The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	0	3917	5864574		Salmonella_phage(100.0%)	5	NA	NA
AYZ49849.1|649_1714_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
AYZ54995.1|1699_1813_-	DUF2770 domain-containing protein	NA	NA	NA	NA	NA
AYZ49850.1|1888_3007_-	N-methyl-L-tryptophan oxidase	NA	NA	NA	NA	NA
AYZ49851.1|3130_3385_-	biofilm formation regulator BssS	NA	NA	NA	NA	NA
AYZ49852.1|3671_3917_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	47.4	7.7e-13
>prophage 2
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	25157	26339	5864574		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
AYZ49871.1|25157_25892_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	2.9e-15
AYZ49872.1|26102_26339_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 3
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	35944	36586	5864574		Pseudomonas_phage(100.0%)	1	NA	NA
AYZ49882.1|35944_36586_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	37.6	1.3e-27
>prophage 4
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	52357	52615	5864574		Erwinia_phage(100.0%)	1	NA	NA
AYZ49896.1|52357_52615_+	DUF1471 domain-containing protein	NA	A0A1B2IFR9	Erwinia_phage	38.6	3.6e-05
>prophage 5
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	58903	62654	5864574		Planktothrix_phage(50.0%)	4	NA	NA
AYZ49899.1|58903_59605_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	41.3	9.2e-35
AYZ49900.1|59604_60849_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
AYZ49901.1|60897_61809_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
AYZ49902.1|61823_62654_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	33.5	3.6e-22
>prophage 6
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	69906	70857	5864574		Cyanophage(100.0%)	1	NA	NA
AYZ49911.1|69906_70857_+	transaldolase	NA	A0A127KMN5	Cyanophage	35.1	1.2e-13
>prophage 7
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	76204	77341	5864574		Mycoplasma_phage(100.0%)	1	NA	NA
AYZ49917.1|76204_77341_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	42.0	1.7e-30
>prophage 8
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	84117	150925	5864574	capsid,portal,integrase,terminase,plate,tail,head,tRNA	Enterobacteria_phage(52.78%)	72	105012:105028	141124:141140
AYZ49924.1|84117_85488_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	2.1e-107
AYZ49925.1|85491_86133_-	lysogenization regulator HflD	NA	NA	NA	NA	NA
AYZ49926.1|86192_87344_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AYZ49927.1|87337_87814_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AYZ49928.1|87834_88485_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AYZ49929.1|88721_89972_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	4.4e-19
AYZ49930.1|90068_90407_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ49931.1|90603_92388_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.7	3.3e-20
AYZ49932.1|92468_93656_-	HD domain-containing protein	NA	NA	NA	NA	NA
AYZ49933.1|93934_94978_+	type II asparaginase	NA	NA	NA	NA	NA
AYZ49934.1|95808_98139_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AYZ49935.1|98236_99184_-	fec operon regulator FecR	NA	NA	NA	NA	NA
AYZ49936.1|99180_99702_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AYZ49937.1|99959_100748_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYZ49938.1|101286_102201_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	51.2	1.0e-73
AYZ49939.1|102290_102929_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
AYZ49940.1|103057_103321_+	DUF2534 family protein	NA	NA	NA	NA	NA
AYZ49941.1|103369_103495_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ55000.1|103635_103752_-	protein YoaJ	NA	NA	NA	NA	NA
AYZ49942.1|103709_103811_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ49943.1|103868_104882_-	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
105012:105028	attL	AAAAAAGCCCCGTCGGG	NA	NA	NA	NA
AYZ49944.1|105114_106128_-|integrase	integrase	integrase	Q83VS6	Escherichia_phage	78.8	9.2e-153
AYZ49945.1|106243_106543_-	XRE family transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	76.8	5.5e-37
AYZ49946.1|106663_106933_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	88.8	3.9e-42
AYZ49947.1|106929_107256_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ49948.1|107386_107605_+	DUF4761 domain-containing protein	NA	A0A0M5M1I3	Salmonella_phage	47.3	1.6e-06
AYZ49949.1|107620_107998_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ49950.1|108013_108286_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ49951.1|108354_108579_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ49952.1|108575_109142_+	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	32.1	4.7e-13
AYZ55001.1|109150_109378_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	41.0	1.9e-05
