The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	0	8470	5231450	integrase	Escherichia_coli_O157_typing_phage(42.86%)	8	142:154	10369:10381
142:154	attL	GAACGGCACGCTA	NA	NA	NA	NA
AYZ38635.1|890_1139_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
AYZ43254.1|1296_1548_+	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	100.0	3.1e-41
AYZ38636.1|1540_2191_+	adenine methylase	NA	A0A2R9YJG0	Escherichia_phage	100.0	5.0e-128
AYZ38637.1|2187_2382_+	DUF1382 family protein	NA	A0A0F6R7M7	Escherichia_coli_O157_typing_phage	98.4	9.7e-27
AYZ38638.1|2385_3636_-|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.3	3.0e-238
AYZ38639.1|3828_5406_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
AYZ38640.1|5474_6941_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
AYZ38641.1|7102_8470_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	5.2e-42
10369:10381	attR	TAGCGTGCCGTTC	NA	NA	NA	NA
>prophage 2
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	28963	29395	5231450		Powai_lake_megavirus(100.0%)	1	NA	NA
AYZ38653.1|28963_29395_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	4.8e-18
>prophage 3
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	39960	46298	5231450		Mycoplasma_phage(20.0%)	8	NA	NA
AYZ38658.1|39960_41244_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	4.9e-34
AYZ38659.1|41302_41503_-	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AYZ38660.1|41514_41850_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AYZ38661.1|41851_43702_-	molecular chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	39.7	1.8e-101
AYZ38662.1|43718_44234_-	co-chaperone protein HscB	NA	NA	NA	NA	NA
AYZ38663.1|44329_44653_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
AYZ38664.1|44669_45056_-	iron-sulfur cluster scaffold-like protein	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
AYZ38665.1|45083_46298_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 4
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	61435	62947	5231450		Staphylococcus_phage(100.0%)	1	NA	NA
AYZ38681.1|61435_62947_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.5	9.0e-11
>prophage 5
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	68705	79994	5231450		Bacillus_phage(50.0%)	7	NA	NA
AYZ38685.1|68705_69959_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
AYZ38686.1|70286_71477_+	flavohemoprotein	NA	NA	NA	NA	NA
AYZ38687.1|71521_71860_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
AYZ38688.1|71920_73255_-	transcriptional regulator	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
AYZ38689.1|73244_73958_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AYZ38690.1|74122_75550_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
AYZ38691.1|76106_79994_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	1.0e-130
>prophage 6
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	84114	84375	5231450		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AYZ38696.1|84114_84375_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	8.4e-18
>prophage 7
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	87835	91578	5231450		Tetraselmis_virus(50.0%)	3	NA	NA
AYZ38702.1|87835_88516_-	ribonuclease 3	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
AYZ38703.1|88788_89763_-	S26 family signal peptidase	NA	NA	NA	NA	NA
AYZ38704.1|89778_91578_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 8
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	97349	103431	5231450	tRNA	Cafeteria_roenbergensis_virus(25.0%)	7	NA	NA
AYZ38712.1|97349_98684_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
AYZ43256.1|98716_99598_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYZ38713.1|99700_100288_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
AYZ38714.1|100342_100726_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
AYZ38715.1|101030_101720_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
AYZ38716.1|101767_102805_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AYZ38717.1|103011_103431_+	thiol disulfide reductase thioredoxin	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 9
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	108724	110023	5231450		Burkholderia_virus(100.0%)	1	NA	NA
AYZ38721.1|108724_110023_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 10
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	115800	118374	5231450		Enterobacteria_phage(100.0%)	1	NA	NA
AYZ38722.1|115800_118374_-	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 11
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	125720	126791	5231450		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AYZ38730.1|125720_126791_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 12
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	140424	140907	5231450		Staphylococcus_phage(100.0%)	1	NA	NA
AYZ38747.1|140424_140907_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 13
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	146551	146818	5231450		Salmonella_phage(100.0%)	1	NA	NA
AYZ38750.1|146551_146818_-	hypothetical protein	NA	A0A1S6L009	Salmonella_phage	67.9	1.2e-11
>prophage 14
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	156313	160364	5231450		Klosneuvirus(50.0%)	4	NA	NA
AYZ38755.1|156313_157594_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.3	4.9e-34
AYZ38756.1|157830_159231_+	GABA permease	NA	NA	NA	NA	NA
AYZ38757.1|159251_159914_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
AYZ38758.1|159914_160364_-	peptidoglycan-binding protein LysM	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 15
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	166170	171467	5231450		Oenococcus_phage(20.0%)	6	NA	NA
AYZ38769.1|166170_166416_+	NrdH-redoxin	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
AYZ38770.1|166412_166823_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
AYZ38771.1|166795_168940_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	8.4e-196
AYZ38772.1|168949_169909_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	72.1	3.1e-134
AYZ38773.1|170026_170275_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ38774.1|170264_171467_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 16
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	184146	189533	5231450	tRNA	Vibrio_phage(25.0%)	5	NA	NA
AYZ38787.1|184146_184332_-	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
AYZ38788.1|184566_187197_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
AYZ38789.1|187325_187826_-	recombination regulator RecX	NA	NA	NA	NA	NA
AYZ38790.1|187894_188956_-	DNA recombination/repair protein RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
AYZ38791.1|189035_189533_-	nicotinamide-nucleotide amidohydrolase PncC	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 17
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	195001	195967	5231450		Tetraselmis_virus(100.0%)	1	NA	NA
AYZ38799.1|195001_195967_+	arabinose 5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
>prophage 18
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	203381	204395	5231450		Enterobacteria_phage(100.0%)	1	NA	NA
AYZ38804.1|203381_204395_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	1.3e-26
>prophage 19
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	223260	233283	5231450		uncultured_Mediterranean_phage(33.33%)	9	NA	NA
AYZ38824.1|223260_225822_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
AYZ38825.1|225927_226584_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	45.2	4.3e-50
AYZ38826.1|226624_226861_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ38827.1|226871_228299_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
AYZ38828.1|229039_229447_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYZ38829.1|229567_230560_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AYZ38830.1|230622_231762_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
AYZ38831.1|231901_232528_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
AYZ38832.1|232521_233283_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 20
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	236395	238428	5231450		Tupanvirus(50.0%)	2	NA	NA
AYZ38838.1|236395_237001_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
AYZ38839.1|237000_238428_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
>prophage 21
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	262553	263339	5231450		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AYZ38860.1|262553_263339_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	6.5e-21
>prophage 22
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	268667	273587	5231450		Vibrio_phage(33.33%)	4	NA	NA
AYZ38863.1|268667_269339_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
AYZ38864.1|269632_270505_+	YgcG family protein	NA	NA	NA	NA	NA
AYZ38865.1|270564_271863_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
AYZ38866.1|271949_273587_-	CTP synthetase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 23
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	277620	281735	5231450		Erysipelothrix_phage(50.0%)	2	NA	NA
AYZ38871.1|277620_278922_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	29.8	2.6e-38
AYZ38872.1|278978_281735_+	signal transduction histidine kinase	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 24
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	289268	290117	5231450		Vibrio_phage(100.0%)	1	NA	NA
AYZ38880.1|289268_290117_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	2.1e-41
>prophage 25
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	294974	295730	5231450		Bacillus_phage(100.0%)	1	NA	NA
AYZ38884.1|294974_295730_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	1.1e-09
>prophage 26
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	307306	328205	5231450	tRNA	environmental_halophage(11.11%)	14	NA	NA
AYZ38896.1|307306_308512_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.2	3.5e-74
AYZ38897.1|308511_308955_+	sulfur acceptor protein CsdE	NA	NA	NA	NA	NA
AYZ38898.1|309005_309812_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	S4VW33	Pandoravirus	33.9	1.3e-16
AYZ38899.1|309888_310986_-	murein transglycosylase A	NA	NA	NA	NA	NA
AYZ38900.1|311569_312517_-	phosphoglycerate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	25.2	5.8e-16
AYZ38901.1|312588_313185_-	SIS domain-containing protein	NA	A0A2P0VNK5	Tetraselmis_virus	36.2	3.1e-23
AYZ38902.1|313187_314363_-	putative C-S lyase	NA	NA	NA	NA	NA
AYZ38903.1|314362_315943_-	PTS glucose transporter subunit IIBC	NA	A0A2I7SAJ6	Vibrio_phage	35.7	2.0e-05
AYZ38904.1|315974_316799_-	PRD domain-containing protein	NA	NA	NA	NA	NA
AYZ38905.1|317057_318311_-	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
AYZ38906.1|318542_319874_+	N-acetylglutamate synthase	NA	NA	NA	NA	NA
AYZ38907.1|319955_321782_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.4	2.3e-24
AYZ38908.1|321781_325324_-	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.6	1.5e-08
AYZ38909.1|325316_328205_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	5.3e-68
>prophage 27
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	333682	340455	5231450		Geobacillus_virus(33.33%)	7	NA	NA
AYZ38915.1|333682_334477_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
AYZ38916.1|334483_335359_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AYZ38917.1|335509_337756_-	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
AYZ38918.1|337768_338299_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AYZ38919.1|338610_338805_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ38920.1|338983_339673_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
AYZ38921.1|339741_340455_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 28
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	350086	352581	5231450		Aichi_virus(50.0%)	2	NA	NA
AYZ38930.1|350086_351505_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	26.9	1.8e-24
AYZ38931.1|351819_352581_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 29
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	384400	385153	5231450		Clostridium_phage(100.0%)	1	NA	NA
AYZ38965.1|384400_385153_-	LysM peptidoglycan-binding domain-containing protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 30
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	409434	413572	5231450		environmental_Halophage(50.0%)	3	NA	NA
AYZ38982.1|409434_410835_+	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	45.2	3.7e-19
AYZ38983.1|410852_412169_+	guanine deaminase	NA	NA	NA	NA	NA
AYZ38984.1|412204_413572_+	guanine/hypoxanthine permease GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
>prophage 31
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	418729	424816	5231450	tRNA	Catovirus(25.0%)	5	NA	NA
AYZ38989.1|418729_420247_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
AYZ38990.1|420256_421355_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
AYZ38991.1|421445_423179_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	1.9e-60
AYZ38992.1|423184_423895_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AYZ38993.1|423919_424816_-	tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 32
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	428625	433102	5231450		Pandoravirus(50.0%)	2	NA	NA
AYZ39000.1|428625_430065_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.3	2.6e-31
AYZ39001.1|430228_433102_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	2.8e-263
>prophage 33
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	441239	442472	5231450		Catovirus(100.0%)	1	NA	NA
AYZ39010.1|441239_442472_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.1	1.6e-103
>prophage 34
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	466902	467811	5231450		Yersinia_phage(100.0%)	1	NA	NA
AYZ39032.1|466902_467811_+	prohibitin family protein	NA	A0A2C9D0H9	Yersinia_phage	56.1	5.2e-54
>prophage 35
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	475635	476790	5231450		Staphylococcus_phage(100.0%)	1	NA	NA
AYZ39041.1|475635_476790_+	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 36
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	502652	503918	5231450		Enterobacteria_phage(100.0%)	1	NA	NA
AYZ39069.1|502652_503918_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	38.1	2.1e-77
>prophage 37
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	516774	520266	5231450	transposase	Shigella_phage(100.0%)	4	NA	NA
AYZ39077.1|516774_517125_+|transposase	transposase	transposase	Q716C1	Shigella_phage	98.9	1.8e-39
AYZ39078.1|518151_518382_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ43275.1|518775_519060_-	DNA helicase UvrD	NA	NA	NA	NA	NA
AYZ39079.1|519053_520266_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	4.7e-103
>prophage 38
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	533117	533693	5231450	protease	Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
AYZ39092.1|533117_533693_+|protease	protease	protease	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	31.8	1.5e-14
>prophage 39
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	540584	544166	5231450		Enterobacteria_phage(50.0%)	3	NA	NA
AYZ39100.1|540584_541814_+	ATPase	NA	Q9EYF3	Enterobacteria_phage	30.3	5.6e-19
AYZ39101.1|541830_542886_+	response regulator	NA	NA	NA	NA	NA
AYZ39102.1|543014_544166_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	55.2	1.3e-107
>prophage 40
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	564175	566517	5231450		Yersinia_phage(33.33%)	4	NA	NA
AYZ39123.1|564175_564994_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.5	6.5e-48
AYZ39124.1|565259_565739_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	8.9e-13
AYZ39125.1|565754_566231_+	DNA repair protein RadC	NA	NA	NA	NA	NA
AYZ39126.1|566295_566517_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
>prophage 41
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	570183	571167	5231450		Tetraselmis_virus(100.0%)	1	NA	NA
AYZ39129.1|570183_571167_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.1	2.4e-36
>prophage 42
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	580266	586591	5231450		Catovirus(50.0%)	4	NA	NA
AYZ39137.1|580266_583029_-	glycosyltransferase	NA	A0A0N9QZQ5	Chrysochromulina_ericina_virus	31.6	4.9e-79
AYZ39138.1|583080_584334_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	A0A127AXI2	Bacillus_phage	27.4	6.5e-31
AYZ39139.1|584416_585562_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	30.2	1.9e-29
AYZ39140.1|585601_586591_-	glycosyl hydrolase family 1	NA	A0A1V0SAE6	Catovirus	32.3	5.5e-33
>prophage 43
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	634876	636225	5231450	transposase	Bacillus_phage(100.0%)	1	NA	NA
AYZ39179.1|634876_636225_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	53.0	3.0e-74
>prophage 44
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	646251	647136	5231450		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
AYZ39192.1|646251_647136_+	NAD(P)-dependent oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 45
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	652979	653807	5231450		Staphylococcus_phage(100.0%)	1	NA	NA
AYZ39199.1|652979_653807_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	44.5	1.4e-61
>prophage 46
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	656847	661863	5231450		Pseudomonas_phage(50.0%)	3	NA	NA
AYZ39203.1|656847_659067_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
AYZ39204.1|659318_660068_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
AYZ39205.1|660390_661863_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	33.3	3.1e-48
>prophage 47
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	669320	674360	5231450		Bacillus_virus(50.0%)	4	NA	NA
AYZ39213.1|669320_671579_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.9	7.0e-84
AYZ39214.1|671716_673324_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYZ39215.1|673432_673915_-	transcriptional regulator	NA	NA	NA	NA	NA
AYZ39216.1|673967_674360_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 48
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	681111	693557	5231450		uncultured_Caudovirales_phage(16.67%)	11	NA	NA
AYZ39224.1|681111_682095_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.6	8.5e-10
AYZ39225.1|682091_682901_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.6	2.7e-14
AYZ39226.1|683274_685416_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AYZ39227.1|685479_687372_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.9	5.8e-92
AYZ39228.1|687400_687982_-	esterase YqiA	NA	NA	NA	NA	NA
AYZ39229.1|687981_688809_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
AYZ39230.1|688833_689256_-	DUF1249 family protein	NA	NA	NA	NA	NA
AYZ39231.1|689256_689886_-	ADP-ribose pyrophosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
AYZ39232.1|690090_691572_+	outer membrane protein TolC	NA	NA	NA	NA	NA
AYZ39233.1|691719_692391_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
AYZ39234.1|692396_693557_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
>prophage 49
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	699442	700096	5231450		Staphylococcus_phage(100.0%)	1	NA	NA
AYZ39240.1|699442_700096_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 50
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	704008	705442	5231450		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AYZ39245.1|704008_705442_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.6	3.6e-41
>prophage 51
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	710579	711818	5231450	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
AYZ39249.1|710579_711818_+|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	5.9e-93
>prophage 52
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	718119	734257	5231450	tRNA	Moraxella_phage(16.67%)	12	NA	NA
AYZ39257.1|718119_719133_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	9.7e-110
AYZ39258.1|719370_719586_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AYZ39259.1|719696_721442_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
AYZ39260.1|721636_723478_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
AYZ39261.1|723556_724063_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
AYZ39262.1|724316_725081_-	siderophore-interacting protein	NA	NA	NA	NA	NA
AYZ39263.1|725368_725992_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AYZ39264.1|726087_727608_-	PAS domain S-box protein	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
AYZ39265.1|727914_729405_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	1.1e-32
AYZ39266.1|729446_729779_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
AYZ39267.1|729997_730981_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
AYZ39268.1|731164_734257_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.2	3.4e-158
>prophage 53
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	746911	747877	5231450		Escherichia_phage(100.0%)	1	NA	NA
AYZ39278.1|746911_747877_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 54
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	773717	776012	5231450		Tetraselmis_virus(100.0%)	1	NA	NA
AYZ39305.1|773717_776012_-	PFL-like enzyme TdcE	NA	A0A2P0VNR5	Tetraselmis_virus	41.1	2.6e-158
>prophage 55
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	783711	784857	5231450		Streptococcus_phage(100.0%)	1	NA	NA
AYZ39313.1|783711_784857_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	42.0	5.2e-51
>prophage 56
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	803255	811060	5231450		Streptococcus_phage(25.0%)	10	NA	NA
AYZ39331.1|803255_804119_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.6e-50
AYZ39332.1|804183_806220_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
AYZ39333.1|806177_806573_+	YraN family protein	NA	NA	NA	NA	NA
AYZ39334.1|806592_807183_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
AYZ39335.1|807192_807768_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
AYZ39336.1|807889_808930_-	permease	NA	NA	NA	NA	NA
AYZ39337.1|809002_809638_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
AYZ39338.1|809765_810284_+	glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	5.8e-10
AYZ39339.1|810263_810707_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ39340.1|810757_811060_+	GIY-YIG nuclease family protein	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
>prophage 57
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	816763	818653	5231450		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AYZ39347.1|816763_818653_-	DEAD/DEAH box family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 58
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	824134	830773	5231450		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
AYZ39354.1|824134_826807_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
AYZ39355.1|826831_828319_-	transcription termination protein NusA	NA	NA	NA	NA	NA
AYZ43286.1|828346_828799_-	ribosome maturation factor	NA	NA	NA	NA	NA
AYZ39356.1|829429_830773_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 59
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	834853	837726	5231450	protease	Pandoravirus(50.0%)	2	NA	NA
AYZ39360.1|834853_835702_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
AYZ39361.1|835791_837726_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 60
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	844355	845834	5231450		Indivirus(50.0%)	2	NA	NA
AYZ39370.1|844355_845327_+	octaprenyl-diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
AYZ39371.1|845555_845834_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	3.4e-17
>prophage 61
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	849902	864696	5231450		Staphylococcus_phage(25.0%)	17	NA	NA
AYZ39376.1|849902_850712_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
AYZ39377.1|850921_851899_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
AYZ39378.1|851912_852899_+	arabinose 5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
AYZ39379.1|852919_853486_+	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
AYZ39380.1|853482_854058_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AYZ39381.1|854026_854584_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AYZ39382.1|854590_855316_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
AYZ39383.1|855363_856797_+	RNA polymerase sigma-54 factor	NA	NA	NA	NA	NA
AYZ39384.1|856819_857107_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
AYZ39385.1|857224_857716_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AYZ39386.1|857761_858616_+	RNase adaptor protein RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
AYZ39387.1|858612_858885_+	phosphocarrier protein NPr	NA	NA	NA	NA	NA
AYZ39388.1|859097_859730_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
AYZ39389.1|859726_860455_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AYZ39390.1|860451_861105_-	isoprenoid biosynthesis protein ElbB	NA	NA	NA	NA	NA
AYZ39391.1|861334_863671_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
AYZ43289.1|863766_864696_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 62
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	871444	876177	5231450		Salmonella_phage(50.0%)	5	NA	NA
AYZ39394.1|871444_872557_+	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	87.8	3.9e-72
AYZ39395.1|872616_873081_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
AYZ39396.1|873077_873953_-	ROK family protein	NA	NA	NA	NA	NA
AYZ39397.1|873949_874639_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
AYZ39398.1|874686_876177_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	23.9	4.9e-09
>prophage 63
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	879882	880380	5231450		Pseudomonas_phage(100.0%)	1	NA	NA
AYZ39402.1|879882_880380_-	stringent starvation protein B	NA	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
>prophage 64
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	884345	886870	5231450	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
