-|transposase	transposase	transposase	H6V7Z4	Pseudomonas_virus	99.4	0.0e+00
AYZ86767.1|5977716_5977926_-	hypothetical protein	NA	L7P7N2	Pseudomonas_phage	100.0	2.2e-32
AYZ86768.1|5977925_5978360_-	hypothetical protein	NA	L7P804	Pseudomonas_phage	100.0	5.1e-76
AYZ86769.1|5978362_5978719_-	nucleotide excision repair protein	NA	L7P7X6	Pseudomonas_phage	99.2	2.2e-61
AYZ86770.1|5978888_5979602_+	XRE family transcriptional regulator	NA	L7P7S1	Pseudomonas_phage	99.6	3.0e-134
>prophage 14
CP033835	Pseudomonas aeruginosa strain FDAARGOS_570 chromosome, complete genome	7119105	6232353	6278733	7119105	portal,protease,head,holin,integrase,tRNA,capsid,terminase	Pseudomonas_phage(66.67%)	59	6235944:6235959	6286503:6286518
AYZ86998.1|6232353_6233592_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2C9CX69	Yersinia_phage	33.3	7.8e-53
AYZ86999.1|6233867_6235154_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ87000.1|6235153_6235357_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ87001.1|6235533_6235758_-	hypothetical protein	NA	A0A1W6JT95	Pseudomonas_phage	100.0	9.4e-34
AYZ87002.1|6235914_6236151_-	hypothetical protein	NA	NA	NA	NA	NA
6235944:6235959	attL	GCGGCGCCGGCCCGGT	NA	NA	NA	NA
AYZ87003.1|6236150_6237911_-	hypothetical protein	NA	A0A2I7S8R8	Vibrio_phage	24.1	7.5e-25
AYZ88032.1|6237907_6238777_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ87004.1|6238764_6239772_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ87005.1|6239771_6243323_-	hypothetical protein	NA	A0A0M4U447	Ralstonia_phage	34.9	1.7e-177
AYZ87006.1|6243371_6243782_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ87007.1|6243778_6247039_-	tape measure domain-containing protein	NA	A0A2I7S9D9	Vibrio_phage	47.0	4.3e-50
AYZ87008.1|6247121_6248030_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYZ87009.1|6248218_6248911_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYZ87010.1|6249053_6249806_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ87011.1|6249833_6250037_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ87012.1|6250087_6250525_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ87013.1|6250521_6250803_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ87014.1|6250832_6251828_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	69.9	5.7e-131
AYZ87015.1|6251894_6252254_-|head	head decoration protein	head	A0A2H4JF15	uncultured_Caudovirales_phage	52.3	4.4e-17
AYZ87016.1|6252253_6253450_-|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	60.6	6.5e-121
AYZ87017.1|6253446_6254922_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	70.4	7.3e-199
AYZ87018.1|6254921_6255146_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ87019.1|6255161_6257102_-|terminase	phage terminase large subunit family protein	terminase	A0A1B0Z2K0	Pseudomonas_phage	54.7	1.8e-213
AYZ87020.1|6257073_6257619_-	DNA-packaging protein	NA	A0A1W6JT69	Pseudomonas_phage	68.3	4.8e-63
AYZ87021.1|6257852_6258119_+	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
AYZ87022.1|6258284_6259031_-	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	46.7	1.5e-43
AYZ87023.1|6259127_6259607_-	hypothetical protein	NA	A0A0U4JX95	Pseudomonas_phage	88.5	1.1e-50
AYZ87024.1|6259576_6260194_-	glycoside hydrolase family 19 protein	NA	A0A0U4JP23	Pseudomonas_phage	90.7	4.4e-105
AYZ87025.1|6260190_6260523_-|holin	phage holin, lambda family	holin	A0A1B0YZZ1	Pseudomonas_phage	100.0	5.1e-44
AYZ87026.1|6261250_6261472_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ87027.1|6261822_6262197_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ87028.1|6262298_6262856_-	hypothetical protein	NA	A0A0A0YRV6	Pseudomonas_phage	82.9	3.5e-61
AYZ87029.1|6262852_6263137_-	hypothetical protein	NA	A0A1W6JTC1	Pseudomonas_phage	100.0	4.9e-43
AYZ87030.1|6263133_6264531_-	replicative DNA helicase	NA	A0A1W6JTB3	Pseudomonas_phage	99.4	4.7e-264
AYZ87031.1|6264527_6265148_-	AAA family ATPase	NA	A0A1W6JTD8	Pseudomonas_phage	99.0	6.5e-109
AYZ87032.1|6265323_6266163_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	94.6	9.7e-148
AYZ87033.1|6266159_6266390_-	hypothetical protein	NA	A0A1W6JTF8	Pseudomonas_phage	98.7	2.0e-39
AYZ87034.1|6266386_6267148_-	hypothetical protein	NA	A0A0A0YQ39	Pseudomonas_phage	99.2	4.5e-136
AYZ87035.1|6267144_6267480_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ87036.1|6267472_6267802_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ87037.1|6267798_6268113_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ87038.1|6268087_6268396_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ87039.1|6268698_6268971_-	hypothetical protein	NA	A0A1W6JTC3	Pseudomonas_phage	88.0	7.4e-33