AYZ49953.1|109374_110310_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	55.4	6.4e-84
AYZ49954.1|113447_115997_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ49955.1|116712_117774_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	70.2	1.5e-145
AYZ49956.1|117767_119495_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	68.3	3.1e-233
AYZ49957.1|119651_120491_+|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	64.5	2.3e-93
AYZ49958.1|120500_121535_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	8.1e-96
AYZ49959.1|121584_122442_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	60.9	8.3e-70
AYZ49960.1|122554_123070_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	49.4	4.1e-40
AYZ49961.1|123069_123270_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	61.5	6.1e-16
AYZ49962.1|123260_123545_+|tail	phage tail protein	tail	NA	NA	NA	NA
AYZ49963.1|123541_124087_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	43.6	2.2e-31
AYZ55002.1|124098_124428_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AYZ49964.1|124609_125077_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	59.5	7.0e-47
AYZ49965.1|125073_125709_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.9	4.6e-57
AYZ49966.1|125705_126293_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	59.5	4.5e-59
AYZ49967.1|126289_126640_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	55.7	3.5e-27
AYZ49968.1|126641_127565_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	43.2	2.2e-52
AYZ49969.1|127554_130584_+|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	6.4e-24
AYZ49970.1|130580_130796_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ49971.1|130780_131878_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	29.3	1.3e-11
AYZ49972.1|132019_132577_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ49973.1|132822_133584_+	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
AYZ49974.1|133832_134270_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	67.6	9.4e-54
AYZ49975.1|134285_137261_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.6	9.5e-222
AYZ55003.1|137247_137406_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.3	3.5e-11
AYZ49976.1|137405_137714_-|tail	phage tail assembly protein	tail	A0A0A7NPZ0	Enterobacteria_phage	46.8	2.2e-12
AYZ49977.1|137759_138275_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	62.4	1.3e-57
AYZ49978.1|138274_139447_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.5	8.5e-158
AYZ49979.1|139601_140741_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	70.2	3.0e-144
AYZ49980.1|140784_141027_+	hypothetical protein	NA	A0A2I8TV89	Erwinia_phage	50.0	2.5e-08
AYZ49981.1|141290_141530_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
141124:141140	attR	AAAAAAGCCCCGTCGGG	NA	NA	NA	NA
AYZ55004.1|141533_141881_-	DUF488 domain-containing protein	NA	NA	NA	NA	NA
AYZ49982.1|141867_142377_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
AYZ49983.1|142539_143232_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ49984.1|143269_144454_-	MFS transporter	NA	NA	NA	NA	NA
AYZ49985.1|144554_145346_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYZ49986.1|145329_145776_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
AYZ49987.1|145954_146455_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
AYZ49988.1|146488_147985_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.0	2.2e-09
AYZ55005.1|148438_149596_+	lipopolysaccharide heptosyltransferase family protein	NA	NA	NA	NA	NA
AYZ49989.1|149641_150925_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.1	3.4e-11
>prophage 9
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	158991	160245	5864574		Tupanvirus(100.0%)	1	NA	NA
AYZ49997.1|158991_160245_-	glycoside hydrolase family 18 protein	NA	A0A2K9L3D4	Tupanvirus	27.9	3.1e-25
>prophage 10
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	165934	169991	5864574		Staphylococcus_phage(50.0%)	4	NA	NA
AYZ50003.1|165934_166918_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	23.9	3.3e-06
AYZ50004.1|167053_167812_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AYZ50005.1|167953_169312_+	MFS transporter	NA	NA	NA	NA	NA
AYZ50006.1|169349_169991_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	38.5	5.9e-20
>prophage 11
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	176096	178052	5864574		Streptococcus_phage(100.0%)	1	NA	NA
AYZ50012.1|176096_178052_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.7	9.8e-42
>prophage 12
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	182688	183321	5864574		Bacillus_phage(100.0%)	1	NA	NA
AYZ50019.1|182688_183321_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	29.1	1.3e-11
>prophage 13
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	189331	190552	5864574		Klosneuvirus(100.0%)	1	NA	NA