AYZ39408.1|884345_885713_+|protease	periplasmic pH-dependent serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
AYZ39409.1|885802_886870_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 65
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	904805	905849	5231450		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AYZ39425.1|904805_905849_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 66
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	915891	920404	5231450		Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
AYZ39435.1|915891_917391_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.3	4.7e-12
AYZ39436.1|917451_918342_-	sugar ABC transporter	NA	NA	NA	NA	NA
AYZ39437.1|918377_919232_-	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
AYZ39438.1|919573_920404_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	27.0	1.2e-09
>prophage 67
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	933130	937284	5231450		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
AYZ39450.1|933130_934156_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
AYZ39451.1|934223_935405_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AYZ39452.1|935414_936518_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AYZ39453.1|936525_937284_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
>prophage 68
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	947618	949090	5231450	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
AYZ39461.1|947618_948128_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	1.1e-18
AYZ39462.1|948142_949090_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.9e-06
>prophage 69
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	968967	974541	5231450		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
AYZ39500.1|968967_970152_-	translation elongation factor EF-Tu 1	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
AYZ39501.1|970222_972337_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
AYZ39502.1|972433_972904_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
AYZ39503.1|973000_973375_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
AYZ39504.1|973500_973788_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
AYZ39505.1|973795_974155_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
AYZ39506.1|974154_974541_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.1	3.3e-18
>prophage 70
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	980112	989652	5231450		Tupanvirus(25.0%)	9	NA	NA
AYZ39514.1|980112_982026_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	5.6e-74
AYZ39515.1|982025_983048_+	hydrolase	NA	NA	NA	NA	NA
AYZ39516.1|983041_983260_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
AYZ39517.1|983313_984183_+	phosphoribulokinase	NA	NA	NA	NA	NA
AYZ39518.1|984237_984642_-	OsmC family protein	NA	NA	NA	NA	NA
AYZ39519.1|984943_985576_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
AYZ39520.1|985626_987717_+	hypothetical protein	NA	H9YQA8	environmental_Halophage	99.3	2.9e-76
AYZ39521.1|987779_989003_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AYZ39522.1|989088_989652_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.3	7.9e-61
>prophage 71
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1008559	1009396	5231450		Vibrio_phage(100.0%)	1	NA	NA
AYZ39543.1|1008559_1009396_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 72
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1026374	1030884	5231450		Bacillus_phage(66.67%)	5	NA	NA
AYZ39557.1|1026374_1027997_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.3	1.5e-141
AYZ39558.1|1028111_1028429_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AYZ39559.1|1028487_1028784_+	transcriptional regulator	NA	NA	NA	NA	NA
AYZ39560.1|1028815_1030168_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
AYZ39561.1|1030164_1030884_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 73
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1037447	1038326	5231450		Sodalis_phage(100.0%)	1	NA	NA
AYZ39567.1|1037447_1038326_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	1.9e-69
>prophage 74
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1044295	1046689	5231450		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
AYZ39573.1|1044295_1046689_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 75
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1051844	1053083	5231450		Ralstonia_phage(100.0%)	1	NA	NA
AYZ39576.1|1051844_1053083_-	RtcB family protein	NA	A0A1L7N133	Ralstonia_phage	60.1	1.3e-124
>prophage 76
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1061990	1064438	5231450		Dickeya_phage(100.0%)	1	NA	NA
AYZ39584.1|1061990_1064438_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 77
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1074767	1076864	5231450		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
AYZ39592.1|1074767_1076864_-	RecQ family ATP-dependent DNA helicase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	33.8	1.0e-41
>prophage 78
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1085262	1087073	5231450		Enterococcus_phage(50.0%)	2	NA	NA
AYZ39602.1|1085262_1086006_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	24.9	2.2e-10
AYZ39603.1|1086002_1087073_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 79
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1090615	1092098	5231450		Planktothrix_phage(50.0%)	2	NA	NA
AYZ39607.1|1090615_1091329_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
AYZ39608.1|1091330_1092098_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 80
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1097821	1107769	5231450		Dickeya_phage(33.33%)	11	NA	NA
AYZ39614.1|1097821_1098676_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
AYZ39615.1|1098920_1099979_-	cell division protein FtsX	NA	NA	NA	NA	NA
AYZ39616.1|1099971_1100640_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
AYZ39617.1|1100642_1102130_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
AYZ39618.1|1102279_1102876_+	16S rRNA (guanine(966)-N(2))-methyltransferase	NA	NA	NA	NA	NA
AYZ39619.1|1102865_1103135_+	DUF1145 family protein	NA	NA	NA	NA	NA
AYZ39620.1|1103137_1103497_-	DUF2500 domain-containing protein	NA	NA	NA	NA	NA
AYZ39621.1|1103637_1104264_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
AYZ39622.1|1104337_1106536_+	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	38.4	5.0e-119
AYZ39623.1|1106637_1106883_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
AYZ39624.1|1107103_1107769_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
>prophage 81
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1115662	1121558	5231450		Bacillus_virus(50.0%)	5	NA	NA
AYZ39633.1|1115662_1116469_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.1	2.0e-17
AYZ39634.1|1116473_1116875_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
AYZ39635.1|1116994_1117354_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
AYZ39636.1|1117698_1118823_-	inner membrane transport permease YhhJ	NA	NA	NA	NA	NA
AYZ39637.1|1118822_1121558_-	ABC transporter ATP-binding protein/permease	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 82
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1134968	1137011	5231450		Indivirus(100.0%)	1	NA	NA
AYZ39648.1|1134968_1137011_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	1.2e-45
>prophage 83
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1140355	1142491	5231450		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
AYZ39653.1|1140355_1140709_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	1.7e-24
AYZ39654.1|1140763_1142053_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.3	4.6e-173
AYZ39655.1|1142065_1142491_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	69.3	2.8e-50
>prophage 84
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1155480	1156950	5231450		Pithovirus(50.0%)	2	NA	NA
AYZ39668.1|1155480_1156251_+	hemin import ATP-binding protein HmuV	NA	W5SAS9	Pithovirus	30.0	1.7e-18
AYZ43294.1|1156302_1156950_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	40.0	1.0e-16
>prophage 85
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1204337	1206322	5231450		Bacillus_virus(50.0%)	2	NA	NA
AYZ39704.1|1204337_1205342_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.4	1.5e-17
AYZ39705.1|1205338_1206322_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	6.7e-15
>prophage 86
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1210689	1212038	5231450	transposase	Bacillus_phage(100.0%)	1	NA	NA
AYZ39709.1|1210689_1212038_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	53.0	3.0e-74
>prophage 87
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1217646	1219980	5231450		Escherichia_phage(100.0%)	1	NA	NA
AYZ39715.1|1217646_1219980_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	29.6	1.4e-71
>prophage 88
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1223634	1225659	5231450	transposase	Morganella_phage(50.0%)	3	NA	NA
AYZ39720.1|1223634_1223847_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
AYZ39721.1|1224035_1224188_-	Hok/Gef family protein	NA	NA	NA	NA	NA
AYZ39722.1|1224289_1225659_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	6.3e-112
>prophage 89
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1229525	1230521	5231450		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AYZ39726.1|1229525_1230521_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.2	7.0e-12
>prophage 90
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1235839	1237381	5231450		Staphylococcus_phage(100.0%)	1	NA	NA
AYZ39732.1|1235839_1237381_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	1.9e-16
>prophage 91
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1258794	1273815	5231450	tRNA	Acinetobacter_phage(33.33%)	10	NA	NA
AYZ39752.1|1258794_1259205_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	39.0	4.9e-20
AYZ39753.1|1259221_1259407_-	addiction module toxin, HicA family	NA	A0A0D4DC32	Acinetobacter_phage	54.2	4.4e-13
AYZ43297.1|1259885_1260959_+	restriction endonuclease	NA	A0A1S5SAB0	Streptococcus_phage	40.7	2.1e-62
AYZ39754.1|1260999_1262538_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
AYZ39755.1|1262645_1263941_-	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	30.9	2.8e-21
AYZ39756.1|1264070_1265222_-	L-threonine dehydrogenase	NA	NA	NA	NA	NA
AYZ39757.1|1265412_1267257_-|tRNA	selenocysteinyl-tRNA-specific translation elongation factor SelB	tRNA	A0A2K9KZ60	Tupanvirus	26.9	1.5e-15
AYZ39758.1|1267253_1268645_-|tRNA	L-selenocysteinyl-tRNA(Sec) synthase	tRNA	NA	NA	NA	NA
AYZ39759.1|1268742_1269351_-	glutathione S-transferase	NA	NA	NA	NA	NA
AYZ39760.1|1269579_1273815_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	43.0	1.3e-22
>prophage 92
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1299838	1309345	5231450		Rhizobium_phage(16.67%)	10	NA	NA
AYZ39780.1|1299838_1300090_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
AYZ39781.1|1300231_1300663_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AYZ39782.1|1300686_1300884_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ39783.1|1300907_1302452_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AYZ39784.1|1302461_1303745_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
AYZ39785.1|1303748_1304708_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AYZ39786.1|1304694_1305729_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	7.5e-09
AYZ39787.1|1305967_1306993_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
AYZ39788.1|1307002_1308199_-	2-amino-3-ketobutyrate CoA ligase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
AYZ39789.1|1308412_1309345_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
>prophage 93
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1313504	1314533	5231450		Archaeal_BJ1_virus(100.0%)	1	NA	NA
AYZ39794.1|1313504_1314533_-	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.9	4.2e-12
>prophage 94
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1321971	1337923	5231450		uncultured_Mediterranean_phage(11.11%)	18	NA	NA
AYZ39802.1|1321971_1322451_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
AYZ39803.1|1322489_1323299_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
AYZ39804.1|1323396_1323564_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
AYZ39805.1|1323584_1323821_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
AYZ39806.1|1324037_1324706_-	JAB domain-containing protein	NA	NA	NA	NA	NA
AYZ39807.1|1324877_1326098_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	8.5e-44
AYZ43300.1|1326078_1326534_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	7.3e-49
AYZ39808.1|1326640_1327237_+	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
AYZ39809.1|1327282_1328242_-	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	28.0	2.2e-10
AYZ39810.1|1328539_1329181_-	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
AYZ39811.1|1329246_1329963_-	ribonuclease PH	NA	NA	NA	NA	NA
AYZ39812.1|1330089_1330953_+	YicC family protein	NA	NA	NA	NA	NA
AYZ39813.1|1331173_1331998_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.0	2.8e-91
AYZ39814.1|1332288_1332906_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
AYZ39815.1|1332902_1334585_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.1	7.4e-22
AYZ39816.1|1334842_1335466_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
AYZ39817.1|1335520_1335796_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AYZ39818.1|1335814_1337923_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis(diphosphate) 3'-diphosphatase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 95
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1342224	1343616	5231450		environmental_Halophage(100.0%)	1	NA	NA
AYZ39822.1|1342224_1343616_+	xanthine permease XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 96
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1381790	1383125	5231450		Moraxella_phage(100.0%)	1	NA	NA
AYZ43301.1|1381790_1383125_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	37.2	6.6e-66
>prophage 97
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1393781	1402258	5231450		Micromonas_sp._RCC1109_virus(25.0%)	9	NA	NA
AYZ39854.1|1393781_1395470_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.9	3.2e-57
AYZ39855.1|1395575_1395674_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
AYZ39856.1|1396238_1396328_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
AYZ39857.1|1396607_1397792_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	6.8e-14
AYZ39858.1|1397799_1398297_-	radical SAM protein	NA	NA	NA	NA	NA
AYZ39859.1|1398293_1398656_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
AYZ39860.1|1398645_1398993_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
AYZ39861.1|1399052_1400546_-	hypothetical protein	NA	A0A2K9L727	Tupanvirus	28.3	3.3e-29
AYZ39862.1|1400542_1402258_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	3.3e-41
>prophage 98
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1409118	1410072	5231450		Synechococcus_phage(50.0%)	2	NA	NA
AYZ39868.1|1409118_1409547_-	heat-shock protein IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
AYZ39869.1|1409658_1410072_-	heat-shock protein IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 99
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1414499	1415648	5231450		Oenococcus_phage(100.0%)	1	NA	NA
AYZ39873.1|1414499_1415648_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.6	1.0e-51
>prophage 100
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1420256	1427625	5231450		Bacillus_virus(33.33%)	7	NA	NA
AYZ39879.1|1420256_1422671_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.4	8.2e-115
AYZ39880.1|1422699_1423773_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
AYZ39881.1|1423772_1424873_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
AYZ39882.1|1424877_1426281_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AYZ39883.1|1426887_1427028_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
AYZ39884.1|1427044_1427404_+	ribonuclease P protein component	NA	NA	NA	NA	NA
AYZ39885.1|1427367_1427625_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 101
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1437826	1439164	5231450		Moraxella_phage(100.0%)	1	NA	NA
AYZ39894.1|1437826_1439164_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.7	4.5e-62
>prophage 102
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1448153	1451993	5231450		Bacillus_phage(50.0%)	4	NA	NA
AYZ39899.1|1448153_1448927_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
AYZ39900.1|1449017_1449908_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
AYZ39901.1|1449907_1450867_-	phosphate ABC transporter permease	NA	NA	NA	NA	NA
AYZ39902.1|1450952_1451993_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.1	8.0e-51
>prophage 103
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1457527	1460889	5231450		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
AYZ39907.1|1457527_1459357_-	glutamine--fructose-6-phosphate aminotransferase	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.2	3.3e-132
AYZ39908.1|1459518_1460889_-	bifunctional N-acetylglucosamine-1-phosphate uridyltransferase/glucosamine-1-phosphate acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	2.4e-34
>prophage 104
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1472839	1473832	5231450		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
AYZ39922.1|1472839_1473832_+	asparagine synthetase A	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 105
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1477000	1482853	5231450		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
AYZ39925.1|1477000_1478869_+	low affinity potassium transport system protein kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	1.0e-64
AYZ43307.1|1479035_1479455_+	D-ribose pyranase	NA	NA	NA	NA	NA
AYZ39926.1|1479462_1480968_+	ribose import ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
AYZ39927.1|1480972_1481938_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
AYZ39928.1|1481962_1482853_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 106
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1496240	1497887	5231450		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AYZ39935.1|1496240_1497887_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.6	1.6e-66
>prophage 107
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1505483	1510896	5231450		Bacillus_phage(33.33%)	4	NA	NA
AYZ39942.1|1505483_1507505_+	ATP-dependent DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	3.8e-113
AYZ39943.1|1507551_1509036_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
AYZ39944.1|1509170_1510436_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
AYZ39945.1|1510566_1510896_+	thiol reductase thioredoxin	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 108
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1514926	1521070	5231450		Enterobacteria_phage(40.0%)	6	NA	NA
AYZ39950.1|1514926_1516057_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.9e-27
AYZ39951.1|1516053_1517316_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
AYZ39952.1|1517315_1518383_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	2.7e-102
AYZ39953.1|1518401_1519283_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.0	4.3e-106
AYZ39954.1|1519260_1519935_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
AYZ39955.1|1519939_1521070_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 109
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1529144	1530800	5231450		Tetraselmis_virus(100.0%)	1	NA	NA
AYZ39962.1|1529144_1530800_-	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	1.0e-44
>prophage 110
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1541692	1545551	5231450		Bacillus_phage(100.0%)	3	NA	NA
AYZ39974.1|1541692_1542589_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
AYZ39975.1|1542588_1543305_+	flavin mononucleotide phosphatase YigB	NA	NA	NA	NA	NA
AYZ39976.1|1543388_1545551_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 111
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1555303	1558714	5231450	transposase	Catovirus(50.0%)	3	NA	NA
AYZ43313.1|1555303_1557133_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.6	1.6e-83
AYZ39987.1|1557196_1557817_+	threonine export protein RhtC	NA	NA	NA	NA	NA
AYZ39988.1|1557853_1558714_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	1.2e-65
>prophage 112
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1584584	1587871	5231450		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
AYZ40014.1|1584584_1586225_+	ubiquinone biosynthesis protein UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	4.8e-42
AYZ40015.1|1586303_1586573_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
AYZ40016.1|1586576_1587092_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
AYZ40017.1|1587094_1587871_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 113
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1596660	1597275	5231450		Streptococcus_phage(100.0%)	1	NA	NA
AYZ40025.1|1596660_1597275_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 114
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1610965	1613752	5231450		uncultured_virus(100.0%)	1	NA	NA
AYZ40036.1|1610965_1613752_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	31.9	6.4e-71
>prophage 115
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1617869	1620340	5231450		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
AYZ43314.1|1617869_1619279_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
AYZ40041.1|1619290_1620340_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 116
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1639772	1642552	5231450		Staphylococcus_phage(50.0%)	3	NA	NA
AYZ40056.1|1639772_1640669_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
AYZ40057.1|1640836_1641733_+	sugar kinase	NA	NA	NA	NA	NA
AYZ40058.1|1641766_1642552_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
>prophage 117
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1650849	1653900	5231450		Escherichia_phage(100.0%)	1	NA	NA
AYZ40070.1|1650849_1653900_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 118
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1670323	1675183	5231450		Bacillus_thuringiensis_phage(33.33%)	5	NA	NA
AYZ40084.1|1670323_1670944_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	6.4e-64
AYZ40085.1|1671203_1672187_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
AYZ40086.1|1672335_1673010_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
AYZ40087.1|1673114_1674488_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
AYZ40088.1|1674484_1675183_-	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 119
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1686757	1691260	5231450		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
AYZ40100.1|1686757_1687603_-	glycerol facilitator	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
AYZ40101.1|1688027_1688273_+	cell division protein ZapB	NA	NA	NA	NA	NA
AYZ40102.1|1688357_1688843_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AYZ40103.1|1688935_1689862_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AYZ40104.1|1689928_1691260_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 120
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1696897	1701082	5231450		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AYZ40110.1|1696897_1701082_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.3	4.8e-22
>prophage 121
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1710249	1711803	5231450		Pandoravirus(100.0%)	1	NA	NA
AYZ40117.1|1710249_1711803_+	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	24.2	2.3e-09
>prophage 122
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1718671	1725918	5231450		Synechococcus_phage(33.33%)	5	NA	NA
AYZ40123.1|1718671_1719334_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	4.2e-29
AYZ40124.1|1719345_1721847_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
AYZ43319.1|1722155_1723235_+	fructose-like permease IIC component 2	NA	NA	NA	NA	NA
AYZ40125.1|1723249_1723570_+	fructose-like phosphotransferase enzyme IIB component 2	NA	NA	NA	NA	NA
AYZ40126.1|1723620_1725918_+	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 123
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1737973	1739188	5231450		Oenococcus_phage(100.0%)	1	NA	NA
AYZ40136.1|1737973_1739188_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.6	1.7e-44
>prophage 124
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1745662	1747507	5231450		Acinetobacter_phage(100.0%)	1	NA	NA
AYZ40142.1|1745662_1747507_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.6	5.5e-10
>prophage 125
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1755843	1758896	5231450		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
AYZ40146.1|1755843_1756794_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
AYZ40147.1|1757711_1758896_+	translation elongation factor EF-Tu 2	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 126
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1762891	1771220	5231450		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
AYZ40154.1|1762891_1766920_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
AYZ40155.1|1766996_1771220_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.4	2.5e-66
>prophage 127
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1779516	1781280	5231450		Klosneuvirus(50.0%)	3	NA	NA
AYZ40165.1|1779516_1780188_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
AYZ40166.1|1780230_1780821_+	DUF416 family protein	NA	NA	NA	NA	NA
AYZ40167.1|1781007_1781280_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 128
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1786648	1788238	5231450		Prochlorococcus_phage(100.0%)	1	NA	NA