AYZ87040.1|6268985_6269231_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ87041.1|6269626_6269965_-	hypothetical protein	NA	A0A1W6JTA4	Pseudomonas_phage	99.1	5.6e-54
AYZ87042.1|6270188_6270401_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ87043.1|6270496_6271216_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6J6	uncultured_Caudovirales_phage	57.5	1.1e-38
AYZ87044.1|6271306_6272401_+	restriction endonuclease	NA	A0A1S5SAB0	Streptococcus_phage	41.2	1.6e-65
AYZ87045.1|6272623_6273007_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JTA9	Pseudomonas_phage	98.4	1.5e-58
AYZ87046.1|6273017_6273308_+	hypothetical protein	NA	A0A1W6JTA7	Pseudomonas_phage	100.0	7.4e-47
AYZ87047.1|6273318_6274116_+	phage antirepressor	NA	A0A1W6JTB0	Pseudomonas_phage	99.6	4.1e-148
AYZ87048.1|6274190_6274421_+	Arc family DNA-binding protein	NA	A0A1W6JTB4	Pseudomonas_phage	96.1	2.4e-32
AYZ87049.1|6274423_6274759_+	hypothetical protein	NA	A0A1W6JTA6	Pseudomonas_phage	88.3	1.0e-47
AYZ87050.1|6275579_6276107_+	hypothetical protein	NA	A0A0A0YRT2	Pseudomonas_phage	98.0	2.0e-50
AYZ87051.1|6276219_6276411_+	hypothetical protein	NA	A0A0A0YQ21	Pseudomonas_phage	96.8	7.8e-29
AYZ87052.1|6276407_6277097_+	hypothetical protein	NA	A0A0A0YUE3	Pseudomonas_phage	87.3	6.6e-110
AYZ88033.1|6277101_6277458_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ87053.1|6277441_6277684_+	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	60.3	6.6e-17
AYZ88034.1|6277683_6278733_+|integrase	integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	53.9	7.7e-102
6286503:6286518	attR	ACCGGGCCGGCGCCGC	NA	NA	NA	NA
>prophage 15
CP033835	Pseudomonas aeruginosa strain FDAARGOS_570 chromosome, complete genome	7119105	6444113	6524602	7119105	tRNA,plate,holin,tail	Pseudomonas_phage(35.9%)	85	NA	NA
AYZ87196.1|6444113_6445313_-|tRNA	Tyrosine--tRNA ligase 2	tRNA	NA	NA	NA	NA
AYZ88037.1|6445597_6446941_+	peptidase M23	NA	O03937	Lactobacillus_phage	44.1	3.0e-18
AYZ87197.1|6446943_6448035_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
AYZ87198.1|6448088_6448439_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	3.0e-26
AYZ87199.1|6448516_6448939_-	polymer-forming cytoskeletal family protein	NA	NA	NA	NA	NA
AYZ87200.1|6448939_6449659_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ87201.1|6449658_6450693_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
AYZ87202.1|6450983_6451406_+	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
AYZ87203.1|6451422_6452391_+	nitronate monooxygenase	NA	NA	NA	NA	NA
AYZ87204.1|6452512_6453595_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
AYZ87205.1|6453655_6454456_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AYZ87206.1|6454495_6455977_-	AAA family ATPase	NA	U5XJW0	Phormidium_phage	33.8	3.9e-67
AYZ87207.1|6456055_6456394_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
AYZ87208.1|6456493_6457141_+	2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase	NA	NA	NA	NA	NA
AYZ87209.1|6457195_6457990_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
AYZ87210.1|6458309_6458732_-	OsmC family protein	NA	NA	NA	NA	NA
AYZ87211.1|6459003_6459648_+	cyclic AMP receptor-like protein	NA	NA	NA	NA	NA
AYZ87212.1|6459709_6460546_-	indole-3-glycerol-phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	56.9	2.1e-70
AYZ87213.1|6460542_6461592_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
AYZ87214.1|6461593_6462199_-	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	66.3	2.1e-75
AYZ87215.1|6462617_6462848_-	hypothetical protein	NA	C8ZKF3	Pseudomonas_phage	71.6	1.4e-24
AYZ87216.1|6462844_6463147_-	hypothetical protein	NA	A0A0H5B141	Pseudomonas_phage	71.0	4.4e-34
AYZ87217.1|6463146_6464199_-|tail	phage tail protein	tail	A0A0H5AXZ9	Pseudomonas_phage	50.9	2.9e-64
AYZ87218.1|6465184_6468838_-	DUF1983 domain-containing protein	NA	A0A0S2SYC5	Pseudomonas_phage	57.0	0.0e+00
AYZ87219.1|6468896_6469499_-|tail	tail assembly protein	tail	A0A1V0E8A0	Vibrio_phage	57.8	2.2e-53
AYZ87220.1|6469553_6470324_-|tail	phage tail protein	tail	A0A2D1GNP8	Pseudomonas_phage	55.6	4.2e-81
AYZ87221.1|6470326_6471022_-|tail	phage minor tail protein L	tail	A0A1B0VNE0	Pseudomonas_phage	49.8	7.4e-69
AYZ87222.1|6471029_6471371_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	40.0	1.4e-17
AYZ87223.1|6471363_6473199_-|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	36.2	1.2e-28
AYZ87224.1|6473245_6473500_-	hypothetical protein	NA	A0A2H4PI34	Pseudomonas_phage	38.4	6.3e-10