AYZ50026.1|189331_190552_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.5	1.2e-26
>prophage 14
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	200143	200971	5864574		Bacillus_virus(100.0%)	1	NA	NA
AYZ50035.1|200143_200971_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	53.1	1.6e-70
>prophage 15
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	207186	212925	5864574		Tupanvirus(50.0%)	5	NA	NA
AYZ50043.1|207186_209445_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	49.9	1.6e-144
AYZ50044.1|209542_209881_+	cell division activator CedA	NA	NA	NA	NA	NA
AYZ50045.1|209955_211347_-	L-cystine transporter	NA	NA	NA	NA	NA
AYZ50046.1|211481_212072_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYZ50047.1|212163_212925_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.4	1.4e-15
>prophage 16
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	217307	218624	5864574		Streptococcus_phage(100.0%)	1	NA	NA
AYZ55007.1|217307_218624_-	voltage-gated chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	32.8	7.8e-43
>prophage 17
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	226130	229088	5864574		Acinetobacter_phage(100.0%)	2	NA	NA
AYZ50061.1|226130_227489_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.2e-35
AYZ50062.1|227492_229088_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	36.4	1.4e-46
>prophage 18
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	242020	244618	5864574		Tupanvirus(100.0%)	1	NA	NA
AYZ50074.1|242020_244618_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.0	1.7e-89
>prophage 19
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	249466	250057	5864574		Staphylococcus_phage(100.0%)	1	NA	NA
AYZ50078.1|249466_250057_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.5	1.6e-43
>prophage 20
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	260544	261354	5864574		Bacillus_virus(100.0%)	1	NA	NA
AYZ50089.1|260544_261354_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.2	4.7e-14
>prophage 21
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	290771	292457	5864574		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AYZ50115.1|290771_292457_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.6	2.0e-19
>prophage 22
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	317871	318600	5864574		Enterobacteria_phage(100.0%)	1	NA	NA
AYZ50135.1|317871_318600_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	46.4	2.1e-45
>prophage 23
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	330696	334375	5864574		Cronobacter_phage(33.33%)	4	NA	NA
AYZ50147.1|330696_331119_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	55.1	8.9e-33
AYZ50148.1|331118_332384_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	65.9	3.8e-156
AYZ50149.1|332547_333615_-	oxidoreductase	NA	NA	NA	NA	NA
AYZ50150.1|333628_334375_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.4	5.4e-17
>prophage 24
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	344196	351107	5864574	tRNA,protease	Enterobacteria_phage(40.0%)	7	NA	NA
AYZ55016.1|344196_345570_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.4	1.8e-50
AYZ50160.1|345614_346550_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.4	7.0e-139
AYZ50161.1|347500_348439_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
AYZ50162.1|348645_348936_-	lipoprotein bor	NA	C6ZCX3	Enterobacteria_phage	66.0	9.7e-31
AYZ50163.1|349121_349556_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	51.4	7.2e-30
AYZ50164.1|349638_349851_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
AYZ50165.1|350000_351107_-	porin	NA	Q1MVN1	Enterobacteria_phage	57.7	4.9e-107
>prophage 25
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	355631	361021	5864574	holin	Enterobacterial_phage(33.33%)	9	NA	NA
AYZ55017.1|355631_356168_+	helix-turn-helix transcriptional regulator	NA	K7PKK1	Enterobacteria_phage	50.3	4.7e-31
AYZ50167.1|356629_356992_+	antitermination protein	NA	C6ZR44	Salmonella_phage	55.8	4.3e-28
AYZ50168.1|357068_357461_+	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	54.5	1.5e-26
AYZ50169.1|357450_357723_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	56.6	1.2e-17
AYZ50170.1|357730_358273_+	hypothetical protein	NA	A0A0U2I1S0	Escherichia_phage	63.5	4.1e-67
AYZ50171.1|358503_358869_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ50172.1|359196_359469_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AYZ50173.1|359465_359906_-	heat shock protein HslJ	NA	NA	NA	NA	NA
AYZ50174.1|360031_361021_-	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	45.7	1.9e-70
>prophage 26
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	404542	409807	5864574		Klosneuvirus(50.0%)	3	NA	NA
AYZ50214.1|404542_408445_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	1.7e-53