AYZ40172.1|1786648_1788238_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	48.1	5.8e-69
>prophage 129
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1801573	1805257	5231450		Dickeya_phage(100.0%)	1	NA	NA
AYZ40179.1|1801573_1805257_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 130
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1817682	1923316	5231450	holin,transposase,portal,head,capsid,tail,lysis,integrase,plate,tRNA,terminase,protease	Escherichia_phage(28.0%)	121	1900355:1900370	1921608:1921623
AYZ40193.1|1817682_1818474_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	2.0e-46
AYZ40194.1|1818487_1818943_-	hypothetical protein	NA	F6MIM0	Haemophilus_phage	42.7	6.6e-26
AYZ40195.1|1818939_1819647_-	DUF4376 domain-containing protein	NA	A0A0E3JQ06	Enterobacteria_phage	42.4	5.3e-14
AYZ40196.1|1819643_1821254_-	short-chain fatty acid transporter	NA	A0A0M3ULH6	Salmonella_phage	39.1	3.8e-84
AYZ40197.1|1821256_1821973_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	37.2	3.1e-22
AYZ40198.1|1821965_1823081_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	51.7	2.0e-100
AYZ40199.1|1823071_1823431_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	1.1e-34
AYZ40200.1|1823529_1824231_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	36.3	6.4e-12
AYZ40201.1|1824240_1825281_-	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.1	2.0e-73
AYZ40202.1|1825268_1825478_-	hypothetical protein	NA	A4JWL2	Burkholderia_virus	60.3	1.3e-16
AYZ40203.1|1825477_1826431_-	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.0	2.8e-34
AYZ43322.1|1827843_1828281_+	PecM	NA	NA	NA	NA	NA
AYZ40204.1|1828312_1829512_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AYZ40205.1|1829590_1830268_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AYZ43323.1|1830299_1830542_-	relaxase	NA	NA	NA	NA	NA
AYZ40206.1|1832163_1832868_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYZ43324.1|1833011_1833566_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
AYZ43325.1|1833696_1834527_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
AYZ40207.1|1835158_1835863_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYZ40208.1|1835969_1836830_+	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
AYZ40209.1|1836842_1837385_+	tunicamycin resistance protein	NA	NA	NA	NA	NA
AYZ40210.1|1838578_1839283_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYZ40211.1|1841604_1841937_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
AYZ40212.1|1841983_1842859_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
AYZ40213.1|1843114_1844377_-|transposase	IS1380 family transposase ISEc9	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AYZ40214.1|1844473_1845523_-|tail	phage tail protein	tail	NA	NA	NA	NA
AYZ40215.1|1845624_1845753_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AYZ40216.1|1845712_1846030_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AYZ40217.1|1846080_1846605_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	9.5e-69
AYZ40218.1|1846604_1848029_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.2	7.0e-191
AYZ40219.1|1848018_1848216_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ40220.1|1848212_1848668_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ40221.1|1848812_1849127_-	hypothetical protein	NA	Q5ZQY8	Pseudomonas_phage	43.2	9.2e-19
AYZ40222.1|1849139_1849745_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.1	3.3e-57
AYZ40223.1|1849747_1850035_-	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	48.6	3.9e-16
AYZ40224.1|1850572_1850920_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	49.0	2.2e-21
AYZ40225.1|1850974_1852324_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
AYZ40226.1|1852848_1854498_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYZ40227.1|1854852_1855095_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ40228.1|1855208_1855847_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
AYZ40229.1|1855843_1856581_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ40230.1|1856580_1858677_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
AYZ40231.1|1858723_1859002_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ40232.1|1859215_1859626_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
AYZ40233.1|1859719_1860610_-	maltose ABC transporter permease	NA	NA	NA	NA	NA
AYZ40234.1|1860624_1862169_-	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
AYZ40235.1|1862322_1863513_-	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
AYZ40236.1|1863877_1864993_+	maltose/maltodextrin import ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
AYZ40237.1|1865064_1866405_+	maltoporin	NA	NA	NA	NA	NA
AYZ40238.1|1866647_1867568_+	maltose operon protein MalM	NA	NA	NA	NA	NA
AYZ40239.1|1867795_1869376_+	SopA family protein	NA	NA	NA	NA	NA
AYZ40240.1|1869598_1870096_+	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
AYZ40241.1|1870108_1870981_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
AYZ43326.1|1871135_1873559_-	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
AYZ40242.1|1873729_1874098_+	diacylglycerol kinase	NA	NA	NA	NA	NA
AYZ40243.1|1874207_1874816_+	LexA repressor	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
AYZ40244.1|1874888_1876214_+	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
AYZ40245.1|1876329_1876539_+	CsbD family protein	NA	NA	NA	NA	NA
AYZ40246.1|1876580_1877096_-	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
AYZ40247.1|1877413_1878418_+	DUF2713 family protein	NA	NA	NA	NA	NA
AYZ40248.1|1878779_1878902_+|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
AYZ43327.1|1879164_1879710_+	DUF4065 domain-containing protein	NA	NA	NA	NA	NA
AYZ40249.1|1879706_1880126_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ40250.1|1880386_1880668_-	pyocin activator protein PrtN	NA	K7PGU0	Enterobacteria_phage	96.8	2.8e-43
AYZ40251.1|1880704_1881487_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ40252.1|1881675_1882500_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	3.0e-149
AYZ40253.1|1882565_1882928_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
AYZ40254.1|1882942_1883143_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ40255.1|1883295_1883526_-	hypothetical protein	NA	A0A291AWY6	Escherichia_phage	97.4	2.5e-13
AYZ40256.1|1883595_1884270_-	LexA family transcriptional regulator	NA	Q8SBF6	Shigella_phage	100.0	3.5e-132
AYZ40257.1|1884360_1884561_+	transcriptional regulator	NA	U5P445	Shigella_phage	98.5	1.3e-31
AYZ40258.1|1884604_1885162_+	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	93.5	1.0e-92
AYZ40259.1|1885337_1885517_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	4.6e-15
AYZ40260.1|1885506_1886448_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	92.3	3.2e-139
AYZ40261.1|1886444_1886933_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	93.2	8.6e-80
AYZ40262.1|1886932_1887586_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	3.3e-127
AYZ40263.1|1887582_1887909_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
AYZ40264.1|1887905_1888295_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	99.2	1.6e-68
AYZ40265.1|1888314_1889124_+	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	99.6	8.2e-152
AYZ40266.1|1889131_1890121_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	6.2e-194
AYZ40267.1|1890134_1890887_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	97.2	4.2e-134
AYZ40268.1|1891079_1891283_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ43328.1|1891412_1891748_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	93.7	2.5e-54
AYZ40269.1|1891751_1892228_+	lysozyme	NA	K7PKV2	Enterobacteria_phage	94.3	6.2e-83
AYZ40270.1|1892224_1892668_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	94.6	2.3e-71
AYZ40271.1|1892706_1893081_+	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	96.0	1.8e-61
AYZ40272.1|1893198_1893402_+	hypothetical protein	NA	A0A1W6JPG4	Morganella_phage	52.9	4.9e-13
AYZ43329.1|1893467_1893818_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	96.6	1.2e-62
AYZ40273.1|1893944_1894439_+|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	100.0	2.3e-88
AYZ43330.1|1894672_1896169_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.6	1.7e-299
AYZ40274.1|1896180_1896363_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	98.3	3.8e-25
AYZ40275.1|1896362_1897604_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.0	2.9e-241
AYZ40276.1|1897581_1898232_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.5	7.3e-119
AYZ40277.1|1898246_1899452_+|capsid	phage major capsid protein	capsid	A0A1B5FPI9	Escherichia_phage	99.0	1.7e-222
AYZ40278.1|1899501_1899690_+	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	93.5	8.8e-25
AYZ40279.1|1899701_1900007_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	87.1	3.9e-38
AYZ40280.1|1900016_1900355_+|head,tail	head-tail adaptor protein	head,tail	A0A1B5FP90	Escherichia_phage	84.8	4.6e-48
AYZ40281.1|1900351_1900801_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	78.5	1.3e-61
1900355:1900370	attL	ACGGATTTTAGTCTGG	NA	NA	NA	NA
AYZ40282.1|1900797_1901142_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	94.7	1.9e-54
AYZ40283.1|1901201_1901906_+|tail	phage tail protein	tail	A0A1B5FP82	Escherichia_phage	90.6	1.8e-110
AYZ40284.1|1901920_1902292_+|tail	phage tail protein	tail	A0A1B5FP91	Escherichia_phage	90.2	3.1e-58
AYZ40285.1|1902315_1902594_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	80.4	1.5e-33
AYZ40286.1|1902652_1902994_+	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	64.5	7.6e-35
AYZ40287.1|1903039_1906282_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	88.8	0.0e+00
AYZ40288.1|1906274_1906616_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	66.4	7.9e-40
AYZ40289.1|1906615_1907314_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	98.3	1.8e-131
AYZ40290.1|1907318_1908062_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	99.2	4.4e-152
AYZ40291.1|1907959_1908607_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	98.6	2.7e-113
AYZ40292.1|1908667_1912147_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.0	0.0e+00
AYZ43331.1|1912214_1912814_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	92.5	3.4e-102
AYZ40293.1|1912878_1915227_+|tail	phage tail protein	tail	A0A0E3M0V5	Enterobacteria_phage	46.3	9.5e-92
AYZ40294.1|1915223_1915505_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	4.1e-18
AYZ40295.1|1915514_1916219_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	7.0e-59
AYZ40296.1|1916229_1916517_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ40297.1|1916627_1916876_-	damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
AYZ40298.1|1916937_1918035_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.2	4.0e-210
AYZ40299.1|1918123_1919161_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AYZ40300.1|1919294_1919537_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
AYZ40301.1|1919702_1920686_-	quinone oxidoreductase	NA	NA	NA	NA	NA
AYZ40302.1|1920768_1922184_+	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.3	4.8e-200
1921608:1921623	attR	CCAGACTAAAATCCGT	NA	NA	NA	NA
AYZ40303.1|1922236_1923316_+	alanine racemase biosynthetic	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
>prophage 131
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1927523	1931137	5231450		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
AYZ40309.1|1927523_1930346_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
AYZ40310.1|1930296_1930479_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ40311.1|1930600_1931137_+	ssDNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 132
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1934954	1936304	5231450		Moraxella_phage(100.0%)	1	NA	NA
AYZ40316.1|1934954_1936304_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.4	3.0e-159
>prophage 133
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1940358	1942317	5231450		Staphylococcus_phage(100.0%)	1	NA	NA
AYZ40320.1|1940358_1942317_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.2	1.6e-89
>prophage 134
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1951714	1953862	5231450		Escherichia_phage(100.0%)	1	NA	NA
AYZ40330.1|1951714_1953862_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 135
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1959107	1965476	5231450		Tetraselmis_virus(50.0%)	5	NA	NA
AYZ40335.1|1959107_1961093_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	42.4	2.3e-139
AYZ40336.1|1961365_1962295_-	allose kinase	NA	NA	NA	NA	NA
AYZ40337.1|1962278_1962974_-	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
AYZ40338.1|1962984_1963965_-	D-allose ABC transporter permease	NA	NA	NA	NA	NA
AYZ40339.1|1963943_1965476_-	D-allose ABC transporter ATP-binding protein AlsA	NA	G3M9Y6	Bacillus_virus	27.4	7.5e-13
>prophage 136
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1971598	1973148	5231450		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
AYZ40347.1|1971598_1972279_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	8.7e-06
AYZ40348.1|1972389_1973148_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	7.9e-16
>prophage 137
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1978711	1979500	5231450		Pithovirus(100.0%)	1	NA	NA
AYZ40356.1|1978711_1979500_-	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.2	3.2e-12
>prophage 138
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	1984340	1985843	5231450		Burkholderia_virus(100.0%)	1	NA	NA
AYZ40360.1|1984340_1985843_+	proline/betaine transporter	NA	Q6JIH2	Burkholderia_virus	31.2	2.4e-56
>prophage 139
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2005408	2008620	5231450	tRNA	Catovirus(50.0%)	2	NA	NA
AYZ40376.1|2005408_2006926_-|tRNA	lysine--tRNA ligase heat inducible	tRNA	A0A1V0SAC0	Catovirus	38.0	1.2e-87
AYZ40377.1|2007162_2008620_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.6	4.0e-48
>prophage 140
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2022897	2024881	5231450		Cronobacter_phage(50.0%)	2	NA	NA
AYZ40388.1|2022897_2023191_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
AYZ40389.1|2023234_2024881_+	molecular chaperone GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 141
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2029082	2029616	5231450		Morganella_phage(100.0%)	1	NA	NA
AYZ40397.1|2029082_2029616_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 142
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2034536	2035514	5231450		Tupanvirus(100.0%)	1	NA	NA
AYZ40403.1|2034536_2035514_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 143
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2042941	2043487	5231450		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AYZ40408.1|2042941_2043487_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 144
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2047402	2060433	5231450	protease,tRNA	Vibrio_phage(20.0%)	11	NA	NA
AYZ40412.1|2047402_2048740_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
AYZ40413.1|2048749_2050597_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	3.4e-60
AYZ40414.1|2050589_2051540_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AYZ40415.1|2051625_2051934_+	RNA-binding protein Hfq	NA	NA	NA	NA	NA
AYZ40416.1|2052009_2053290_+	GTPase HflX	NA	NA	NA	NA	NA
AYZ40417.1|2053375_2054635_+|protease	protease modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
AYZ40418.1|2054637_2055642_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
AYZ40419.1|2055723_2055921_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
AYZ40420.1|2056024_2057323_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
AYZ40421.1|2057527_2057953_+	transcriptional regulator	NA	NA	NA	NA	NA
AYZ40422.1|2057991_2060433_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
>prophage 145
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2064365	2065529	5231450		Ralstonia_phage(100.0%)	1	NA	NA
AYZ40429.1|2064365_2065529_+	glutathionylspermidine synthase preATP-grasp family protein	NA	B2ZXR7	Ralstonia_phage	43.8	1.8e-80
>prophage 146
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2107096	2173221	5231450	transposase,holin,protease,tRNA	Vibrio_phage(17.65%)	58	NA	NA
AYZ40473.1|2107096_2107627_-	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
AYZ40474.1|2107936_2108893_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYZ40475.1|2109025_2110528_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	8.1e-12
AYZ40476.1|2110541_2111564_+	ABC transporter permease	NA	NA	NA	NA	NA
AYZ40477.1|2111550_2112546_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
AYZ40478.1|2112578_2113577_-	fructose 1,6-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
AYZ40479.1|2113752_2115126_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
AYZ40480.1|2115281_2115833_-	ribosome-associated protein	NA	NA	NA	NA	NA
AYZ40481.1|2115926_2117279_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
AYZ40482.1|2117461_2117848_+	soluble cytochrome b562	NA	NA	NA	NA	NA
AYZ40483.1|2117892_2118357_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	1.1e-52
AYZ40484.1|2118514_2120653_-	anaerobic ribonucleoside triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
AYZ40485.1|2121046_2122702_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
AYZ40486.1|2122751_2124173_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
AYZ40487.1|2124291_2125239_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
AYZ43338.1|2125423_2125477_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
AYZ40488.1|2125617_2128314_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
AYZ40489.1|2128519_2128906_-	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
AYZ40490.1|2128978_2129440_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AYZ40491.1|2129452_2130388_-	aspartate carbamoyltransferase catalytic subunit	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
AYZ40492.1|2130391_2130526_-	pyrBI operon leader peptide	NA	NA	NA	NA	NA
AYZ40493.1|2130806_2131202_-	RidA family protein	NA	NA	NA	NA	NA
AYZ40494.1|2131332_2132046_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AYZ40495.1|2132116_2132710_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYZ40496.1|2132854_2133307_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
AYZ40497.1|2133428_2134403_+	DNA-binding protein	NA	NA	NA	NA	NA
AYZ40498.1|2134418_2134772_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ40499.1|2134758_2134989_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ40500.1|2135089_2136094_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AYZ40501.1|2136255_2136672_+	regulator of ribonuclease activity B	NA	NA	NA	NA	NA
AYZ40502.1|2136717_2137221_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYZ40503.1|2137413_2138610_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
AYZ40504.1|2138665_2141521_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
AYZ40505.1|2141520_2141964_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AYZ40506.1|2142219_2143731_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
AYZ40507.1|2143997_2145098_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
AYZ40508.1|2145097_2146180_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
AYZ40509.1|2146340_2147843_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.2	4.6e-84
AYZ40510.1|2147920_2148919_-	transcriptional regulator	NA	NA	NA	NA	NA
AYZ40511.1|2148985_2150305_-	gnt-II system L-idonate transporter	NA	NA	NA	NA	NA
AYZ40512.1|2150366_2151131_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
AYZ40513.1|2151154_2152186_-	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
AYZ40514.1|2152402_2152966_+	thermosensitive gluconokinase	NA	NA	NA	NA	NA
AYZ40515.1|2152969_2153989_-	aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.1e-44
AYZ40516.1|2158546_2159875_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
AYZ40517.1|2160501_2161719_+	MFS transporter	NA	NA	NA	NA	NA
AYZ43339.1|2161730_2162849_+	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AYZ40518.1|2162891_2163017_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ40519.1|2163069_2163327_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ40520.1|2163640_2164807_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.8e-184
AYZ40521.1|2164742_2165156_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
AYZ40522.1|2165115_2165274_-|holin	choline transporter	holin	NA	NA	NA	NA
AYZ43340.1|2165218_2167216_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
AYZ40523.1|2168272_2169424_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
AYZ40524.1|2169380_2169749_-|transposase	transposase	transposase	NA	NA	NA	NA
AYZ40525.1|2170682_2170940_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ40526.1|2171496_2172264_-	Fe(3+) dicitrate transport ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
AYZ40527.1|2172264_2173221_-	Fe3+ dicitrate ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	8.2e-18
>prophage 147
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2181212	2185539	5231450	transposase	Stx2-converting_phage(75.0%)	5	NA	NA
AYZ40534.1|2181212_2181404_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.4e-06
AYZ40535.1|2181782_2183141_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
AYZ40536.1|2183379_2184765_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.5	6.9e-260
AYZ40537.1|2184814_2185162_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AYZ43341.1|2185158_2185539_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
>prophage 148
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2197756	2200166	5231450		Yersinia_phage(33.33%)	4	NA	NA
AYZ40553.1|2197756_2198575_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.3	6.1e-46
AYZ40554.1|2198916_2199390_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	29.6	3.3e-12
AYZ40555.1|2199405_2199882_+	DNA repair protein RadC	NA	NA	NA	NA	NA
AYZ40556.1|2199944_2200166_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
>prophage 149
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2222673	2231660	5231450	transposase	Escherichia_phage(60.0%)	6	NA	NA
AYZ40579.1|2222673_2223690_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	1.1e-185
AYZ43343.1|2224304_2225285_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	56.6	4.7e-101
AYZ40580.1|2225923_2227196_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AYZ40581.1|2227811_2228528_-	N-acetylneuraminic acid outer membrane channel protein NanC	NA	NA	NA	NA	NA
AYZ40582.1|2229983_2230586_+	type 1 fimbriae regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
AYZ40583.1|2231063_2231660_+	type 1 fimbriae regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 150
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2241927	2243388	5231450		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AYZ40593.1|2241927_2243388_+	D-mannonate oxidoreductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.9	4.7e-49
>prophage 151
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2249956	2250511	5231450		Clostridioides_phage(100.0%)	1	NA	NA
AYZ40603.1|2249956_2250511_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 152
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2258024	2258945	5231450	transposase	Sodalis_phage(100.0%)	1	NA	NA
AYZ40611.1|2258024_2258945_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.7	2.6e-61
>prophage 153
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2264743	2271088	5231450		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AYZ40614.1|2264743_2271088_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	22.4	7.1e-49
>prophage 154
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2297200	2302532	5231450		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
AYZ40634.1|2297200_2298832_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.5	8.8e-12
AYZ40635.1|2300456_2301371_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYZ40636.1|2301509_2302532_+	L-galactonate-5-dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
>prophage 155
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2305759	2307039	5231450		Shigella_phage(50.0%)	2	NA	NA
AYZ40638.1|2305759_2306497_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
AYZ40639.1|2306499_2307039_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 156
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2315046	2317922	5231450		Streptococcus_phage(50.0%)	3	NA	NA
AYZ40649.1|2315046_2316636_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
AYZ40650.1|2317028_2317634_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
AYZ40651.1|2317742_2317922_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	2.0e-10
>prophage 157
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2324059	2325382	5231450		Geobacillus_virus(100.0%)	1	NA	NA
AYZ40657.1|2324059_2325382_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 158
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2332089	2333322	5231450		Enterococcus_phage(100.0%)	1	NA	NA
AYZ40664.1|2332089_2333322_+	trifunctional nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase/transcriptional regulator NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
>prophage 159
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2337598	2341414	5231450		Klosneuvirus(50.0%)	2	NA	NA
AYZ40671.1|2337598_2339266_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
AYZ40672.1|2339476_2341414_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 160
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2344600	2346714	5231450		Bacillus_phage(50.0%)	2	NA	NA
AYZ40677.1|2344600_2345290_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
AYZ40678.1|2345289_2346714_+	two-component sensor histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.3	3.2e-10
>prophage 161
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2358369	2365742	5231450		Cyanophage(25.0%)	8	NA	NA
AYZ40688.1|2358369_2359323_+	transaldolase B	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