AYZ87225.1|6473529_6473877_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ87226.1|6473888_6474383_-|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	56.5	1.4e-45
AYZ87227.1|6474453_6474684_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ87228.1|6474698_6474956_-	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
AYZ88038.1|6474952_6475315_-	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	47.9	1.9e-15
AYZ87229.1|6475311_6475941_-	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.0	1.6e-86
AYZ87230.1|6475973_6476963_-	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.8	1.3e-106
AYZ87231.1|6477020_6477227_-|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
AYZ87232.1|6477201_6478074_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	51.7	1.3e-75
AYZ87233.1|6478083_6480321_-|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
AYZ87234.1|6480490_6480835_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AYZ87235.1|6480849_6481353_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	8.0e-65
AYZ87236.1|6481365_6482526_-|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.4	1.2e-188
AYZ87237.1|6482568_6483027_-|tail	phage tail protein	tail	NA	NA	NA	NA
AYZ87238.1|6483023_6485099_-|tail	phage tail protein	tail	Q9ZXK6	Pseudomonas_virus	49.8	2.1e-196
AYZ87239.1|6485100_6485634_-|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.0	6.7e-62
AYZ87240.1|6485626_6486514_-	bacteriophage protein	NA	S4TNY7	Salmonella_phage	59.8	5.3e-88
AYZ87241.1|6486510_6486837_-|plate	phage baseplate protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	3.2e-30
AYZ87242.1|6486989_6487547_-|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	70.3	6.0e-45
AYZ87243.1|6487543_6488059_-	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	42.9	4.1e-32
AYZ87244.1|6488080_6488530_-|holin	holin	holin	B5TK61	Pseudomonas_phage	53.3	5.0e-26
AYZ87245.1|6488893_6489253_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ87246.1|6489300_6489501_-	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
AYZ87247.1|6489958_6490729_+	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	58.7	5.1e-71
AYZ87248.1|6490828_6491143_+	transcription regulatory protein PrtN	NA	NA	NA	NA	NA
AYZ87249.1|6491459_6492938_-	anthranilate synthase component I	NA	NA	NA	NA	NA
AYZ87250.1|6493010_6493829_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
AYZ87251.1|6493828_6494503_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
AYZ87252.1|6494626_6495457_-	ABC transporter permease	NA	NA	NA	NA	NA
AYZ87253.1|6495562_6496810_-	ABC transporter permease	NA	NA	NA	NA	NA
AYZ87254.1|6496923_6497970_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYZ87255.1|6498025_6499135_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
AYZ87256.1|6499367_6500402_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
AYZ87257.1|6500530_6501163_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AYZ87258.1|6501208_6503602_-	PAS domain S-box protein	NA	NA	NA	NA	NA
AYZ87259.1|6503753_6504815_+	DUF3530 family protein	NA	NA	NA	NA	NA
AYZ87260.1|6504815_6505574_-	molecular chaperone DjlA	NA	NA	NA	NA	NA
AYZ87261.1|6505575_6506250_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
AYZ87262.1|6506246_6507263_-	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
AYZ87263.1|6507389_6510164_+	LPS-assembly protein LptD	NA	NA	NA	NA	NA
AYZ87264.1|6510144_6511437_+	molecular chaperone SurA	NA	NA	NA	NA	NA
AYZ87265.1|6511433_6512420_+	4-hydroxythreonine-4-phosphate dehydrogenase 1	NA	NA	NA	NA	NA
AYZ87266.1|6512535_6513342_+	ribosomal RNA small subunit methyltransferase A	NA	NA	NA	NA	NA
AYZ87267.1|6513378_6513759_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
AYZ87268.1|6513758_6514610_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A2R4ALP3	Aeromonas_phage	44.2	2.4e-08
AYZ87269.1|6514653_6514986_+	thiosulfate sulfurtransferase	NA	NA	NA	NA	NA
AYZ87270.1|6515264_6517187_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
AYZ87271.1|6517287_6518559_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
AYZ87272.1|6518555_6520109_+	SpoVR family protein	NA	NA	NA	NA	NA
AYZ87273.1|6520203_6520710_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
AYZ87274.1|6520753_6521986_+	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.3	2.0e-77
AYZ87275.1|6521958_6522501_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AYZ87276.1|6522491_6522845_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AYZ87277.1|6522928_6523498_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
AYZ87278.1|6523576_6524602_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	8.3e-109