AYZ50215.1|408668_409058_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ50216.1|409147_409807_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	51.9	9.0e-32
>prophage 27
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	423670	428858	5864574		Bacillus_phage(20.0%)	8	NA	NA
AYZ50230.1|423670_424642_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.4	2.3e-12
AYZ50231.1|424723_424927_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	53.7	3.5e-11
AYZ50232.1|425206_425404_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ50233.1|425787_426030_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	82.3	1.6e-31
AYZ50234.1|426245_426773_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	1.2e-18
AYZ50235.1|426863_427337_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYZ50236.1|427441_427717_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
AYZ50237.1|427739_428858_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	29.7	6.2e-33
>prophage 28
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	436222	437731	5864574		Moumouvirus(100.0%)	1	NA	NA
AYZ50245.1|436222_437731_+	carboxylesterase/lipase family protein	NA	M1PNU1	Moumouvirus	34.4	4.6e-31
>prophage 29
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	451799	453764	5864574	protease	Phage_TP(100.0%)	1	NA	NA
AYZ50258.1|451799_453764_+|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	28.1	5.1e-22
>prophage 30
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	459908	460919	5864574		Mycoplasma_phage(100.0%)	1	NA	NA
AYZ50265.1|459908_460919_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	55.8	1.4e-23
>prophage 31
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	477915	480012	5864574		Salmonella_phage(100.0%)	1	NA	NA
AYZ55020.1|477915_480012_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	68.8	2.9e-140
>prophage 32
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	490305	491085	5864574		Bacillus_virus(100.0%)	1	NA	NA
AYZ50292.1|490305_491085_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.0	1.2e-19
>prophage 33
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	509735	511832	5864574		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AYZ50309.1|509735_511832_+	peptidase domain-containing ABC transporter	NA	F2Y165	Organic_Lake_phycodnavirus	27.6	1.0e-12
>prophage 34
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	515915	516617	5864574		Bacillus_virus(100.0%)	1	NA	NA
AYZ50313.1|515915_516617_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	32.7	1.4e-30
>prophage 35
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	521972	523517	5864574		Escherichia_phage(100.0%)	1	NA	NA
AYZ50319.1|521972_523517_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	44.6	1.9e-19
>prophage 36
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	529622	533292	5864574		Mycobacterium_phage(50.0%)	3	NA	NA
AYZ50323.1|529622_531113_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	29.8	5.4e-32
AYZ50324.1|531116_531914_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
AYZ50325.1|532173_533292_+	muconate cycloisomerase	NA	Q6A202	Oenococcus_phage	23.8	5.5e-05
>prophage 37
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	537598	538372	5864574		Bacillus_phage(100.0%)	1	NA	NA
AYZ50331.1|537598_538372_+	1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase	NA	W8CYX9	Bacillus_phage	48.5	2.2e-05
>prophage 38
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	548438	550043	5864574		Planktothrix_phage(100.0%)	1	NA	NA
AYZ50342.1|548438_550043_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.3	9.9e-16
>prophage 39
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	553759	558542	5864574		Tupanvirus(66.67%)	4	NA	NA
AYZ50346.1|553759_554770_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.6	4.3e-25
AYZ50347.1|555027_555627_+	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	39.5	5.0e-21
AYZ50348.1|555824_556793_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYZ50349.1|556829_558542_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	25.4	2.5e-33
>prophage 40
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	577421	581005	5864574		Bacillus_virus(50.0%)	2	NA	NA
AYZ50366.1|577421_578117_+	MgtC family protein	NA	G3MA03	Bacillus_virus	43.1	8.1e-15
AYZ50367.1|578272_581005_+	magnesium-translocating P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	25.6	6.6e-36
>prophage 41
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	593250	597366	5864574		Klosneuvirus(50.0%)	4	NA	NA
AYZ50379.1|593250_594636_-	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.3	9.7e-28
AYZ50380.1|594943_595879_-	thiamine biosynthesis protein	NA	NA	NA	NA	NA
AYZ50381.1|595903_596644_-	ABC transporter permease	NA	NA	NA	NA	NA
AYZ50382.1|596640_597366_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.4	2.6e-24