AYZ40689.1|2359437_2360025_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
AYZ40690.1|2360059_2360626_-	acetate uptake transporter	NA	NA	NA	NA	NA
AYZ40691.1|2360774_2361488_-	acidic protein MsyB	NA	NA	NA	NA	NA
AYZ40692.1|2361513_2361918_-	DUF2541 family protein	NA	NA	NA	NA	NA
AYZ40693.1|2362293_2364210_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
AYZ40694.1|2364298_2365429_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
AYZ40695.1|2365532_2365742_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	5.2e-18
>prophage 162
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2370196	2371363	5231450		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AYZ40698.1|2370196_2371363_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	7.5e-90
>prophage 163
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2380848	2383665	5231450	tRNA	Tupanvirus(100.0%)	1	NA	NA
AYZ40708.1|2380848_2383665_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 164
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2388091	2389240	5231450		Halovirus(100.0%)	1	NA	NA
AYZ40714.1|2388091_2389240_+	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 165
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2394743	2400403	5231450		Staphylococcus_phage(50.0%)	4	NA	NA
AYZ40719.1|2394743_2396297_-	ATP-dependent acyl-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.3	4.1e-35
AYZ40720.1|2396369_2397587_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
AYZ40721.1|2397715_2398858_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AYZ40722.1|2398888_2400403_-	L-carnitine/gamma-butyrobetaine antiporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 166
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2408296	2410257	5231450		Bacillus_phage(50.0%)	4	NA	NA
AYZ43352.1|2408296_2408776_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
AYZ40730.1|2408861_2409095_+	antitoxin	NA	NA	NA	NA	NA
AYZ40731.1|2409097_2409412_+	plasmid maintenance protein CcdB	NA	NA	NA	NA	NA
AYZ40732.1|2409408_2410257_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.1e-08
>prophage 167
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2419343	2424765	5231450		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
AYZ40741.1|2419343_2422250_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
AYZ40742.1|2422413_2424765_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.2	1.3e-37
>prophage 168
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2431096	2431795	5231450		Planktothrix_phage(100.0%)	1	NA	NA
AYZ40747.1|2431096_2431795_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	6.2e-23
>prophage 169
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2440612	2446008	5231450		Micromonas_sp._RCC1109_virus(50.0%)	5	NA	NA
AYZ40755.1|2440612_2442184_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	23.4	4.5e-05
AYZ40756.1|2442276_2442363_-	leu operon leader peptide	NA	NA	NA	NA	NA
AYZ40757.1|2443021_2443966_+	transcriptional regulator LeuO	NA	NA	NA	NA	NA
AYZ43354.1|2444120_2444165_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ40758.1|2444283_2446008_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.9e-36
>prophage 170
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2471979	2473023	5231450		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AYZ40784.1|2471979_2473023_+	guanosine monophosphate reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 171
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2477268	2477820	5231450		Sphingobium_phage(100.0%)	1	NA	NA
AYZ40789.1|2477268_2477820_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	1.1e-11
>prophage 172
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2486330	2487755	5231450		Erysipelothrix_phage(100.0%)	1	NA	NA
AYZ40795.1|2486330_2487755_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 173
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2495501	2501969	5231450		Mamastrovirus(33.33%)	5	NA	NA
AYZ40802.1|2495501_2497052_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
AYZ40803.1|2497098_2499489_-	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
AYZ40804.1|2499694_2500231_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
AYZ40805.1|2500271_2500934_-	carbonate dehydratase	NA	NA	NA	NA	NA
AYZ40806.1|2501042_2501969_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 174
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2505231	2506164	5231450	transposase	Sodalis_phage(100.0%)	1	NA	NA
AYZ40811.1|2505231_2506164_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	48.8	1.7e-60
>prophage 175
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2516344	2523150	5231450	tRNA	unidentified_phage(50.0%)	6	NA	NA
AYZ40823.1|2516344_2517763_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
AYZ40824.1|2517801_2518728_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AYZ40825.1|2518764_2519220_-	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
AYZ40826.1|2519397_2520102_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AYZ40827.1|2520116_2520647_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
AYZ40828.1|2520720_2523150_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	31.4	6.0e-41
>prophage 176
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2528237	2529035	5231450		Planktothrix_phage(100.0%)	1	NA	NA
AYZ40831.1|2528237_2529035_+	iron(3+)-hydroxamate import ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 177
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2535069	2535414	5231450		Lake_Baikal_phage(100.0%)	1	NA	NA
AYZ40836.1|2535069_2535414_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 178
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2539343	2540768	5231450	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AYZ40841.1|2539343_2540768_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.5e-26
>prophage 179
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2553065	2620528	5231450	plate,transposase,protease,tRNA	Flavobacterium_phage(10.0%)	57	NA	NA
AYZ40854.1|2553065_2553824_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
AYZ40855.1|2553836_2554694_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AYZ40856.1|2554705_2556058_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
AYZ40857.1|2556087_2558520_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
AYZ40858.1|2558641_2559127_+	chaperone protein Skp	NA	NA	NA	NA	NA
AYZ40859.1|2559130_2560156_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AYZ40860.1|2560260_2560716_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
AYZ40861.1|2560719_2561508_+	acyl-[acyl-carrier-protein]--UDP-N- acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AYZ40862.1|2561507_2562656_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AYZ40863.1|2562652_2563249_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
AYZ40864.1|2563285_2566768_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
AYZ40865.1|2566780_2567740_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
AYZ40866.1|2567838_2569980_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
AYZ40867.1|2570036_2570426_+	VOC family protein	NA	NA	NA	NA	NA
AYZ40868.1|2570490_2571789_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
AYZ40869.1|2571837_2572098_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
AYZ40870.1|2572084_2572285_-	YaeP family protein	NA	NA	NA	NA	NA
AYZ40871.1|2572450_2572996_+	YaeQ family protein	NA	NA	NA	NA	NA
AYZ40872.1|2572992_2573415_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AYZ40873.1|2573428_2574139_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
AYZ40874.1|2574294_2575119_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
AYZ40875.1|2575171_2576890_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AYZ40876.1|2577000_2577708_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
AYZ40877.1|2577704_2578109_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
AYZ40878.1|2578226_2579042_-	MetQ/NlpA family lipoprotein	NA	NA	NA	NA	NA
AYZ40879.1|2579081_2579735_-	methionine ABC transporter	NA	NA	NA	NA	NA
AYZ40880.1|2579727_2580759_-	methionine import ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
AYZ40881.1|2580946_2581519_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
AYZ40882.1|2587288_2588092_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	35.8	2.7e-38
AYZ40883.1|2588088_2589003_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYZ40884.1|2589243_2590044_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
AYZ40885.1|2590120_2590891_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYZ40886.1|2590938_2592297_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
AYZ40887.1|2592368_2593124_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AYZ40888.1|2593157_2593880_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYZ40889.1|2593876_2594344_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
AYZ43356.1|2594408_2595140_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
AYZ40890.1|2595674_2596460_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ40891.1|2597090_2597999_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ40892.1|2598042_2598525_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
AYZ40893.1|2598548_2599901_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ43357.1|2599911_2603346_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AYZ40894.1|2603454_2604870_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AYZ40895.1|2604874_2605618_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
AYZ40896.1|2605614_2608374_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.0	7.2e-83
AYZ40897.1|2608382_2609144_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AYZ40898.1|2609148_2610480_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AYZ40899.1|2610482_2611007_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AYZ40900.1|2611003_2612284_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AYZ40901.1|2612308_2613391_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AYZ40902.1|2613354_2615205_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AYZ40903.1|2615208_2615622_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AYZ40904.1|2615628_2617104_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AYZ40905.1|2617154_2617379_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ40906.1|2617413_2617914_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AYZ40907.1|2618610_2619129_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
AYZ40908.1|2619315_2620528_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.2	2.1e-103
>prophage 180
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2625115	2628943	5231450		Caulobacter_phage(50.0%)	6	NA	NA
AYZ40912.1|2625115_2625694_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	2.5e-14
AYZ40913.1|2625809_2626577_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
AYZ40914.1|2626547_2627288_-	transpeptidase	NA	NA	NA	NA	NA
AYZ43358.1|2627443_2627632_-	type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family	NA	NA	NA	NA	NA
AYZ40915.1|2627723_2627984_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
AYZ40916.1|2628169_2628943_+	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.3e-20
>prophage 181
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2634022	2635174	5231450		Mycobacterium_phage(100.0%)	1	NA	NA
AYZ40922.1|2634022_2635174_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	30.9	3.5e-31
>prophage 182
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2640672	2644384	5231450		Streptococcus_phage(66.67%)	3	NA	NA
AYZ40928.1|2640672_2641728_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	2.9e-117
AYZ40929.1|2642015_2643119_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.1	2.4e-61
AYZ40930.1|2643130_2644384_+	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	3.4e-96
>prophage 183
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2661427	2662279	5231450		Staphylococcus_phage(100.0%)	1	NA	NA
AYZ40948.1|2661427_2662279_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.2e-47
>prophage 184
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2668323	2671628	5231450		Staphylococcus_phage(50.0%)	4	NA	NA
AYZ40951.1|2668323_2669193_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	1.1e-53
AYZ40952.1|2669352_2669946_-	protein RclC	NA	NA	NA	NA	NA
AYZ40953.1|2669957_2670194_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AYZ40954.1|2670302_2671628_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.4	2.3e-111
>prophage 185
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2677016	2682954	5231450	holin	Catovirus(50.0%)	4	NA	NA
AYZ40960.1|2677016_2678705_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	1.2e-59
AYZ40961.1|2678718_2680191_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AYZ40962.1|2680204_2680792_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
AYZ40963.1|2680920_2682954_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 186
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2694016	2695066	5231450		Tupanvirus(100.0%)	1	NA	NA
AYZ40974.1|2694016_2695066_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.0	1.8e-71
>prophage 187
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2703447	2709042	5231450		Staphylococcus_phage(50.0%)	4	NA	NA
AYZ40983.1|2703447_2705334_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	2.4e-53
AYZ40984.1|2705570_2706830_+	cytosine permease	NA	NA	NA	NA	NA
AYZ40985.1|2706819_2708103_+	cytosine deaminase	NA	NA	NA	NA	NA
AYZ40986.1|2708142_2709042_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	1.9e-16
>prophage 188
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2713568	2717848	5231450		Herpes_simplex_virus(50.0%)	2	NA	NA
AYZ40991.1|2713568_2716643_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	97.9	0.0e+00
AYZ40992.1|2716765_2717848_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	98.6	4.5e-190
>prophage 189
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2723258	2725219	5231450		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
AYZ40997.1|2723258_2724209_+	acetaldehyde dehydrogenase (acetylating)	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	4.3e-35
AYZ40998.1|2724205_2725219_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	4.1e-44
>prophage 190
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2728300	2729410	5231450		Prochlorococcus_phage(100.0%)	1	NA	NA
AYZ41001.1|2728300_2729410_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 191
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2734706	2735474	5231450		Planktothrix_phage(100.0%)	1	NA	NA
AYZ41007.1|2734706_2735474_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	2.5e-25
>prophage 192
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2742412	2743570	5231450		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AYZ41013.1|2742412_2743570_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 193
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2750984	2752100	5231450		Bacillus_phage(100.0%)	1	NA	NA
AYZ41021.1|2750984_2752100_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 194
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2756386	2766355	5231450		Bacillus_phage(60.0%)	7	NA	NA
AYZ43367.1|2756386_2757298_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
AYZ41029.1|2757422_2758331_+	fructokinase	NA	NA	NA	NA	NA
AYZ43368.1|2758470_2759655_-	MFS transporter AraJ	NA	NA	NA	NA	NA
AYZ41030.1|2759780_2762924_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
AYZ41031.1|2762920_2764123_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
AYZ41032.1|2764312_2765002_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
AYZ41033.1|2765059_2766355_+	PAS domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
>prophage 195
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2774954	2783795	5231450	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
AYZ41040.1|2774954_2776082_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
AYZ41041.1|2776104_2776437_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
AYZ41042.1|2776464_2778312_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
AYZ41043.1|2778322_2779294_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
AYZ41044.1|2779422_2779770_+	HNH endonuclease	NA	NA	NA	NA	NA
AYZ41045.1|2779807_2780692_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
AYZ41046.1|2780989_2781529_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
AYZ41047.1|2781679_2782129_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AYZ41048.1|2782132_2783236_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	36.1	1.7e-54
AYZ41049.1|2783324_2783795_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 196
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2805229	2810276	5231450	protease	Agrobacterium_phage(25.0%)	4	NA	NA
AYZ41072.1|2805229_2805853_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
AYZ41073.1|2805978_2807253_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
AYZ41074.1|2807440_2809795_+|protease	Lon protease	protease	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
AYZ41075.1|2810003_2810276_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 197
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2813416	2814112	5231450		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AYZ41079.1|2813416_2814112_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 198
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2817435	2820982	5231450		Bacillus_phage(100.0%)	2	NA	NA
AYZ41083.1|2817435_2819208_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.5	1.8e-50
AYZ41084.1|2819200_2820982_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.5	3.1e-42
>prophage 199
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2829818	2832968	5231450		Leptospira_phage(100.0%)	1	NA	NA
AYZ41095.1|2829818_2832968_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 200
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2839806	2848264	5231450		Klosneuvirus(25.0%)	8	NA	NA
AYZ41102.1|2839806_2840358_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
AYZ41103.1|2840486_2842418_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
AYZ41104.1|2842470_2842800_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AYZ41105.1|2842799_2843405_+	recombination protein RecR	NA	NA	NA	NA	NA
AYZ41106.1|2843514_2845389_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	2.3e-117
AYZ41107.1|2845569_2846214_+	adenylate kinase	NA	NA	NA	NA	NA
AYZ41108.1|2846345_2847308_+	ferrochelatase	NA	NA	NA	NA	NA
AYZ41109.1|2847304_2848264_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	4.2e-14
>prophage 201
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2856454	2859696	5231450		Escherichia_phage(66.67%)	3	NA	NA
AYZ41116.1|2856454_2856757_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	80.0	1.3e-41
AYZ41117.1|2856792_2857134_+	addiction module antidote protein, HigA family	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
AYZ41118.1|2857191_2859696_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	5.0e-115
>prophage 202
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2866794	2867472	5231450		Bacillus_virus(100.0%)	1	NA	NA
AYZ41128.1|2866794_2867472_+	iron export ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	3.1e-27
>prophage 203
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2870608	2871295	5231450		Planktothrix_phage(100.0%)	1	NA	NA
AYZ41133.1|2870608_2871295_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.1	4.5e-34
>prophage 204
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2878094	2879876	5231450		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AYZ41139.1|2878094_2879876_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	7.8e-38
>prophage 205
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2886068	2887214	5231450		Streptococcus_phage(100.0%)	1	NA	NA
AYZ41145.1|2886068_2887214_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	1.6e-47
>prophage 206
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2898730	2975636	5231450	head,portal,capsid,transposase,lysis,tail,integrase,tRNA,terminase,protease	Enterobacteria_phage(57.63%)	84	2908882:2908928	2955814:2955860
AYZ41157.1|2898730_2900116_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
AYZ41158.1|2900151_2900673_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYZ41159.1|2900780_2900993_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
AYZ41160.1|2900994_2901861_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
AYZ41161.1|2902332_2902875_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
AYZ41162.1|2903094_2903787_+	molecular chaperone FimC	NA	NA	NA	NA	NA
AYZ41163.1|2903817_2906427_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AYZ41164.1|2906439_2907447_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
AYZ41165.1|2907457_2907973_+	fimbriae assembly protein	NA	NA	NA	NA	NA
AYZ43370.1|2907975_2908608_-	DNA-binding response regulator	NA	NA	NA	NA	NA
2908882:2908928	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
AYZ41166.1|2908941_2910105_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
AYZ41167.1|2909960_2910332_-	DNA-binding protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
AYZ41168.1|2910303_2910582_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
AYZ41169.1|2910629_2910848_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	97.2	5.4e-34
AYZ41170.1|2911239_2911431_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
AYZ41171.1|2911403_2911586_-	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
AYZ41172.1|2911582_2912263_-	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
AYZ41173.1|2912259_2913045_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.2	6.9e-148
AYZ41174.1|2913050_2913347_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
AYZ41175.1|2913423_2913630_-	cell division inhibitor protein	NA	K7PM31	Enterobacteria_phage	83.8	7.1e-28
AYZ43371.1|2914224_2914914_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
AYZ41176.1|2915018_2915249_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
AYZ41177.1|2915318_2915858_+	regulator	NA	M9NZI6	Enterobacteria_phage	66.1	1.5e-61
AYZ43372.1|2915944_2916874_+	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	63.8	4.0e-110
AYZ41178.1|2916870_2917572_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.4	7.9e-127
AYZ41179.1|2917568_2917871_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	93.5	1.7e-41
AYZ41180.1|2917938_2918271_+	multidrug SMR transporter	NA	NA	NA	NA	NA
AYZ41181.1|2918362_2918470_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ41182.1|2918527_2920054_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.7	3.6e-31
AYZ41183.1|2920165_2920489_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ41184.1|2920950_2921307_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ41185.1|2921396_2921498_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ41186.1|2921494_2921950_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	67.5	4.9e-61
AYZ41187.1|2921949_2922120_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	1.4e-13
AYZ41188.1|2922112_2922403_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
AYZ41189.1|2922399_2922762_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
AYZ41190.1|2922758_2922899_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
AYZ41191.1|2922984_2923362_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.3	8.1e-54
AYZ41192.1|2923517_2924042_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
AYZ41193.1|2924234_2925194_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
AYZ41194.1|2925545_2926277_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYZ41195.1|2926464_2926680_+|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
AYZ41196.1|2926679_2927177_+	lysozyme	NA	A0A1B5FP97	Escherichia_phage	97.0	9.3e-90
AYZ41197.1|2927393_2927600_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	5.3e-31
AYZ41198.1|2927628_2927781_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
AYZ41199.1|2928132_2928543_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
AYZ41200.1|2928599_2928833_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
AYZ41201.1|2929221_2929767_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
AYZ41202.1|2929741_2931667_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
AYZ41203.1|2931663_2931870_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
AYZ41204.1|2931866_2933468_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	8.5e-310
AYZ41205.1|2933448_2934768_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	6.9e-233
AYZ41206.1|2934777_2935110_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
AYZ41207.1|2935165_2936191_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	1.0e-191
AYZ41208.1|2936232_2936631_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	100.0	3.1e-64
AYZ41209.1|2936642_2936996_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
AYZ41210.1|2937007_2937586_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
AYZ41211.1|2937582_2937978_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
AYZ43373.1|2937985_2938726_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	1.7e-127
AYZ41212.1|2938741_2939164_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	97.9	2.8e-71
AYZ41213.1|2939145_2939580_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
AYZ41214.1|2939572_2942134_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.5	0.0e+00
AYZ41215.1|2942130_2942460_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	97.2	8.9e-57
AYZ41216.1|2942459_2943158_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
AYZ41217.1|2943163_2943907_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.9e-149
AYZ41218.1|2943843_2944476_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
AYZ41219.1|2944536_2948016_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
AYZ41220.1|2948083_2948683_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	92.5	4.4e-102