>prophage 42
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	615633	616518	5864574		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AYZ50399.1|615633_616518_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	56.1	2.2e-81
>prophage 43
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	636114	656684	5864574		Bacillus_phage(50.0%)	5	NA	NA
AYZ50412.1|636114_637917_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	24.7	1.4e-18
AYZ50413.1|637903_639706_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	29.7	1.0e-29
AYZ55027.1|639872_640832_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
AYZ50414.1|641012_647120_+	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	26.2	6.8e-33
AYZ50415.1|647207_656684_+	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	35.9	1.5e-47
>prophage 44
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	669267	669729	5864574		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AYZ50428.1|669267_669729_-	RidA family protein	NA	M1I5B0	Acanthocystis_turfacea_Chlorella_virus	42.0	4.4e-25
>prophage 45
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	700934	701771	5864574		Mycobacterium_phage(100.0%)	1	NA	NA
AYZ50463.1|700934_701771_-	alpha/beta hydrolase	NA	A0A1I9SAY0	Mycobacterium_phage	37.7	3.1e-13
>prophage 46
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	713488	715021	5864574		Staphylococcus_phage(100.0%)	1	NA	NA
AYZ50477.1|713488_715021_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.6	1.1e-16
>prophage 47
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	729435	732998	5864574		Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
AYZ50491.1|729435_730431_+	oxidoreductase	NA	M1I0I9	Paramecium_bursaria_Chlorella_virus	32.5	6.7e-23
AYZ50492.1|730520_731783_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
AYZ50493.1|731912_732998_-	porin	NA	Q1MVN1	Enterobacteria_phage	67.1	7.9e-142
>prophage 48
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	737358	738168	5864574		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
AYZ50498.1|737358_738168_-	ABC transporter ATP-binding protein	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.0	4.8e-11
>prophage 49
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	742150	743608	5864574		Mycoplasma_phage(100.0%)	1	NA	NA
AYZ50503.1|742150_743608_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	37.4	4.7e-41
>prophage 50
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	750221	750962	5864574		Indivirus(100.0%)	1	NA	NA
AYZ50511.1|750221_750962_-	amino acid ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.1	7.3e-14
>prophage 51
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	754214	755006	5864574		Bacillus_virus(100.0%)	1	NA	NA
AYZ50517.1|754214_755006_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	29.0	2.8e-19
>prophage 52
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	781041	782403	5864574		Bacillus_phage(100.0%)	1	NA	NA
AYZ50543.1|781041_782403_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.4	2.9e-16
>prophage 53
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	787972	788734	5864574		Escherichia_phage(100.0%)	1	NA	NA
AYZ50550.1|787972_788734_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	34.9	2.0e-30
>prophage 54
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	793290	794052	5864574		Moraxella_phage(100.0%)	1	NA	NA
AYZ50555.1|793290_794052_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.1	1.0e-42
>prophage 55
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	801621	802002	5864574		Streptococcus_phage(100.0%)	1	NA	NA
AYZ55029.1|801621_802002_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	1.4e-08
>prophage 56
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	805299	806805	5864574		Staphylococcus_phage(50.0%)	2	NA	NA
AYZ50568.1|805299_805998_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.3	2.4e-14
AYZ50569.1|806007_806805_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	27.4	3.6e-11
>prophage 57
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	810980	812084	5864574		uncultured_virus(100.0%)	1	NA	NA
AYZ50573.1|810980_812084_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	48.9	1.4e-101
>prophage 58
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	820683	827903	5864574		Escherichia_phage(50.0%)	5	NA	NA
AYZ50583.1|820683_821754_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	44.3	3.8e-64
AYZ50584.1|821961_825069_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AYZ50585.1|825124_826375_+	MFS transporter	NA	NA	NA	NA	NA
AYZ50586.1|826448_827537_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	81.9	9.2e-175
AYZ50587.1|827639_827903_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	81.2	1.1e-33
>prophage 59
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	832692	835936	5864574		uncultured_Caudovirales_phage(33.33%)	4	NA	NA
AYZ50595.1|832692_833364_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.0	7.6e-79
AYZ55031.1|833540_834152_+	transporter	NA	NA	NA	NA	NA
AYZ50596.1|834246_835515_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	88.2	1.7e-220
AYZ50597.1|835516_835936_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	6.1e-34
>prophage 60
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	842319	859591	5864574		Escherichia_phage(37.5%)	17	NA	NA
AYZ50604.1|842319_844362_-	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	23.2	9.0e-14
AYZ50605.1|844534_845284_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
AYZ50606.1|845372_846059_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYZ50607.1|846110_846542_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.3	8.8e-20
AYZ55032.1|846810_848274_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.9	2.1e-44
AYZ50608.1|848508_849885_-	MFS transporter	NA	NA	NA	NA	NA
AYZ50609.1|849928_850948_-	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
AYZ50610.1|850963_852178_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	30.2	2.3e-49
AYZ50611.1|852388_852715_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	56.6	4.4e-24
AYZ50612.1|852851_853193_+	DUF1283 family protein	NA	NA	NA	NA	NA
AYZ50613.1|853253_853814_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AYZ50614.1|853807_854518_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AYZ50615.1|854620_854872_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AYZ50616.1|855020_857456_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.8	1.8e-215
AYZ50617.1|857466_858084_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.1	5.8e-73
AYZ50618.1|858085_858943_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AYZ50619.1|858982_859591_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.1	5.9e-22
>prophage 61
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	871108	873265	5864574		Bacillus_virus(100.0%)	1	NA	NA
AYZ50630.1|871108_873265_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	35.5	3.2e-17
>prophage 62
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	880519	881479	5864574		Salmonella_phage(100.0%)	1	NA	NA
AYZ50640.1|880519_881479_+	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	1.0e-52
>prophage 63
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	890699	893477	5864574		Lactobacillus_phage(100.0%)	1	NA	NA
AYZ50649.1|890699_893477_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.3	1.2e-66
>prophage 64
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	910030	910546	5864574		Streptococcus_phage(100.0%)	1	NA	NA
AYZ50664.1|910030_910546_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.5	2.0e-23
>prophage 65
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	922524	923826	5864574		Bacillus_phage(100.0%)	1	NA	NA
AYZ50676.1|922524_923826_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.0	1.1e-17
>prophage 66
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	935401	935605	5864574		Salmonella_phage(100.0%)	1	NA	NA
AYZ55034.1|935401_935605_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	68.7	3.5e-19
>prophage 67
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	940946	942317	5864574		Pandoravirus(100.0%)	1	NA	NA
AYZ50691.1|940946_942317_+	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	34.1	1.4e-66
>prophage 68
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	953508	954783	5864574	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
AYZ50703.1|953508_954783_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.8	5.5e-86
>prophage 69
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	963617	965095	5864574		Salmonella_phage(50.0%)	2	NA	NA
AYZ50712.1|963617_964139_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	56.3	1.2e-47
AYZ50713.1|964198_965095_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.3	1.1e-08
>prophage 70
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	969251	978150	5864574		Bacillus_phage(20.0%)	9	NA	NA
AYZ50719.1|969251_970106_+	peptidoglycan endopeptidase	NA	A0A217EQL1	Bacillus_phage	38.7	4.7e-17
AYZ50720.1|970417_970999_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.5	1.7e-42
AYZ50721.1|971055_972222_-	MFS transporter	NA	NA	NA	NA	NA
AYZ50722.1|972392_972482_-	YnhF family membrane protein	NA	NA	NA	NA	NA
AYZ50723.1|972778_973804_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.2	2.8e-32
AYZ50724.1|973822_974734_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYZ50725.1|974845_976030_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
AYZ50726.1|976330_977479_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	6.5e-86