AYZ41221.1|2948747_2951105_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	50.1	2.2e-117
AYZ41222.1|2951104_2951374_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ41223.1|2951386_2952427_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	91.9	2.1e-176
AYZ41224.1|2953438_2954188_+	transcriptional regulator	NA	NA	NA	NA	NA
AYZ41225.1|2954436_2955390_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
AYZ41226.1|2955902_2956664_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
2955814:2955860	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
AYZ41227.1|2956846_2957737_-	DUF4434 family protein	NA	NA	NA	NA	NA
AYZ41228.1|2957737_2960710_-	phage receptor	NA	NA	NA	NA	NA
AYZ41229.1|2960696_2962934_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
AYZ41230.1|2963131_2964268_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
AYZ41231.1|2965121_2965511_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ41232.1|2965507_2970361_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	31.8	9.9e-19
AYZ41233.1|2970380_2970842_-	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
AYZ41234.1|2970869_2972771_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.1	6.0e-28
AYZ41235.1|2973514_2974963_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.1	2.3e-11
AYZ41236.1|2974952_2975636_-	DNA-binding response regulator in two-component regulatory system with CusS	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 207
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2978781	2981925	5231450		Leptospira_phage(100.0%)	1	NA	NA
AYZ41240.1|2978781_2981925_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	5.7e-60
>prophage 208
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	2992861	2998903	5231450		Tupanvirus(50.0%)	3	NA	NA
AYZ41251.1|2992861_2996743_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.0	4.2e-60
AYZ41252.1|2996957_2998091_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
AYZ41253.1|2998087_2998903_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.5	4.3e-07
>prophage 209
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3013225	3015048	5231450		uncultured_marine_virus(50.0%)	2	NA	NA
AYZ41267.1|3013225_3013855_-	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	53.3	1.3e-56
AYZ41268.1|3013827_3015048_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	2.1e-58
>prophage 210
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3018111	3020226	5231450		Bacillus_virus(50.0%)	2	NA	NA
AYZ41272.1|3018111_3019677_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
AYZ41273.1|3019797_3020226_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	38.5	3.3e-19
>prophage 211
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3034316	3034963	5231450		Morganella_phage(50.0%)	2	NA	NA
AYZ41287.1|3034316_3034526_+	cold-shock protein CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
AYZ41288.1|3034579_3034963_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 212
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3039781	3042221	5231450		Stx2-converting_phage(50.0%)	2	NA	NA
AYZ41295.1|3039781_3040993_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
AYZ41296.1|3041132_3042221_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 213
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3049231	3051814	5231450	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
AYZ41305.1|3049231_3051814_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	1.2e-183
>prophage 214
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3058753	3062286	5231450		Bathycoccus_sp._RCC1105_virus(50.0%)	3	NA	NA
AYZ41313.1|3058753_3060424_-	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	32.7	2.3e-76
AYZ41314.1|3060507_3061443_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
AYZ41315.1|3061560_3062286_-	glutamate/aspartate transport ATP-binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 215
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3070239	3071319	5231450		Pseudomonas_phage(100.0%)	1	NA	NA
AYZ41323.1|3070239_3071319_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 216
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3075846	3077511	5231450		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AYZ41327.1|3075846_3077511_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	6.1e-85
>prophage 217
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3082136	3085950	5231450	tRNA	Vibrio_phage(50.0%)	2	NA	NA
AYZ41332.1|3082136_3084083_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
AYZ41333.1|3084285_3085950_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.9	0.0e+00
>prophage 218
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3090094	3090859	5231450		Mycobacterium_phage(100.0%)	1	NA	NA
AYZ41340.1|3090094_3090859_-	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	2.9e-05
>prophage 219
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3099103	3110936	5231450		Hokovirus(40.0%)	10	NA	NA
AYZ41348.1|3099103_3099781_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	30.6	2.0e-26
AYZ41349.1|3099777_3102462_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
AYZ41350.1|3102454_3103027_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
AYZ41351.1|3103035_3105084_-	K(+)-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.8	7.1e-27
AYZ41352.1|3105106_3106780_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AYZ41353.1|3106779_3106869_-	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
AYZ41354.1|3107181_3107388_+	DUF2517 family protein	NA	NA	NA	NA	NA
AYZ41355.1|3107488_3107998_+	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
AYZ41356.1|3107994_3109413_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.8	9.5e-63
AYZ41357.1|3109454_3110936_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.2	5.5e-45
>prophage 220
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3114314	3115106	5231450		Kaumoebavirus(100.0%)	1	NA	NA
AYZ41362.1|3114314_3115106_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	28.1	9.8e-09
>prophage 221
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3119029	3119785	5231450		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
AYZ41367.1|3119029_3119785_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	27.9	2.2e-10
>prophage 222
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3135861	3137259	5231450		Bordetella_phage(100.0%)	1	NA	NA
AYZ41382.1|3135861_3137259_-	RtcB family protein	NA	A0A291L9X2	Bordetella_phage	31.8	2.4e-34
>prophage 223
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3171050	3174570	5231450		Vibrio_phage(33.33%)	4	NA	NA
AYZ41413.1|3171050_3171770_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	7.0e-22
AYZ41414.1|3171766_3172708_-	zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.9	2.9e-23
AYZ41415.1|3172821_3173202_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ41416.1|3173517_3174570_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A1Z1LZD8	Serratia_phage	48.2	7.5e-81
>prophage 224
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3178932	3185506	5231450		Tupanvirus(33.33%)	7	NA	NA
AYZ41421.1|3178932_3179949_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
AYZ41422.1|3180209_3181682_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	27.9	1.2e-12
AYZ41423.1|3181749_3182538_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
AYZ41424.1|3182666_3182816_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
AYZ41425.1|3182982_3183756_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYZ41426.1|3183755_3184445_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
AYZ41427.1|3184447_3185506_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.4	5.7e-20
>prophage 225
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3195698	3196988	5231450		Klosneuvirus(100.0%)	1	NA	NA
AYZ41435.1|3195698_3196988_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
>prophage 226
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3203315	3204224	5231450		Streptococcus_phage(100.0%)	1	NA	NA
AYZ41441.1|3203315_3204224_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	6.4e-28
>prophage 227
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3214824	3226697	5231450		Anomala_cuprea_entomopoxvirus(16.67%)	11	NA	NA
AYZ41455.1|3214824_3216561_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
AYZ41456.1|3216553_3217549_-	secretion protein HlyD	NA	NA	NA	NA	NA
AYZ43376.1|3217551_3218223_-	transcriptional regulator	NA	NA	NA	NA	NA
AYZ41457.1|3218451_3219813_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
AYZ41458.1|3220046_3220529_-	NADAR family protein	NA	A0A0H3TLU0	Faustovirus	52.7	2.6e-36
AYZ43377.1|3220648_3222799_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	2.2e-42
AYZ41459.1|3222826_3223789_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
AYZ41460.1|3223929_3225015_+	dehydrogenase	NA	NA	NA	NA	NA
AYZ41461.1|3225154_3225415_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AYZ41462.1|3225679_3225946_-	DksA/TraR family C4-type zinc finger protein	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
AYZ41463.1|3226019_3226697_-	Fe2+-dependent dioxygenase	NA	Q5GQB0	Synechococcus_phage	30.1	9.0e-19
>prophage 228
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3233085	3238311	5231450		Planktothrix_phage(33.33%)	7	NA	NA
AYZ41468.1|3233085_3233808_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
AYZ41469.1|3233804_3234464_-	glutamine ABC transporter permease	NA	NA	NA	NA	NA
AYZ41470.1|3234602_3235349_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYZ41471.1|3235752_3236256_-	DNA starvation/stationary phase protection protein	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
AYZ41472.1|3236555_3237443_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
AYZ43378.1|3237677_3237743_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ41473.1|3237795_3238311_+	outer membrane protein X	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 229
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3243308	3244904	5231450		Tupanvirus(100.0%)	1	NA	NA
AYZ41479.1|3243308_3244904_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	5.3e-62
>prophage 230
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3252503	3256634	5231450		Citrobacter_phage(50.0%)	3	NA	NA
AYZ41484.1|3252503_3254936_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
AYZ41485.1|3254941_3255841_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
AYZ41486.1|3255971_3256634_+	fructose-6-phosphate aldolase 1	NA	C7BV14	Synechococcus_phage	32.5	2.8e-25
>prophage 231
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3259951	3261823	5231450		Planktothrix_phage(100.0%)	1	NA	NA
AYZ41490.1|3259951_3261823_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	5.2e-16
>prophage 232
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3274111	3275314	5231450		Stx2-converting_phage(100.0%)	1	NA	NA
AYZ43380.1|3274111_3275314_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 233
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3281448	3374168	5231450	head,capsid,tRNA,tail,lysis,integrase,plate,portal,protease	Salmonella_phage(59.32%)	94	3281348:3281374	3315727:3315753
3281348:3281374	attL	ATAAATTTCAGGCAACAAAAAACCCAC	NA	NA	NA	NA
AYZ41509.1|3281448_3282501_-|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	55.8	4.8e-104
AYZ41510.1|3282583_3284260_-	DUF4041 domain-containing protein	NA	A0A142LP25	Marinitoga_camini_virus	66.8	9.8e-83
AYZ41511.1|3284280_3284877_-	hypothetical protein	NA	A0A1S6KZZ7	Salmonella_phage	42.9	1.4e-39
AYZ41512.1|3284972_3285194_+	regulator	NA	NA	NA	NA	NA
AYZ41513.1|3285226_3285736_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
AYZ43381.1|3285743_3285944_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
AYZ41514.1|3285907_3286249_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYZ41515.1|3286316_3286550_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
AYZ41516.1|3286549_3286777_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
AYZ41517.1|3286773_3287631_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	98.2	4.1e-162
AYZ41518.1|3287627_3290042_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.6	0.0e+00
AYZ41519.1|3290195_3290384_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AYZ41520.1|3290322_3290628_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	2.3e-35
AYZ41521.1|3290802_3291861_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ41522.1|3292394_3294176_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AYZ41523.1|3294212_3295247_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	85.5	2.3e-167
AYZ41524.1|3295246_3297013_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYZ41525.1|3297155_3297989_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
AYZ41526.1|3298005_3299064_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	8.4e-181
AYZ41527.1|3299067_3299718_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	95.8	9.6e-111
AYZ41528.1|3299813_3300278_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
AYZ41529.1|3300277_3300481_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYZ41530.1|3300484_3300700_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYZ43382.1|3300719_3301193_+	lysozyme	NA	E5G6N1	Salmonella_phage	90.4	8.3e-80
AYZ41531.1|3301194_3301572_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	8.8e-16
AYZ41532.1|3301568_3301997_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.2	1.9e-46
AYZ41533.1|3301926_3302127_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	77.3	3.9e-23
AYZ41534.1|3302092_3302524_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	9.9e-72
AYZ41535.1|3302516_3302963_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.2	4.0e-60
AYZ41536.1|3302904_3303711_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ41537.1|3303814_3304393_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	7.2e-94
AYZ41538.1|3304389_3304749_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.7	2.8e-51
AYZ41539.1|3304735_3305644_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	3.5e-143
AYZ41540.1|3305636_3306242_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.2e-110
AYZ41541.1|3306238_3307780_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	71.2	7.6e-199
AYZ41542.1|3307779_3308382_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	84.4	3.7e-93
AYZ41543.1|3308515_3309688_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	7.8e-204
AYZ41544.1|3309697_3310213_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
AYZ41545.1|3310267_3310570_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	88.0	3.5e-39
AYZ41546.1|3310584_3310704_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYZ41547.1|3310696_3313774_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	69.3	0.0e+00
AYZ41548.1|3313770_3314256_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	79.4	1.6e-65
AYZ41549.1|3314252_3315353_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	85.2	1.0e-176
AYZ41550.1|3315443_3315662_+	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYZ41551.1|3315897_3317583_-	transporter	NA	NA	NA	NA	NA
3315727:3315753	attR	ATAAATTTCAGGCAACAAAAAACCCAC	NA	NA	NA	NA
AYZ41552.1|3317852_3318230_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ41553.1|3318259_3318517_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
AYZ41554.1|3318676_3318964_+	DUF1418 family protein	NA	NA	NA	NA	NA
AYZ41555.1|3319731_3320634_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
AYZ41556.1|3320721_3321198_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
AYZ41557.1|3321548_3322661_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AYZ41558.1|3322755_3323889_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
AYZ41559.1|3323898_3324852_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AYZ41560.1|3324848_3325694_+	spermidine/putrescine ABC transporter permease	NA	NA	NA	NA	NA
AYZ41561.1|3325753_3326242_+	DUF2593 family protein	NA	NA	NA	NA	NA
AYZ41562.1|3326282_3327410_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
AYZ41563.1|3327438_3328170_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYZ41564.1|3328395_3329064_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
AYZ41565.1|3329063_3329780_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
AYZ41566.1|3329786_3330518_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYZ41567.1|3330535_3331264_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
AYZ41568.1|3331481_3331997_-	lipoprotein	NA	NA	NA	NA	NA
AYZ43383.1|3332644_3334414_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
AYZ41569.1|3334381_3334570_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ41570.1|3334624_3334948_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ41571.1|3334944_3335775_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
AYZ43384.1|3335771_3336785_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AYZ41572.1|3336883_3338314_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AYZ41573.1|3338324_3339326_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AYZ41574.1|3339362_3341081_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	6.8e-31
AYZ41575.1|3341213_3342182_-	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AYZ41576.1|3342193_3343846_-	hydroxylamine reductase	NA	NA	NA	NA	NA
AYZ41577.1|3343844_3344024_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ41578.1|3343988_3344888_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
AYZ41579.1|3345345_3346041_-	aquaporin	NA	NA	NA	NA	NA
AYZ41580.1|3346466_3348125_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AYZ41581.1|3348121_3349114_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
AYZ41582.1|3349228_3350344_+	MacA family efflux pump subunit	NA	NA	NA	NA	NA
AYZ41583.1|3350340_3352287_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	40.1	6.5e-38
AYZ41584.1|3352359_3352584_-	cold-shock protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
AYZ41585.1|3352906_3353227_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
AYZ41586.1|3353257_3355534_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
AYZ41587.1|3356281_3356500_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AYZ41588.1|3356784_3357489_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AYZ41589.1|3357530_3359252_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.9e-21
AYZ41590.1|3359252_3361019_-	ATP-binding/permease CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
AYZ41591.1|3361141_3362107_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
AYZ41592.1|3362650_3363145_+	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AYZ41593.1|3363279_3367350_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
AYZ41594.1|3367508_3368120_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AYZ41595.1|3368130_3369474_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.0	7.3e-81
AYZ41596.1|3369564_3370857_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AYZ41597.1|3371095_3373540_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.6	1.6e-219
AYZ41598.1|3373550_3374168_+	dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 234
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3380477	3383692	5231450		Tetraselmis_virus(100.0%)	2	NA	NA
AYZ41605.1|3380477_3381218_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
AYZ41606.1|3381409_3383692_-	formate acetyltransferase 1	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.3e-162
>prophage 235
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3387790	3388879	5231450		Streptococcus_phage(100.0%)	1	NA	NA
AYZ41610.1|3387790_3388879_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.1	2.7e-81
>prophage 236
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3393965	3398505	5231450		Bacillus_phage(100.0%)	3	NA	NA
AYZ41615.1|3393965_3394250_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
AYZ41616.1|3394455_3396720_+	ComEC family protein	NA	NA	NA	NA	NA
AYZ41617.1|3396756_3398505_+	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
>prophage 237
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3413210	3423991	5231450	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
AYZ43385.1|3413210_3413759_+	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
AYZ41629.1|3413785_3414433_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AYZ41630.1|3414482_3415673_-	aspartate aminotransferase	NA	NA	NA	NA	NA
AYZ41631.1|3415857_3416931_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	55.1	2.3e-101
AYZ41632.1|3417532_3418933_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
AYZ41633.1|3419100_3420303_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AYZ41634.1|3420568_3423181_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
AYZ41635.1|3423223_3423991_-	aliphatic sulfonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
>prophage 238
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3439763	3441671	5231450		Tupanvirus(100.0%)	1	NA	NA
AYZ41651.1|3439763_3441671_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	6.4e-54
>prophage 239
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3454271	3456326	5231450		Bacillus_phage(100.0%)	1	NA	NA
AYZ41663.1|3454271_3456326_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
>prophage 240
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3460560	3461220	5231450		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AYZ41671.1|3460560_3461220_-	BAX inhibitor protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 241
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3472213	3484527	5231450		Morganella_phage(20.0%)	13	NA	NA
AYZ41682.1|3472213_3472426_+	cold-shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
AYZ43388.1|3472436_3472625_+	cold-shock protein	NA	NA	NA	NA	NA
AYZ41683.1|3472599_3472830_+	protein YmcE	NA	NA	NA	NA	NA
AYZ41684.1|3472819_3472993_+	protein GnsA	NA	NA	NA	NA	NA
AYZ41685.1|3473041_3474115_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
AYZ41686.1|3474197_3476930_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.5	1.6e-37
AYZ41687.1|3477012_3478041_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
AYZ41688.1|3478013_3478706_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
AYZ41689.1|3478835_3480008_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
AYZ41690.1|3480007_3482554_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.6	1.7e-70
AYZ41691.1|3482550_3483150_+	molecular chaperone TorD	NA	NA	NA	NA	NA
AYZ41692.1|3483301_3483607_-	chaperone modulatory protein CbpM	NA	NA	NA	NA	NA
AYZ41693.1|3483606_3484527_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	2.5e-11
>prophage 242
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3488831	3490931	5231450		Enterobacteria_phage(100.0%)	3	NA	NA
AYZ41698.1|3488831_3489005_+	stress-induced protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
AYZ41699.1|3489087_3490416_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	99.1	2.2e-234
AYZ41700.1|3490436_3490931_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	9.3e-50
>prophage 243
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3505374	3506298	5231450		Cronobacter_phage(100.0%)	1	NA	NA
AYZ41711.1|3505374_3506298_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	1.2e-90
>prophage 244
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3513120	3514488	5231450		Bacillus_phage(100.0%)	1	NA	NA
AYZ41716.1|3513120_3514488_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	2.5e-20
>prophage 245
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3517878	3518712	5231450		Pelagibacter_phage(100.0%)	1	NA	NA
AYZ41721.1|3517878_3518712_-	curli production assembly/transport component CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 246
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3522848	3523382	5231450		Scale_drop_disease_virus(100.0%)	1	NA	NA
AYZ41729.1|3522848_3523382_+	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	46.6	1.0e-25
>prophage 247
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3532690	3533611	5231450		Morganella_phage(100.0%)	1	NA	NA
AYZ41736.1|3532690_3533611_-	lipid A biosynthesis lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	6.6e-57
>prophage 248
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3538273	3538519	5231450		Salmonella_phage(100.0%)	1	NA	NA
AYZ41743.1|3538273_3538519_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 249
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3554364	3555306	5231450		Brevibacillus_phage(100.0%)	1	NA	NA
AYZ41763.1|3554364_3555306_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	4.7e-10
>prophage 250
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3568468	3569650	5231450		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
AYZ41776.1|3568468_3569203_+	beta-ketoacyl-ACP reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.7e-15
AYZ41777.1|3569413_3569650_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 251
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3572922	3574565	5231450		Pseudomonas_phage(50.0%)	2	NA	NA
AYZ41781.1|3572922_3573564_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	3.4e-28
AYZ41782.1|3573560_3574565_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
>prophage 252
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3586888	3587146	5231450		Erwinia_phage(100.0%)	1	NA	NA
AYZ41795.1|3586888_3587146_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 253
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3594434	3598157	5231450		Planktothrix_phage(50.0%)	4	NA	NA
AYZ41800.1|3594434_3595136_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
AYZ41801.1|3595135_3596380_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
AYZ41802.1|3596408_3597320_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AYZ41803.1|3597335_3598157_+	NAD-dependent deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
>prophage 254
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3601432	3603410	5231450		Mycoplasma_phage(100.0%)	2	NA	NA
AYZ41808.1|3601432_3602290_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
AYZ41809.1|3602273_3603410_-	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
>prophage 255
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3608431	3609802	5231450		Bodo_saltans_virus(100.0%)	1	NA	NA
AYZ41814.1|3608431_3609802_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	7.2e-108
>prophage 256
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3614448	3618184	5231450		Enterobacteria_phage(66.67%)	5	NA	NA
AYZ41820.1|3614448_3615699_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
AYZ41821.1|3615801_3616125_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	4.0e-41
AYZ41822.1|3616664_3616775_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ41823.1|3616827_3617232_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
AYZ41824.1|3617452_3618184_-	helix-turn-helix-type transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	50.5	3.5e-53
>prophage 257
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3624052	3626374	5231450		Escherichia_phage(100.0%)	1	NA	NA
AYZ41832.1|3624052_3626374_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	43.5	9.4e-92
>prophage 258
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3634884	3636572	5231450		Morganella_phage(50.0%)	2	NA	NA
AYZ41845.1|3634884_3635304_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.9	5.3e-38
AYZ41846.1|3635303_3636572_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	82.9	8.7e-209
>prophage 259
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3654658	3655417	5231450		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AYZ41862.1|3654658_3655417_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.5e-14
>prophage 260
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3680364	3685853	5231450	integrase,transposase	Morganella_phage(25.0%)	9	3672808:3672821	3684739:3684752
3672808:3672821	attL	GTAATAATTCAGGA	NA	NA	NA	NA
AYZ41876.1|3680364_3680739_+	XRE family transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	40.8	6.3e-06
AYZ41877.1|3681000_3681393_+	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
AYZ41878.1|3681512_3681974_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ41879.1|3681975_3682428_+	DNA repair protein RadC	NA	NA	NA	NA	NA
AYZ41880.1|3682474_3683404_+|integrase	site-specific integrase	integrase	A0A1B1P7C7	Bacillus_phage	29.0	2.3e-09
AYZ41881.1|3683390_3684005_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ41882.1|3684228_3684426_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	43.9	1.1e-06
AYZ41883.1|3684427_3684670_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ41884.1|3684639_3685853_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.4	4.7e-103
3684739:3684752	attR	GTAATAATTCAGGA	NA	NA	NA	NA
>prophage 261
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3704041	3710585	5231450	tRNA	Pseudomonas_phage(33.33%)	6	NA	NA
AYZ41898.1|3704041_3705217_-	DUF4102 domain-containing protein	NA	A0A1B0VMI6	Pseudomonas_phage	39.0	3.8e-73
AYZ41899.1|3705430_3706522_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
AYZ41900.1|3706638_3707223_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AYZ41901.1|3707500_3707779_+	DUF2583 domain-containing protein	NA	NA	NA	NA	NA
AYZ41902.1|3707833_3709513_-	sodium-independent anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
AYZ43397.1|3709637_3710585_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 262
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3713721	3720526	5231450		Pseudomonas_phage(33.33%)	9	NA	NA
AYZ41905.1|3713721_3714804_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
AYZ41906.1|3714803_3715637_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AYZ41907.1|3715633_3716026_+	protein sirB2	NA	NA	NA	NA	NA
AYZ41908.1|3716029_3716839_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
AYZ41909.1|3716874_3717729_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
AYZ43399.1|3717877_3717985_-	small toxic polypeptide LdrA/LdrC	NA	NA	NA	NA	NA
AYZ43400.1|3718412_3718520_-	small toxic polypeptide LdrA/LdrC	NA	NA	NA	NA	NA
AYZ41910.1|3718925_3720026_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
AYZ41911.1|3720295_3720526_+	cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 263
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3731657	3741489	5231450		Escherichia_phage(25.0%)	10	NA	NA
AYZ41919.1|3731657_3733196_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
AYZ41920.1|3733192_3733903_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
AYZ41921.1|3733902_3734580_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
AYZ41922.1|3735126_3735969_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
AYZ41923.1|3736018_3736477_-	YchJ family protein	NA	NA	NA	NA	NA
AYZ41924.1|3736589_3737495_+	patatin family protein	NA	NA	NA	NA	NA
AYZ41925.1|3737586_3738600_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
AYZ41926.1|3738801_3739710_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
AYZ41927.1|3739854_3740268_-	DNA-binding protein H-NS	NA	NA	NA	NA	NA
AYZ41928.1|3740871_3741489_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	7.8e-54
>prophage 264
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3751337	3753352	5231450		Planktothrix_phage(50.0%)	2	NA	NA
AYZ41934.1|3751337_3752351_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
AYZ41935.1|3752347_3753352_+	oligopeptide transport ATP-binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 265
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3765017	3767975	5231450		Acinetobacter_phage(100.0%)	2	NA	NA
AYZ41948.1|3765017_3766376_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
AYZ41949.1|3766379_3767975_-	bifunctional glutamine amidotransferase/anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
>prophage 266
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3776465	3781757	5231450	protease	Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
AYZ41957.1|3776465_3777224_-	NAD(P)-dependent oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
AYZ41958.1|3777443_3778493_+|protease	protease	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
AYZ41959.1|3778528_3778780_-	DUF2498 family protein	NA	NA	NA	NA	NA
AYZ41960.1|3779159_3781757_+	DNA topoisomerase I	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
>prophage 267
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3786682	3787273	5231450		Staphylococcus_phage(100.0%)	1	NA	NA
AYZ41966.1|3786682_3787273_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 268
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3795087	3797022	5231450		Lactococcus_phage(100.0%)	1	NA	NA
AYZ41976.1|3795087_3797022_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	28.1	1.1e-32
>prophage 269
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3805943	3807962	5231450		Salmonella_phage(50.0%)	2	NA	NA
AYZ41982.1|3805943_3807107_+	Bcr/CflA family efflux MFS transporter	NA	S4TR35	Salmonella_phage	27.2	1.3e-28
AYZ41983.1|3807155_3807962_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 270
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3820752	3822018	5231450		Klosneuvirus(100.0%)	1	NA	NA
AYZ41995.1|3820752_3822018_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.2	1.8e-25
>prophage 271
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3836023	3837106	5231450		Planktothrix_phage(100.0%)	1	NA	NA
AYZ42010.1|3836023_3837106_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 272
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3851218	3851734	5231450		Streptococcus_phage(100.0%)	1	NA	NA
AYZ42024.1|3851218_3851734_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 273
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3858060	3915796	5231450	holin,tail,tRNA,terminase,coat	Escherichia_phage(48.98%)	67	NA	NA
AYZ42030.1|3858060_3859293_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
AYZ42031.1|3859547_3860531_+	zinc transporter ZntB	NA	NA	NA	NA	NA
AYZ42032.1|3861008_3862382_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	1.1e-52
AYZ42033.1|3862510_3863446_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
AYZ42034.1|3863497_3864733_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.5	1.6e-239
AYZ42035.1|3864734_3864950_-	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
AYZ43411.1|3865028_3865238_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
AYZ43410.1|3865230_3865425_-	restriction alleviation and modification enhancement protein	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
AYZ42036.1|3865481_3866291_-	DNA recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
AYZ42037.1|3866283_3868884_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.6	9.4e-250
AYZ42038.1|3868985_3869261_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	93.4	1.3e-40
AYZ43412.1|3869335_3869506_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	1.9e-23
AYZ42039.1|3869505_3869727_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	98.6	3.1e-37
AYZ43413.1|3870168_3870657_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
AYZ42040.1|3870653_3870809_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
AYZ42041.1|3870819_3870954_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ42042.1|3871261_3871738_-	Rac prophage repressor	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
AYZ42043.1|3871861_3872158_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
AYZ42044.1|3872180_3872603_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.2e-69
AYZ42045.1|3872615_3873473_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	85.4	7.0e-69
AYZ42046.1|3873479_3874226_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	80.5	6.2e-114
AYZ42047.1|3874248_3874998_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	86.0	6.5e-111
AYZ42048.1|3875251_3877321_+	ATP-binding protein	NA	NA	NA	NA	NA
AYZ42049.1|3877447_3877546_+	Hok/Gef family protein	NA	NA	NA	NA	NA
AYZ42050.1|3877891_3878107_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ42051.1|3878009_3878609_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	2.2e-106
AYZ42052.1|3878608_3878899_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
AYZ42053.1|3878895_3879438_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	9.8e-77
AYZ42054.1|3879659_3880229_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ42055.1|3880197_3880500_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ42056.1|3880576_3880918_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	89.2	6.9e-52
AYZ42057.1|3880921_3881398_+	lysozyme	NA	K7PKV2	Enterobacteria_phage	96.2	2.3e-85
AYZ42058.1|3881614_3881800_+	Spanin from lambdoid prophage Rac, outer membrane subunit	NA	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
AYZ42059.1|3881996_3883454_+	potassium transporter TrkG	NA	NA	NA	NA	NA
AYZ42060.1|3883591_3884380_+	transcriptional regulator	NA	R4TG31	Halovirus	40.9	7.4e-49
AYZ42061.1|3884372_3885305_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	2.4e-83
AYZ42062.1|3885282_3885492_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ42063.1|3885495_3886590_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	9.1e-114
AYZ42064.1|3886570_3887872_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.8	1.6e-149
AYZ42065.1|3887874_3889281_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	68.8	8.8e-186
AYZ42066.1|3889264_3890377_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.8	6.0e-113
AYZ42067.1|3890481_3891246_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	66.5	3.9e-87
AYZ42068.1|3891344_3892484_+|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	75.0	3.3e-159
AYZ42069.1|3892706_3893102_+	protein singed	NA	NA	NA	NA	NA
AYZ42070.1|3893101_3893485_+	glutamate 5-kinase	NA	A0A0P0I456	Acinetobacter_phage	40.2	4.4e-15
AYZ42071.1|3893485_3893866_+	HK97 gp10 family phage protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
AYZ42072.1|3893862_3894255_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
AYZ42073.1|3894281_3895244_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
AYZ43414.1|3895394_3895754_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ42074.1|3895861_3896062_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ42075.1|3896227_3899461_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	34.5	8.7e-112
AYZ42076.1|3899453_3899792_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
AYZ42077.1|3899791_3900490_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	94.4	1.9e-128
AYZ42078.1|3900495_3901239_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	4.0e-145
AYZ42079.1|3901175_3901784_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	91.1	4.2e-100
AYZ42080.1|3901844_3905324_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.8	0.0e+00
AYZ43415.1|3905391_3905991_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	92.5	3.4e-102
AYZ42081.1|3906055_3908404_+|tail	phage tail protein	tail	A0A0E3M0V5	Enterobacteria_phage	46.3	9.5e-92
AYZ42082.1|3908400_3908682_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	4.1e-18
AYZ42083.1|3908691_3909396_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	7.0e-59
AYZ42084.1|3909406_3909700_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ42085.1|3910051_3910909_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AYZ42086.1|3910905_3911763_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AYZ42087.1|3911759_3912587_-	manganese/iron ABC transporter ATP-binding protein	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.0	8.7e-08
AYZ42088.1|3912586_3913501_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYZ42089.1|3914087_3914522_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
AYZ42090.1|3914662_3915796_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	54.1	1.5e-103
>prophage 274
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3920750	3921740	5231450		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AYZ42094.1|3920750_3921740_-	lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
>prophage 275
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3935276	3939179	5231450		Klosneuvirus(100.0%)	1	NA	NA
AYZ42106.1|3935276_3939179_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 276
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3943117	3944066	5231450		Escherichia_phage(50.0%)	2	NA	NA
AYZ43418.1|3943117_3943648_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	43.9	1.2e-18
AYZ42109.1|3943892_3944066_+	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	69.8	7.6e-07
>prophage 277
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3957226	3964276	5231450		Phage_TP(25.0%)	7	NA	NA
AYZ42123.1|3957226_3959188_+	U32 family peptidase	NA	Q6DW11	Phage_TP	28.9	9.2e-24
AYZ42124.1|3959279_3959510_-	DUF2554 family protein	NA	NA	NA	NA	NA
AYZ42125.1|3959731_3959908_+	mRNA interferase HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
AYZ43419.1|3959953_3960370_+	antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
AYZ42126.1|3960448_3961855_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
AYZ42127.1|3962099_3963245_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
AYZ42128.1|3963262_3964276_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	36.9	1.7e-26
>prophage 278
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3971409	3973512	5231450		Salmonella_phage(100.0%)	1	NA	NA
AYZ42138.1|3971409_3973512_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	66.2	5.6e-136
>prophage 279
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3978419	3980528	5231450		Ralstonia_phage(100.0%)	1	NA	NA
AYZ42143.1|3978419_3980528_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.2	2.8e-26
>prophage 280
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3988876	3990421	5231450		Escherichia_phage(100.0%)	1	NA	NA
AYZ42152.1|3988876_3990421_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 281
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	3998698	3999799	5231450		Enterobacteria_phage(100.0%)	1	NA	NA
AYZ42157.1|3998698_3999799_-	porin	NA	Q1MVN1	Enterobacteria_phage	65.1	1.6e-137
>prophage 282
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4005810	4007251	5231450		Escherichia_phage(50.0%)	2	NA	NA
AYZ42163.1|4005810_4006095_-	addiction module antidote protein, HigA family	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
AYZ42164.1|4006240_4007251_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.0	2.1e-24
>prophage 283
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4010524	4012430	5231450		Planktothrix_phage(100.0%)	2	NA	NA
AYZ42169.1|4010524_4011451_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.6	2.4e-14
AYZ42170.1|4011443_4012430_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	3.8e-18
>prophage 284
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4016746	4020553	5231450		Klosneuvirus(50.0%)	2	NA	NA
AYZ43421.1|4016746_4019146_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.2e-09
AYZ42175.1|4019170_4020553_-	diguanylate cyclase	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 285
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4025832	4032768	5231450		Powai_lake_megavirus(50.0%)	3	NA	NA
AYZ42179.1|4025832_4028628_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.3	3.7e-18
AYZ42180.1|4028672_4031045_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AYZ42181.1|4031082_4032768_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.2	1.1e-09
>prophage 286
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4046320	4146225	5231450	transposase,tail,lysis,portal,terminase,protease	Enterobacteria_phage(37.29%)	108	NA	NA
AYZ42193.1|4046320_4047594_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AYZ42194.1|4054044_4055637_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
AYZ42195.1|4055715_4056669_-	LsrR family transcriptional regulator	NA	NA	NA	NA	NA
AYZ42196.1|4056917_4058453_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	24.0	3.2e-16
AYZ42197.1|4058446_4059475_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
AYZ42198.1|4059474_4060467_+	autoinducer 2 import system permease LsrD	NA	NA	NA	NA	NA
AYZ42199.1|4060478_4061501_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
AYZ42200.1|4061527_4062403_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
AYZ42201.1|4062426_4062717_+	autoinducer 2-degrading protein LsrG	NA	NA	NA	NA	NA
AYZ42202.1|4062773_4063532_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
AYZ42203.1|4063535_4064450_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ42204.1|4064646_4066098_-	tagaturonate reductase	NA	NA	NA	NA	NA
AYZ42205.1|4066325_4067744_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
AYZ42206.1|4067882_4068242_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
AYZ42207.1|4068241_4069168_-	glutaminase 2	NA	NA	NA	NA	NA
AYZ42208.1|4069231_4070620_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AYZ42209.1|4070720_4071602_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYZ42210.1|4071679_4072795_+	putative protein YneK	NA	NA	NA	NA	NA
AYZ42211.1|4072944_4074135_+	sugar efflux transporter	NA	NA	NA	NA	NA
AYZ42212.1|4074159_4074825_-	NAAT family transporter MarC	NA	NA	NA	NA	NA
AYZ42213.1|4075036_4075471_+	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
AYZ42214.1|4075491_4075875_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
AYZ42215.1|4075906_4076125_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
AYZ42216.1|4076155_4077055_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
AYZ42217.1|4077249_4078437_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
AYZ42218.1|4078563_4078659_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ42219.1|4078877_4079768_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.0	1.4e-19
AYZ42220.1|4080022_4080415_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
AYZ42221.1|4080780_4082826_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
AYZ42222.1|4082962_4083709_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AYZ42223.1|4083797_4084484_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYZ42224.1|4084660_4084864_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
AYZ42225.1|4084899_4086360_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	30.1	6.6e-43
AYZ42226.1|4086449_4087733_-	MFS transporter	NA	NA	NA	NA	NA
AYZ42227.1|4088337_4088451_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
AYZ42228.1|4088519_4088753_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
AYZ42229.1|4089069_4089660_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
AYZ43422.1|4089887_4090181_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ42230.1|4090223_4091264_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	80.5	4.5e-155
AYZ42231.1|4091274_4091553_-	hypothetical protein	NA	A0A0E3GMJ7	Enterobacteria_phage	54.3	3.8e-24
AYZ42232.1|4091549_4093922_-|tail	phage tail protein	tail	A0A0E3M0V5	Enterobacteria_phage	47.5	4.1e-103
AYZ42233.1|4093986_4094586_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	92.0	1.5e-102
AYZ42234.1|4094653_4098133_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
AYZ42235.1|4098193_4098841_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	4.7e-110
AYZ42236.1|4098738_4099482_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	9.2e-150
AYZ42237.1|4099487_4100186_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	1.3e-134
AYZ42238.1|4100195_4100525_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
AYZ42239.1|4100524_4103590_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.2	0.0e+00
AYZ42240.1|4103573_4103891_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	4.4e-53
AYZ43423.1|4103899_4104286_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.1	4.9e-62
AYZ42241.1|4104346_4105090_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	98.4	7.3e-131
AYZ42242.1|4105100_4105502_-|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	99.2	2.4e-72
AYZ42243.1|4105498_4106089_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.1	7.2e-81
AYZ42244.1|4106100_4106376_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	3.8e-45
AYZ42245.1|4106368_4106692_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
AYZ42246.1|4106777_4108805_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.7	0.0e+00
AYZ42247.1|4108749_4110258_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	6.6e-288
AYZ42248.1|4110257_4110470_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AYZ42249.1|4110466_4112569_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
AYZ42250.1|4112568_4113063_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	99.4	3.8e-83
AYZ42251.1|4113615_4113822_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
AYZ42252.1|4114117_4114291_-	protein GnsB	NA	NA	NA	NA	NA
AYZ43424.1|4114463_4114619_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ43425.1|4114766_4114955_-	cold-shock protein	NA	NA	NA	NA	NA
AYZ42253.1|4114965_4115178_-	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
AYZ42254.1|4115541_4116039_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
AYZ42255.1|4116035_4116569_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	8.4e-97
AYZ42256.1|4116565_4116877_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	62.6	1.5e-24
AYZ42257.1|4116881_4117097_-|lysis	lysis protein S	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
AYZ43426.1|4117348_4117723_-	tolA family protein	NA	NA	NA	NA	NA
AYZ42258.1|4117894_4118323_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
AYZ42259.1|4118689_4118821_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
AYZ43427.1|4118856_4119183_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ42260.1|4119716_4120538_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	2.1e-78
AYZ42261.1|4120552_4120909_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	6.1e-35
AYZ42262.1|4120921_4121971_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	6.5e-109
AYZ42263.1|4121972_4122251_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
AYZ42264.1|4122317_4122569_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ42265.1|4122785_4122998_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
AYZ42266.1|4123042_4123150_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	2.5e-08
AYZ42267.1|4123156_4123360_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ42268.1|4124012_4125035_-	hypothetical protein	NA	Q858S2	Enterobacteria_phage	62.4	2.5e-105
AYZ42269.1|4125234_4125636_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	95.5	2.4e-64
AYZ42270.1|4125676_4126642_-	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	2.9e-55
AYZ42271.1|4126622_4127144_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ42272.1|4127127_4127355_-	transcriptional regulator	NA	NA	NA	NA	NA
AYZ42273.1|4127432_4127840_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
AYZ42274.1|4128032_4128185_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	6.6e-07
AYZ43428.1|4128196_4128562_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ42275.1|4128530_4128731_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ42276.1|4129233_4129422_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AYZ42277.1|4129418_4129610_+	DUF1482 family protein	NA	NA	NA	NA	NA
AYZ42278.1|4129702_4132174_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.5	8.5e-59
AYZ43429.1|4132261_4132498_+	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
AYZ42279.1|4132532_4133813_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.6	1.7e-156
AYZ42280.1|4133814_4133943_-	transporter	NA	NA	NA	NA	NA
AYZ42281.1|4134000_4135020_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
AYZ42282.1|4135031_4136246_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
AYZ42283.1|4136451_4136778_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.9e-23
AYZ42284.1|4136912_4137254_+	DUF1283 family protein	NA	NA	NA	NA	NA
AYZ42285.1|4137288_4137849_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AYZ42286.1|4137851_4138562_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AYZ42287.1|4138669_4138975_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AYZ42288.1|4139173_4141600_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
AYZ43430.1|4141660_4144084_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.8	2.2e-208
AYZ42289.1|4144094_4144712_+	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
AYZ42290.1|4144713_4145568_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AYZ42291.1|4145610_4146225_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	6.6e-29
>prophage 287
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4163986	4165288	5231450		Bacillus_phage(100.0%)	1	NA	NA
AYZ42310.1|4163986_4165288_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.2	2.1e-16
>prophage 288
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4192728	4194003	5231450	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
AYZ42336.1|4192728_4194003_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 289
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4200914	4202413	5231450		Salmonella_phage(50.0%)	2	NA	NA
AYZ43434.1|4200914_4201436_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	56.3	6.0e-47
AYZ42344.1|4201516_4202413_-	oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
>prophage 290
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4211216	4220020	5231450		Streptomyces_phage(20.0%)	9	NA	NA
AYZ42352.1|4211216_4212044_+	endopeptidase	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
AYZ42353.1|4212171_4212753_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
AYZ42354.1|4212898_4214068_-	MFS transporter	NA	NA	NA	NA	NA
AYZ42355.1|4214233_4214323_-	YnhF family membrane protein	NA	NA	NA	NA	NA
AYZ42356.1|4214621_4215647_+	PurR family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
AYZ42357.1|4215643_4216576_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYZ42358.1|4216688_4217900_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
AYZ42359.1|4218190_4219339_+	cyclopropane-fatty-acyl-phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
AYZ42360.1|4219378_4220020_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 291
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4225525	4227792	5231450		Edwardsiella_phage(50.0%)	3	NA	NA
AYZ42365.1|4225525_4226338_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	34.1	6.5e-08
AYZ42366.1|4226341_4227127_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
AYZ42367.1|4227123_4227792_-	thiosulfate reductase electron transport protein PhsB	NA	A0A077SL61	Escherichia_phage	36.5	6.5e-22
>prophage 292
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4236082	4241166	5231450		environmental_halophage(33.33%)	5	NA	NA
AYZ42376.1|4236082_4237303_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.2	1.7e-92
AYZ42377.1|4237299_4238571_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
AYZ42378.1|4238545_4239292_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.0	5.1e-07
AYZ42379.1|4239301_4240789_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
AYZ42380.1|4240797_4241166_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	5.6e-15
>prophage 293
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4259759	4279208	5231450	tRNA	Staphylococcus_phage(11.11%)	19	NA	NA
AYZ42396.1|4259759_4261460_+	cyclohexanecarboxylate-CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	1.4e-31
AYZ42397.1|4261516_4263895_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.6	2.7e-171
AYZ42398.1|4264226_4265060_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
AYZ42399.1|4265216_4266263_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.4	4.7e-83
AYZ42400.1|4266394_4266586_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
AYZ42401.1|4266589_4268026_-	YdiU family protein	NA	NA	NA	NA	NA
AYZ42402.1|4268088_4268802_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AYZ42403.1|4269048_4269513_-	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
AYZ42404.1|4269590_4270340_-	vitamin B12 import ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
AYZ42405.1|4270339_4270891_-	glutathione peroxidase	NA	NA	NA	NA	NA
AYZ42406.1|4270953_4271934_-	vitamin B12 import system permease BtuC	NA	NA	NA	NA	NA
AYZ42407.1|4272034_4272334_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AYZ42408.1|4272338_4274726_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AYZ42409.1|4274740_4275724_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	1.9e-33
AYZ43436.1|4275862_4275907_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
AYZ42410.1|4276029_4276386_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AYZ42411.1|4276439_4276637_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AYZ42412.1|4276733_4277276_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
AYZ42413.1|4277279_4279208_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
>prophage 294
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4290497	4292759	5231450		Tupanvirus(100.0%)	1	NA	NA
AYZ42426.1|4290497_4292759_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.4	3.9e-143
>prophage 295
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4298877	4299705	5231450		Bacillus_virus(100.0%)	1	NA	NA
AYZ42434.1|4298877_4299705_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	7.0e-74
>prophage 296
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4307181	4308402	5231450		Klosneuvirus(100.0%)	1	NA	NA
AYZ42442.1|4307181_4308402_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.6	7.2e-27
>prophage 297
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4315166	4315820	5231450		Bacillus_phage(100.0%)	1	NA	NA
AYZ42450.1|4315166_4315820_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.0	1.5e-10
>prophage 298
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4320210	4322166	5231450		Streptococcus_phage(100.0%)	1	NA	NA
AYZ42456.1|4320210_4322166_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	2.4e-40
>prophage 299
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4327092	4331177	5231450		Tupanvirus(50.0%)	4	NA	NA
AYZ42461.1|4327092_4327734_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	5.0e-19
AYZ42462.1|4327826_4329185_-	MFS transporter	NA	NA	NA	NA	NA
AYZ42463.1|4329301_4330060_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AYZ42464.1|4330196_4331177_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	1.8e-07
>prophage 300
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4339986	4340841	5231450		Indivirus(100.0%)	1	NA	NA
AYZ42473.1|4339986_4340841_-	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	24.3	5.6e-10
>prophage 301
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4344159	4348736	5231450		Bacillus_phage(100.0%)	3	NA	NA
AYZ42476.1|4344159_4345443_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
AYZ42477.1|4345589_4347065_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AYZ42478.1|4347245_4348736_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 302
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4363490	4371595	5231450	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
AYZ42497.1|4363490_4365176_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
AYZ42498.1|4365380_4365962_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
AYZ42499.1|4366000_4366696_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AYZ42500.1|4366753_4368664_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
AYZ42501.1|4368795_4369140_+	RidA family protein	NA	NA	NA	NA	NA
AYZ42502.1|4369501_4369861_+	DUF1889 family protein	NA	NA	NA	NA	NA
AYZ42503.1|4369980_4370160_-	YoaH family protein	NA	NA	NA	NA	NA
AYZ42504.1|4370233_4371595_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.7	4.0e-42
>prophage 303
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4375457	4377014	5231450		Moraxella_phage(100.0%)	1	NA	NA
AYZ42508.1|4375457_4377014_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 304
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4382655	4382865	5231450		Morganella_phage(100.0%)	1	NA	NA
AYZ42515.1|4382655_4382865_-	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 305
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4388197	4390246	5231450		Moraxella_phage(100.0%)	1	NA	NA
AYZ42523.1|4388197_4390246_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	5.2e-86
>prophage 306
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4397742	4402212	5231450		Escherichia_phage(33.33%)	7	NA	NA
AYZ42529.1|4397742_4398399_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	6.8e-56
AYZ42530.1|4398794_4399136_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AYZ42531.1|4399148_4400021_-	copper resistance D family protein	NA	NA	NA	NA	NA
AYZ42532.1|4400024_4400399_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AYZ42533.1|4400537_4400768_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
AYZ42534.1|4400869_4401526_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AYZ42535.1|4401549_4402212_+	DNA polymerase III subunit epsilon	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 307
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4410267	4411743	5231450		Cyanophage(100.0%)	1	NA	NA
AYZ42543.1|4410267_4411743_-	glucose-6-phosphate 1-dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 308
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4415742	4422806	5231450		Bacillus_virus(50.0%)	9	NA	NA
AYZ42547.1|4415742_4417065_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
AYZ43441.1|4417080_4418013_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
AYZ42548.1|4418091_4418847_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.0e-18
AYZ42549.1|4418843_4419629_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
AYZ42550.1|4419775_4420786_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
AYZ42551.1|4420794_4421406_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AYZ43442.1|4421544_4421610_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ42552.1|4421680_4422283_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
AYZ42553.1|4422284_4422806_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 309
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4426699	4428750	5231450		Escherichia_coli_phage(50.0%)	3	NA	NA
AYZ42558.1|4426699_4427518_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	98.4	2.5e-71
AYZ42559.1|4427570_4427966_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ42560.1|4428006_4428750_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
>prophage 310
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4435236	4436970	5231450	tRNA	Tupanvirus(100.0%)	1	NA	NA
AYZ42566.1|4435236_4436970_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.3	1.7e-85
>prophage 311
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4443842	4449486	5231450		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
AYZ42572.1|4443842_4444232_-	two-component system response regulator	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
AYZ42573.1|4444246_4445296_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
AYZ42574.1|4445298_4446159_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
AYZ42575.1|4446177_4447779_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	1.1e-14
AYZ42576.1|4447824_4449486_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
>prophage 312
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4459574	4461089	5231450		Cedratvirus(100.0%)	1	NA	NA
AYZ42587.1|4459574_4461089_-	arabinose import ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
>prophage 313
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4471466	4474751	5231450		Liberibacter_phage(100.0%)	1	NA	NA
AYZ42600.1|4471466_4474751_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.5	1.4e-64
>prophage 314
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4478511	4480035	5231450		Staphylococcus_phage(100.0%)	1	NA	NA
AYZ42604.1|4478511_4480035_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	39.3	3.7e-89
>prophage 315
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4487678	4488431	5231450		Bacillus_virus(100.0%)	1	NA	NA
AYZ42612.1|4487678_4488431_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 316
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4500428	4501097	5231450		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AYZ42626.1|4500428_4501097_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	8.1e-81
>prophage 317
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4516911	4529335	5231450		Bacillus_phage(28.57%)	12	NA	NA
AYZ42650.1|4516911_4518606_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.8	1.7e-18
AYZ42651.1|4518776_4518959_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AYZ42652.1|4519037_4519955_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AYZ42653.1|4520127_4521048_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AYZ42654.1|4521036_4521507_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	2.0e-33
AYZ42655.1|4521487_4522906_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	4.0e-101
AYZ42656.1|4522972_4523668_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.1e-07
AYZ42657.1|4523707_4524073_-	permease	NA	NA	NA	NA	NA
AYZ42658.1|4524639_4525755_+	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	47.7	1.0e-91
AYZ42659.1|4526346_4527198_+	Molecular chaperone Hsp31 and glyoxalase 3	NA	NA	NA	NA	NA
AYZ42660.1|4527305_4528664_-	HAMP domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	22.1	8.7e-05
AYZ43443.1|4528663_4529335_-	DNA-binding response regulator HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
>prophage 318
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4534524	4559180	5231450		Bacillus_phage(40.0%)	8	NA	NA
AYZ42665.1|4534524_4535787_+	DUF4102 domain-containing protein	NA	A0A1B0VMI6	Pseudomonas_phage	39.0	3.1e-73
AYZ42666.1|4535980_4537285_-	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
AYZ42667.1|4537312_4538593_-	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
AYZ42668.1|4538585_4540388_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
AYZ42669.1|4540374_4542177_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.6	8.5e-32
AYZ42670.1|4542343_4543303_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
AYZ42671.1|4543493_4549601_+	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	1.8e-33
AYZ42672.1|4549688_4559180_+	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.2e-49
>prophage 319
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4586113	4587975	5231450		uncultured_marine_virus(50.0%)	2	NA	NA
AYZ42692.1|4586113_4586758_-	transcriptional regulator	NA	A0A0F7L444	uncultured_marine_virus	51.0	3.7e-54
AYZ42693.1|4586742_4587975_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.8	8.3e-63
>prophage 320
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4604662	4604890	5231450		Morganella_phage(100.0%)	1	NA	NA
AYZ43446.1|4604662_4604890_-	virulence protein	NA	A0A1W6JP07	Morganella_phage	81.0	5.6e-10
>prophage 321
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4610887	4611601	5231450		Bacillus_virus(100.0%)	1	NA	NA
AYZ42707.1|4610887_4611601_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.7	5.2e-17
>prophage 322
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4618232	4619446	5231450	transposase	Shigella_phage(100.0%)	1	NA	NA
AYZ42713.1|4618232_4619446_-|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.8	2.6e-101
>prophage 323
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4622803	4623952	5231450		Oenococcus_phage(100.0%)	1	NA	NA
AYZ42718.1|4622803_4623952_+	D-galactonate dehydratase 1	NA	Q6A202	Oenococcus_phage	32.8	1.0e-51
>prophage 324
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4635172	4636446	5231450	transposase	Shigella_phage(100.0%)	1	NA	NA
AYZ42726.1|4635172_4636446_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
>prophage 325
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4645496	4646866	5231450	transposase	Macacine_betaherpesvirus(100.0%)	1	NA	NA
AYZ42738.1|4645496_4646866_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.0	3.1e-111
>prophage 326
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4656949	4659108	5231450		Yersinia_phage(33.33%)	4	NA	NA
AYZ42749.1|4656949_4657771_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.8	2.1e-46
AYZ42750.1|4657852_4658332_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	32.8	1.7e-11
AYZ42751.1|4658347_4658824_+	DNA repair protein RadC	NA	NA	NA	NA	NA
AYZ42752.1|4658886_4659108_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	3.6e-09
>prophage 327
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4663449	4664616	5231450		Stx2-converting_phage(100.0%)	1	NA	NA
AYZ42760.1|4663449_4664616_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
>prophage 328
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4671819	4672719	5231450		Cellulophaga_phage(100.0%)	1	NA	NA
AYZ42767.1|4671819_4672719_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 329
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4680074	4682895	5231450		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
AYZ42776.1|4680074_4681241_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	2.2e-110
AYZ42777.1|4681488_4682895_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.6	2.8e-38
>prophage 330
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4687169	4695885	5231450		Enterobacteria_phage(42.86%)	8	NA	NA
AYZ42782.1|4687169_4688297_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAI1	Catovirus	30.4	5.3e-32
AYZ42783.1|4688306_4689545_-	flippase	NA	NA	NA	NA	NA
AYZ42784.1|4689576_4690125_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.1	4.2e-51
AYZ42785.1|4690129_4691008_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.5e-106
AYZ42786.1|4691065_4691965_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	1.5e-29
AYZ42787.1|4691964_4693050_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	1.4e-101
AYZ42788.1|4693422_4694316_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
AYZ42789.1|4694490_4695885_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	2.8e-19
>prophage 331
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4701394	4708096	5231450		Bacillus_phage(25.0%)	6	NA	NA
AYZ42793.1|4701394_4702765_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.5	1.7e-32
AYZ42794.1|4702865_4704302_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.3e-46
AYZ42795.1|4704304_4705528_-	colanic acid biosynthesis glycosyltransferase WcaI	NA	NA	NA	NA	NA
AYZ42796.1|4705524_4706004_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
AYZ42797.1|4706006_4706972_-	GDP-fucose synthetase	NA	D1LW79	Prochlorococcus_phage	50.8	1.7e-87
AYZ42798.1|4706974_4708096_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 332
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4712340	4724738	5231450	transposase	uncultured_marine_virus(16.67%)	11	NA	NA
AYZ42804.1|4712340_4713180_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
AYZ42805.1|4713275_4715438_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	1.9e-17
AYZ42806.1|4715440_4715884_-	protein-tyrosine-phosphatase	NA	NA	NA	NA	NA
AYZ42807.1|4715889_4717029_-	lipoprotein	NA	NA	NA	NA	NA
AYZ42808.1|4717687_4719271_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
AYZ42809.1|4719534_4720560_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AYZ42810.1|4720994_4721216_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ42811.1|4721205_4721496_+	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	38.4	1.2e-09
AYZ42812.1|4721548_4723402_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
AYZ42813.1|4723423_4724005_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.8e-31
AYZ42814.1|4724096_4724738_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 333
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4729401	4730754	5231450		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AYZ42817.1|4729401_4730754_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	2.1e-06
>prophage 334
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4743869	4750732	5231450		Bacillus_phage(50.0%)	9	NA	NA
AYZ42825.1|4743869_4745273_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
AYZ42826.1|4745269_4745992_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
AYZ42827.1|4746171_4746504_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AYZ42828.1|4746712_4747009_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
AYZ42829.1|4747010_4747307_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AYZ42830.1|4747409_4748771_+	U32 family peptidase	NA	Q6DW11	Phage_TP	99.5	2.5e-217
AYZ42831.1|4748933_4749113_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ42832.1|4749100_4749418_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ42833.1|4749832_4750732_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.7e-12
>prophage 335
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4759872	4763429	5231450		Serratia_phage(50.0%)	4	NA	NA
AYZ42843.1|4759872_4760877_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	9.9e-14
AYZ42844.1|4760873_4761839_+	sugar kinase	NA	NA	NA	NA	NA
AYZ42845.1|4761812_4762559_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYZ42846.1|4762610_4763429_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	2.5e-23
>prophage 336
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4774055	4776089	5231450	tRNA	Indivirus(100.0%)	1	NA	NA
AYZ42857.1|4774055_4776089_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 337
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4787999	4797441	5231450		Enterobacteria_phage(85.71%)	10	NA	NA
AYZ42863.1|4787999_4789136_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	4.2e-162
AYZ42864.1|4789132_4791133_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
AYZ42865.1|4791257_4791719_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
AYZ42866.1|4791759_4792230_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AYZ42867.1|4792276_4792996_-	two-component system response regulator YehT	NA	NA	NA	NA	NA
AYZ42868.1|4792992_4794678_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.5	9.5e-304
AYZ42869.1|4794899_4795631_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
AYZ42870.1|4795690_4795798_+	protein YohO	NA	NA	NA	NA	NA
AYZ42871.1|4795778_4796510_-	ABC transporter permease	NA	NA	NA	NA	NA
AYZ42872.1|4796514_4797441_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.2e-23
>prophage 338
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4817701	4819222	5231450		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AYZ42891.1|4817701_4819222_-	galactose/methyl galactoside import ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 339
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4822916	4826701	5231450		Cellulophaga_phage(50.0%)	3	NA	NA
AYZ42895.1|4822916_4823585_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
AYZ42896.1|4823842_4824679_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AYZ42897.1|4824709_4826701_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.6e-13
>prophage 340
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4830769	4831627	5231450		Hokovirus(100.0%)	1	NA	NA
AYZ42901.1|4830769_4831627_+	endonuclease	NA	A0A1V0SFR4	Hokovirus	34.8	6.2e-25
>prophage 341
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4846122	4850423	5231450		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
AYZ42916.1|4846122_4847589_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.8	4.3e-42
AYZ42917.1|4847706_4848693_+	GTP-binding protein	NA	NA	NA	NA	NA
AYZ42918.1|4848731_4849445_+	lipid A 1-diphosphate synthase	NA	NA	NA	NA	NA
AYZ42919.1|4849856_4850423_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 342
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4856177	4863826	5231450		Vibrio_phage(50.0%)	7	NA	NA
AYZ42924.1|4856177_4857767_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	2.5e-19
AYZ42925.1|4857770_4858115_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ42926.1|4858447_4859638_-	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	23.7	2.9e-20
AYZ42927.1|4859665_4860361_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
AYZ42928.1|4860510_4862271_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
AYZ42929.1|4862395_4862680_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
AYZ42930.1|4862818_4863826_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
>prophage 343
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4875524	4876148	5231450		Bacillus_virus(100.0%)	1	NA	NA
AYZ42942.1|4875524_4876148_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	26.1	5.2e-13
>prophage 344
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4884910	4890679	5231450		Bacillus_phage(25.0%)	5	NA	NA
AYZ42952.1|4884910_4886554_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.2	7.2e-14
AYZ42953.1|4886629_4887280_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.4	1.1e-05
AYZ42954.1|4887279_4888344_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	3.1e-18
AYZ42955.1|4888417_4889473_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
AYZ42956.1|4889584_4890679_-	porin	NA	Q1MVN1	Enterobacteria_phage	60.2	8.8e-117
>prophage 345
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4894842	4899685	5231450		Hokovirus(50.0%)	2	NA	NA
AYZ42959.1|4894842_4897692_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	8.4e-42
AYZ42960.1|4897858_4899685_+	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	26.9	7.5e-20
>prophage 346
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4914608	4926515	5231450		Pseudomonas_phage(40.0%)	6	NA	NA
AYZ42970.1|4914608_4917236_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.4	1.4e-88
AYZ42971.1|4917382_4918105_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
AYZ42972.1|4918245_4922004_-	AIDA-I family autotransporter YfaL	NA	A0A2L1IV18	Escherichia_phage	27.6	7.2e-25
AYZ42973.1|4922699_4924985_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.4	1.3e-282
AYZ43455.1|4925130_4926261_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
AYZ42974.1|4926260_4926515_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
>prophage 347
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4929560	4930637	5231450		Staphylococcus_phage(100.0%)	1	NA	NA
AYZ42978.1|4929560_4930637_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.9e-08
>prophage 348
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4936529	4941076	5231450	transposase	Sodalis_phage(50.0%)	5	NA	NA
AYZ42983.1|4936529_4937465_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	1.5e-69
AYZ42984.1|4937477_4937663_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ42985.1|4937703_4938507_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
AYZ42986.1|4938524_4939814_-	MFS transporter	NA	NA	NA	NA	NA
AYZ43456.1|4939870_4941076_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	2.7e-26
>prophage 349
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4944678	4949682	5231450		Tupanvirus(50.0%)	4	NA	NA
AYZ42991.1|4944678_4945281_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	3.4e-09
AYZ43457.1|4945588_4946728_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	30.6	1.9e-29
AYZ42992.1|4946731_4947700_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	5.2e-36
AYZ42993.1|4947699_4949682_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	4.1e-19
>prophage 350
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4986018	4989246	5231450		Salmonella_phage(50.0%)	3	NA	NA
AYZ43026.1|4986018_4986618_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
AYZ43027.1|4986676_4988509_-	SLC13 family permease	NA	NA	NA	NA	NA
AYZ43028.1|4988595_4989246_-	sugar phosphatase	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	27.5	2.8e-09
>prophage 351
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	4999807	5001668	5231450	transposase	Sodalis_phage(50.0%)	2	NA	NA
AYZ43040.1|4999807_5000698_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	44.2	6.8e-67
AYZ43041.1|5000894_5001668_-	histidine transport ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 352
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	5005879	5007397	5231450		Mollivirus(100.0%)	1	NA	NA
AYZ43047.1|5005879_5007397_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
>prophage 353
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	5013838	5014975	5231450		Brazilian_cedratvirus(100.0%)	1	NA	NA
AYZ43055.1|5013838_5014975_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.4	1.0e-22
>prophage 354
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	5023413	5027627	5231450		Pandoravirus(50.0%)	4	NA	NA
AYZ43064.1|5023413_5024499_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
AYZ43065.1|5024533_5025466_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AYZ43066.1|5025631_5026183_+	endonuclease SmrB	NA	NA	NA	NA	NA
AYZ43067.1|5026268_5027627_+	ATP-binding protein	NA	C7BGE8	Burkholderia_phage	31.4	2.1e-06
>prophage 355
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	5044447	5045380	5231450		Enterobacteria_phage(100.0%)	1	NA	NA
AYZ43084.1|5044447_5045380_+	transporter	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
>prophage 356
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	5053308	5060884	5231450		Bacillus_phage(50.0%)	4	NA	NA
AYZ43091.1|5053308_5056902_+	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	6.2e-10
AYZ43092.1|5056957_5058103_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
AYZ43093.1|5058176_5059121_-	transporter YfdV	NA	NA	NA	NA	NA
AYZ43094.1|5059189_5060884_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
>prophage 357
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	5064574	5065495	5231450		Morganella_phage(100.0%)	1	NA	NA
AYZ43099.1|5064574_5065495_+	lipid A biosynthesis palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	6.4e-76
>prophage 358
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	5069313	5070048	5231450		Clostridioides_phage(100.0%)	1	NA	NA
AYZ43102.1|5069313_5070048_+	DNA-binding response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 359
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	5095587	5110957	5231450		Streptococcus_phage(33.33%)	15	NA	NA
AYZ43126.1|5095587_5097603_-	DNA ligase (NAD(+)) LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.5	1.0e-150
AYZ43127.1|5097673_5098672_-	cell division protein ZipA	NA	NA	NA	NA	NA
AYZ43128.1|5098901_5099663_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
AYZ43129.1|5099847_5100819_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
AYZ43130.1|5101202_5101460_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AYZ43131.1|5101504_5103232_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
AYZ43132.1|5103272_5103782_+	glucose-specific phosphotransferase enzyme IIA component	NA	NA	NA	NA	NA
AYZ43133.1|5103824_5104676_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
AYZ43134.1|5104780_5105149_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ43135.1|5105151_5106063_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.6	5.0e-57
AYZ43136.1|5106196_5107294_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
AYZ43137.1|5107283_5108159_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
AYZ43138.1|5108158_5108992_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
AYZ43139.1|5108991_5110008_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYZ43140.1|5110165_5110957_-	NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	6.8e-18
>prophage 360
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	5114435	5119370	5231450		Mycobacterium_phage(33.33%)	6	NA	NA
AYZ43144.1|5114435_5115737_+	penicillin binding protein PBP4B	NA	R4JG75	Mycobacterium_phage	23.1	2.5e-09
AYZ43145.1|5115794_5116694_-	deferrochelatase/peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
AYZ43146.1|5116789_5117365_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
AYZ43147.1|5117425_5117875_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
AYZ43148.1|5117861_5118287_-	acetyltransferase YpeA	NA	NA	NA	NA	NA
AYZ43149.1|5118500_5119370_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	3.2e-13
>prophage 361
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	5140031	5140982	5231450		Cyanophage(100.0%)	1	NA	NA
AYZ43169.1|5140031_5140982_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 362
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	5157611	5161306	5231450		Pseudomonas_phage(50.0%)	2	NA	NA
AYZ43181.1|5157611_5159279_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	53.1	6.2e-162
AYZ43182.1|5160592_5161306_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 363
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	5182573	5186574	5231450		Enterobacteria_phage(33.33%)	4	NA	NA
AYZ43203.1|5182573_5183863_-	uracil/xanthine transporter	NA	Q9KX94	Enterobacteria_phage	37.1	8.6e-63
AYZ43204.1|5183948_5184575_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AYZ43205.1|5184898_5185936_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
AYZ43206.1|5185935_5186574_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.3	1.2e-28
>prophage 364
CP033850	Escherichia coli strain FDAARGOS_497 chromosome, complete genome	5231450	5193009	5231353	5231450	tail,terminase,holin	Escherichia_phage(61.54%)	48	NA	NA
AYZ43463.1|5193009_5193183_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
AYZ43210.1|5193496_5194012_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.0e-62
AYZ43211.1|5194027_5194567_+	hypothetical protein	NA	G9L6F0	Escherichia_phage	96.6	2.9e-44
AYZ43212.1|5194786_5195269_-	DUF2514 domain-containing protein	NA	A0A0F6TK39	Escherichia_coli_O157_typing_phage	90.0	3.2e-71
AYZ43213.1|5195265_5195895_-	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	97.6	1.8e-114
AYZ43214.1|5195884_5196193_-|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	95.1	1.2e-47
AYZ43215.1|5196179_5196584_-	hypothetical protein	NA	G9L6E6	Escherichia_phage	97.0	2.7e-63
AYZ43464.1|5196806_5197103_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ43216.1|5197182_5199312_-	hypothetical protein	NA	A0A2D2W320	Escherichia_phage	44.9	4.8e-119
AYZ43465.1|5199507_5199765_+	hypothetical protein	NA	G9L6E3	Escherichia_phage	100.0	3.4e-43
AYZ43217.1|5199788_5200295_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ43218.1|5200284_5200704_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ43219.1|5201015_5201102_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ43220.1|5201147_5201840_+	BRO-like protein	NA	G9L6E2	Escherichia_phage	80.2	1.7e-97
AYZ43221.1|5201961_5202288_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ43222.1|5202214_5202763_+	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
AYZ43223.1|5202856_5203018_+	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
AYZ43224.1|5203047_5203899_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ43225.1|5203900_5207290_-	hypothetical protein	NA	A0A1E1GEP2	Vibrio_phage	36.8	3.4e-183
AYZ43226.1|5207289_5210037_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	43.5	1.2e-117
AYZ43227.1|5210036_5210612_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	95.3	7.0e-81
AYZ43228.1|5210611_5211076_-	hypothetical protein	NA	G9L6D1	Escherichia_phage	99.4	1.1e-84
AYZ43229.1|5211075_5213547_-	hypothetical protein	NA	G9L6D0	Escherichia_phage	99.3	0.0e+00
AYZ43230.1|5213546_5214152_-	hypothetical protein	NA	G9L6C9	Escherichia_phage	100.0	2.8e-112
AYZ43231.1|5214208_5214544_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
AYZ43232.1|5214554_5214992_-	hypothetical protein	NA	A0A0F6R7N9	Escherichia_coli_O157_typing_phage	94.5	1.9e-70
AYZ43233.1|5215043_5216030_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	94.5	2.5e-179
AYZ43234.1|5216044_5216740_-	peptidase	NA	G9L6C4	Escherichia_phage	100.0	6.0e-95
AYZ43235.1|5216742_5217039_-	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
AYZ43236.1|5217035_5218715_-|tail	phage tail protein	tail	G9L6C2	Escherichia_phage	99.1	3.1e-302
AYZ43237.1|5218729_5218936_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
AYZ43238.1|5219697_5220303_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ43239.1|5220307_5221777_-|terminase	terminase	terminase	G9L6B8	Escherichia_phage	97.4	1.2e-289
AYZ43240.1|5221773_5222448_-|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	99.6	3.4e-119
AYZ43241.1|5222940_5223870_-	DUF551 domain-containing protein	NA	Q1MVF7	Enterobacteria_phage	50.6	7.9e-66
AYZ43242.1|5223946_5224210_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ43243.1|5224383_5225148_-	ead/Ea22-like family protein	NA	A0A1B0VCG7	Salmonella_phage	95.6	2.4e-68
AYZ43244.1|5225149_5225449_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	97.0	1.4e-56
AYZ43245.1|5225445_5225991_-	hypothetical protein	NA	J9Q748	Salmonella_phage	83.2	3.2e-83
AYZ43246.1|5225987_5226467_-	hypothetical protein	NA	Q9MCR3	Enterobacteria_phage	54.2	1.5e-28
AYZ43247.1|5226528_5226876_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	96.5	5.9e-59
AYZ43466.1|5226993_5227779_-	replication protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	99.6	3.6e-152
AYZ43248.1|5227775_5228591_-	primosomal protein	NA	Q286X4	Escherichia_phage	95.6	1.7e-117
AYZ43249.1|5228606_5228807_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	1.0e-31
AYZ43250.1|5228957_5229188_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
AYZ43251.1|5229342_5229927_+	XRE family transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
AYZ43252.1|5230235_5230535_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	98.0	1.4e-45
AYZ43253.1|5230531_5231353_+	exodeoxyribonuclease VIII	NA	A0A2R9YJH7	Escherichia_phage	100.0	1.2e-163
>prophage 1
CP033847	Escherichia coli strain FDAARGOS_497 plasmid unnamed1, complete sequence	143865	49183	94648	143865	transposase,protease	Escherichia_phage(46.67%)	46	NA	NA
AYZ38376.1|49183_50206_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AYZ38377.1|50392_50644_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ38378.1|50610_50868_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
AYZ38463.1|50903_51020_-	replication protein RepA	NA	NA	NA	NA	NA
AYZ38462.1|51103_51178_+	positive regulator of RepFIC repA1 expression	NA	NA	NA	NA	NA
AYZ38379.1|51170_52028_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AYZ38380.1|52390_52777_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ38381.1|52966_53620_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYZ38382.1|53712_53970_+	antitoxin PemI	NA	NA	NA	NA	NA
AYZ38383.1|53971_54304_+	mRNA interferase PemK	NA	NA	NA	NA	NA
AYZ38384.1|55614_56319_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
AYZ38385.1|56453_56549_+	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
AYZ38386.1|56674_57412_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.6	6.3e-135
AYZ38387.1|57416_57527_+	hypothetical protein	NA	E4ZFP9	Streptococcus_phage	88.6	1.9e-08
AYZ38388.1|58041_58491_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ38389.1|59019_60552_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AYZ38390.1|60874_61579_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
AYZ38391.1|63498_64809_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYZ38392.1|64801_65875_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	2.6e-28
AYZ38393.1|65880_66705_-	phosphodiesterase	NA	NA	NA	NA	NA
AYZ38394.1|66715_67603_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
AYZ38464.1|67592_68459_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AYZ38395.1|69015_69210_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ38396.1|69442_70333_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
AYZ38397.1|70357_70738_+	RidA family protein	NA	NA	NA	NA	NA
AYZ38398.1|70770_71736_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
AYZ38399.1|71781_72534_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AYZ38400.1|73138_73423_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
AYZ38401.1|73422_73698_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AYZ38402.1|74580_74874_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ38403.1|75069_76239_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ38404.1|76535_76730_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ38465.1|77438_77564_+	transcriptional regulator	NA	NA	NA	NA	NA
AYZ38405.1|77684_78425_+	site-specific recombinase	NA	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
AYZ38406.1|78709_79687_-	repFIB replication protein A	NA	J9Q7H0	Salmonella_phage	59.2	3.9e-100
AYZ38407.1|82840_83773_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
AYZ38466.1|83759_85163_-	S-methylmethionine permease	NA	NA	NA	NA	NA
AYZ38408.1|85370_86387_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	4.9e-186
AYZ38409.1|86614_86932_+	type I deoxyribonuclease HsdR	NA	NA	NA	NA	NA
AYZ38410.1|87218_87578_-	pdcB	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
AYZ38411.1|87605_87785_-	PdcA protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
AYZ38412.1|87789_88170_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
AYZ38413.1|88169_88391_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
AYZ38467.1|88573_90130_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.5	7.1e-104
AYZ38414.1|90126_91410_+	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	26.5	2.9e-10
AYZ38415.1|91531_94648_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	3.7e-27
>prophage 1
CP033848	Escherichia coli strain FDAARGOS_497 plasmid unnamed2, complete sequence	97018	0	92370	97018	plate,lysis,terminase,tail,portal,transposase,holin,head	Escherichia_phage(61.9%)	113	NA	NA
AYZ38473.1|854_1691_+|tail	phage tail protein	tail	A0A077SLH5	Escherichia_phage	99.3	5.8e-153
AYZ38474.1|1769_2204_+|tail	phage tail protein	tail	A0A077SLL3	Escherichia_phage	100.0	3.3e-75
AYZ38475.1|2215_5122_+|tail	phage tail protein	tail	A0A077SK37	Escherichia_phage	97.7	1.3e-114
AYZ38476.1|5118_6021_+|tail	phage tail protein	tail	A0A0M4QWS3	Salmonella_phage	63.6	2.0e-98
AYZ38477.1|6029_6647_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	83.0	1.7e-88
AYZ38580.1|6610_7156_-	serine acetyltransferase	NA	NA	NA	NA	NA
AYZ38478.1|7320_7587_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ38479.1|7702_8032_+|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
AYZ38480.1|8028_8472_+|lysis	lysis protein	lysis	A0A077SK09	Escherichia_phage	100.0	1.3e-82
AYZ38481.1|8458_9061_+	odaE	NA	Q1MVM6	Enterobacteria_phage	99.0	3.5e-99
AYZ38482.1|9062_10982_+	hypothetical protein	NA	A0A077SLK4	Escherichia_phage	96.1	0.0e+00
AYZ38483.1|10978_11344_+	ddrA	NA	Q1MVM8	Enterobacteria_phage	97.5	3.0e-45
AYZ38484.1|11383_12592_-|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	100.0	1.8e-224
AYZ38485.1|12691_15679_+	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	99.5	0.0e+00
AYZ38486.1|15668_15974_+	hypothetical protein	NA	Q1MVN0	Enterobacteria_phage	100.0	1.2e-52
AYZ38487.1|16003_16786_-	hypothetical protein	NA	A0A077SK34	Escherichia_phage	99.2	6.0e-144
AYZ38581.1|16792_17470_-	DUF2829 domain-containing protein	NA	A0A1B0VBT1	Salmonella_phage	99.6	1.2e-127
AYZ38488.1|17667_18156_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	100.0	5.0e-88
AYZ38582.1|18325_18883_+	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
AYZ38489.1|19018_19171_+|holin	antiholin	holin	Q71TR5	Escherichia_phage	94.0	4.7e-21
AYZ38490.1|19174_20194_-|head	head processing protein	head	Q1MVN5	Enterobacteria_phage	96.5	2.1e-176
AYZ38491.1|20186_21896_-|portal	phage portal protein	portal	Q1MVN6	Enterobacteria_phage	99.6	0.0e+00
AYZ38492.1|21971_28739_+	helicase	NA	Q1MVN7	Enterobacteria_phage	98.8	0.0e+00
AYZ38493.1|28772_29213_+	peptide-binding protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
AYZ38494.1|29209_29458_+	modulator protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
AYZ38495.1|29499_30804_-	SIR2 family protein	NA	Q38324	Lactococcus_phage	30.4	3.4e-06
AYZ38496.1|30860_31502_-	maturation control protein	NA	A0A077SK30	Escherichia_phage	99.1	1.8e-114
AYZ38497.1|31689_32250_-	recombinase	NA	Q5QBN4	Enterobacteria_phage	97.8	3.2e-99
AYZ38498.1|32497_32809_-	lysogeny establishment protein	NA	Q71TG4	Escherichia_phage	99.0	2.7e-47
AYZ38499.1|32859_33891_-	recombinase	NA	Q71TG5	Escherichia_phage	99.4	1.9e-193
AYZ38500.1|33898_34120_-	creatininase	NA	A0A077SLI9	Escherichia_phage	100.0	3.4e-36
AYZ38501.1|34531_34645_+	peptidase	NA	Q5XLQ7	Enterobacteria_phage	100.0	3.2e-14
AYZ38502.1|34663_34759_+	peptidase	NA	Q38402	Escherichia_phage	100.0	2.8e-11
AYZ38503.1|34724_34934_+	c1 repressor inactivator	NA	Q5XLQ8	Enterobacteria_phage	100.0	4.8e-32
AYZ38504.1|35044_35896_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	6.1e-158
AYZ38505.1|35920_37405_-|terminase	terminase	terminase	Q5QBP2	Enterobacteria_phage	99.8	4.3e-292
AYZ38506.1|37404_38598_-|terminase	terminase	terminase	A0A077SL59	Escherichia_phage	99.7	4.7e-180
AYZ38507.1|38683_39136_-	Late promoter-activating protein	NA	Q71T63	Escherichia_phage	100.0	3.0e-79
AYZ38508.1|39224_40268_-	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	99.7	1.1e-206
AYZ38509.1|40295_40475_-	PdcA protein	NA	Q71TH5	Escherichia_phage	98.3	1.2e-23
AYZ38510.1|40479_40860_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	99.2	2.5e-63
AYZ38511.1|40859_41081_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
AYZ38512.1|41153_41543_-	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	100.0	8.3e-70
AYZ38513.1|41666_41918_-	DNA polymerase III subunit theta	NA	A0A077SLL5	Escherichia_phage	100.0	1.4e-38
AYZ38583.1|42091_42301_+	hypothetical protein	NA	A0A222YY00	Escherichia_phage	98.6	1.1e-31
AYZ38514.1|42285_42570_-	antitoxin PHD	NA	A0A222YXZ5	Escherichia_phage	100.0	2.4e-05
AYZ38515.1|42553_43492_-	hypothetical protein	NA	A0A1B0VDS6	Salmonella_phage	96.3	5.0e-169
AYZ38516.1|43473_43848_-	hypothetical protein	NA	A0A077SL57	Escherichia_phage	96.8	1.7e-67
AYZ38517.1|43854_44148_-	hypothetical protein	NA	A0A077SK23	Escherichia_phage	92.7	2.7e-44
AYZ38518.1|44326_44560_-	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	98.7	7.3e-37
AYZ38519.1|44645_44906_-	eaa protein	NA	A0A077SLR0	Escherichia_phage	96.5	9.3e-41
AYZ38520.1|44902_45784_-	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	83.9	3.2e-141
AYZ38521.1|45860_46124_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ38522.1|46297_46486_-	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	98.4	1.4e-30
AYZ38523.1|46831_47320_-	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	88.9	5.2e-45
AYZ38524.1|47316_48009_-	ead/Ea22-like family protein	NA	E7C9P6	Salmonella_phage	57.9	1.9e-40
AYZ38525.1|48005_48650_-	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	98.6	3.7e-131
AYZ38526.1|48646_48886_-	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	91.1	4.1e-35
AYZ38527.1|48878_49082_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	94.0	1.5e-30
AYZ38528.1|49078_49951_-	hypothetical protein	NA	A0A2R2Z314	Escherichia_phage	95.8	6.5e-171
AYZ38529.1|49960_50689_-	hypothetical protein	NA	Q71T76	Escherichia_phage	99.1	4.9e-140
AYZ38530.1|50882_51389_-	3'-phosphatase	NA	A0A1B0VAK0	Salmonella_phage	100.0	4.8e-94
AYZ38531.1|51461_52724_-	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	99.8	1.6e-234
AYZ38532.1|52725_52944_-	hypothetical protein	NA	Q71TI9	Escherichia_phage	100.0	3.4e-36
AYZ38533.1|53025_53727_-	hypothetical protein	NA	Q1MVG6	Enterobacteria_phage	99.6	2.1e-143
AYZ38534.1|53723_54401_-	serine/threonine protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	100.0	7.6e-135
AYZ38535.1|54397_55024_-	norphogenetic protein	NA	Q71T82	Escherichia_phage	100.0	6.1e-123
AYZ38536.1|54921_55584_-	norphogenetic protein	NA	Q71T83	Escherichia_phage	100.0	4.5e-124
AYZ38537.1|55525_55681_-	norphogenetic protein	NA	Q71TJ4	Escherichia_phage	100.0	7.0e-20
AYZ38538.1|55747_56326_-	VRR-NUC domain-containing protein	NA	Q71T85	Escherichia_phage	99.0	7.4e-107
AYZ38539.1|56611_56989_+	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
AYZ38540.1|56998_58216_+|tail	phage tail protein	tail	A0A077SL53	Escherichia_phage	100.0	1.1e-224
AYZ38541.1|58219_58948_+|tail	phage tail protein	tail	Q71TJ9	Escherichia_phage	100.0	4.2e-139
AYZ38542.1|58934_59720_+|plate	baseplate	plate	A0A1B0V7N6	Salmonella_phage	99.2	1.4e-143
AYZ38543.1|59721_60738_+|tail	phage tail tape measure protein	tail	A0A077SLQ1	Escherichia_phage	99.7	5.9e-192
AYZ38544.1|60730_61363_+|plate	baseplate protein	plate	Q1MVH8	Enterobacteria_phage	100.0	9.0e-90
AYZ38545.1|61410_62409_-	hypothetical protein	NA	A0A077SL52	Escherichia_phage	99.4	9.6e-195
AYZ38546.1|62408_63773_-	replicative DNA helicase	NA	O80281	Escherichia_phage	99.6	3.6e-253
AYZ38547.1|63763_63979_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ38548.1|64162_64990_-	SPFH/Band 7/PHB domain protein	NA	A0A077SLJ6	Escherichia_phage	100.0	1.6e-131
AYZ38549.1|64970_65207_-	hypothetical protein	NA	A0A0A7NQ74	Enterobacteria_phage	50.0	2.1e-07
AYZ38584.1|65399_65591_+	hypothetical protein	NA	Q71T98	Escherichia_phage	98.4	3.9e-28
AYZ38550.1|65979_66165_+	hypothetical protein	NA	Q71T99	Escherichia_phage	100.0	1.5e-16
AYZ38551.1|66964_68983_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	Q1MVI4	Enterobacteria_phage	96.4	0.0e+00
AYZ38552.1|68979_69885_-	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.7	1.6e-159
AYZ38553.1|69877_70162_-	hypothetical protein	NA	Q71TA2	Escherichia_phage	100.0	3.5e-49
AYZ38554.1|70436_70616_+	hypothetical protein	NA	A0A1B0V758	Salmonella_phage	100.0	3.1e-27
AYZ38555.1|70624_71413_+	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	97.3	2.6e-118
AYZ38556.1|71452_71875_+	ppfA	NA	A0A1B0VCB0	Salmonella_phage	99.3	6.1e-58
AYZ38557.1|72052_72445_+	hypothetical protein	NA	Q1MVJ1	Enterobacteria_phage	98.5	2.0e-71
AYZ38558.1|72780_73665_+	RepB family plasmid replication initiator protein	NA	A0A077SLP3	Escherichia_phage	100.0	2.1e-161
AYZ38559.1|73957_74767_+	GIY-YIG nuclease family protein	NA	A0A077SK46	Escherichia_phage	97.4	2.1e-155
AYZ38560.1|74935_76132_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
AYZ38561.1|76148_77150_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
AYZ38562.1|77375_79082_+	hypothetical protein	NA	Q71TM1	Escherichia_phage	100.0	0.0e+00
AYZ38563.1|79142_80732_+	hypothetical protein	NA	Q71TB2	Escherichia_phage	99.8	4.3e-306
AYZ38564.1|80741_81557_+	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	99.3	2.6e-113
AYZ38565.1|81592_82174_+	hypothetical protein	NA	Q71TM4	Escherichia_phage	96.9	6.1e-101
AYZ38566.1|82185_82695_+|plate	baseplate protein	plate	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
AYZ38567.1|82866_83463_+	hypothetical protein	NA	A0A077SLI4	Escherichia_phage	99.0	2.0e-107
AYZ38585.1|83645_83891_-	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	45.0	3.5e-13
AYZ38568.1|83941_84787_-	Replication protein repL	NA	Q1MVK3	Enterobacteria_phage	99.3	8.5e-152
AYZ38569.1|84816_85617_-	DNA-binding protein	NA	Q1MVK4	Enterobacteria_phage	100.0	1.9e-148
AYZ38570.1|85781_86825_-	phage antirepressor Ant	NA	Q71TN2	Escherichia_phage	98.8	9.1e-188
AYZ38571.1|86821_87043_-	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	93.2	2.6e-36
AYZ38572.1|87076_87247_-	transcriptional regulator	NA	NA	NA	NA	NA
AYZ38586.1|87470_88109_+	simA domain protein	NA	Q71TC4	Escherichia_phage	90.2	3.1e-13
AYZ38573.1|88173_88524_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ38574.1|88546_89023_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ38575.1|89097_90132_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
AYZ38576.1|90285_90852_+	hypothetical protein	NA	Q71TN7	Escherichia_phage	98.9	3.3e-99
AYZ38577.1|90862_91474_+|tail	phage tail protein	tail	Q71TN8	Escherichia_phage	99.0	8.4e-109
AYZ38578.1|91488_92370_+	morphogenetic protein	NA	A0A1B0VBL3	Salmonella_phage	99.7	3.7e-174
>prophage 2
CP033848	Escherichia coli strain FDAARGOS_497 plasmid unnamed2, complete sequence	97018	96086	96443	97018		Escherichia_phage(100.0%)	1	NA	NA
AYZ38579.1|96086_96443_+	hypothetical protein	NA	Q71TP1	Escherichia_phage	99.2	6.5e-61