AYZ50727.1|977508_978150_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.3	1.3e-22
>prophage 71
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	989812	990811	5864574		Enterobacteria_phage(100.0%)	1	NA	NA
AYZ55039.1|989812_990811_+	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	29.9	2.0e-22
>prophage 72
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	998383	1002475	5864574		Trichoplusia_ni_ascovirus(50.0%)	5	NA	NA
AYZ50745.1|998383_999268_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	55.8	1.4e-80
AYZ50746.1|999289_1000096_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AYZ50747.1|1000200_1000836_-	carbonic anhydrase	NA	NA	NA	NA	NA
AYZ50748.1|1001061_1001691_+	LysE family translocator	NA	NA	NA	NA	NA
AYZ50749.1|1001704_1002475_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.7	1.2e-16
>prophage 73
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1006681	1007728	5864574		Bacillus_virus(100.0%)	1	NA	NA
AYZ50755.1|1006681_1007728_+	methionine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.0	1.1e-18
>prophage 74
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1011527	1013470	5864574		Bacillus_virus(50.0%)	2	NA	NA
AYZ50758.1|1011527_1012508_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.9	3.8e-10
AYZ50759.1|1012504_1013470_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SJ29	Klosneuvirus	26.0	2.4e-09
>prophage 75
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1024235	1025108	5864574		Lactobacillus_phage(100.0%)	1	NA	NA
AYZ50766.1|1024235_1025108_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	9.5e-05
>prophage 76
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1028531	1029602	5864574		Bacillus_virus(100.0%)	1	NA	NA
AYZ50770.1|1028531_1029602_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	1.3e-27
>prophage 77
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1033536	1034232	5864574		Brazilian_cedratvirus(100.0%)	1	NA	NA
AYZ50774.1|1033536_1034232_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.9	5.0e-17
>prophage 78
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1054801	1059137	5864574		Planktothrix_phage(50.0%)	3	NA	NA
AYZ50791.1|1054801_1055623_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.0	4.3e-15
AYZ50792.1|1056180_1058202_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AYZ50793.1|1058348_1059137_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	33.8	7.2e-28
>prophage 79
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1072010	1073974	5864574		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
AYZ50805.1|1072010_1073027_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.0e-42
AYZ50806.1|1073023_1073974_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.9	6.2e-34
>prophage 80
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1092131	1095344	5864574		environmental_halophage(50.0%)	3	NA	NA
AYZ50824.1|1092131_1093352_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.7	4.4e-93
AYZ50825.1|1093348_1094623_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
AYZ50826.1|1094597_1095344_-	Fe-S cluster assembly ATPase SufC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	22.7	6.2e-05
>prophage 81
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1105006	1123112	5864574	tRNA	Tupanvirus(28.57%)	18	NA	NA
AYZ50835.1|1105006_1107385_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.0	5.0e-173
AYZ50836.1|1107727_1108561_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
AYZ55045.1|1108715_1109762_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.3	1.2e-81
AYZ50837.1|1109880_1110108_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
AYZ50838.1|1110142_1111585_-	YdiU family protein	NA	NA	NA	NA	NA
AYZ50839.1|1111836_1112301_-	endopeptidase	NA	NA	NA	NA	NA
AYZ50840.1|1112382_1113132_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A285PWH2	Cedratvirus	28.2	9.6e-06
AYZ50841.1|1113131_1113683_-	glutathione peroxidase	NA	NA	NA	NA	NA
AYZ50842.1|1113908_1114709_+	MetQ/NlpA family lipoprotein	NA	NA	NA	NA	NA
AYZ50843.1|1114766_1115825_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
AYZ50844.1|1115849_1116149_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	9.4e-13
AYZ50845.1|1116153_1118541_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AYZ50846.1|1118556_1119540_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	2.9e-34
AYZ55046.1|1119769_1119814_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
AYZ50847.1|1119936_1120293_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
AYZ50848.1|1120343_1120541_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
AYZ50849.1|1120637_1121180_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.3	5.3e-14
AYZ50850.1|1121183_1123112_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	6.7e-128
>prophage 82
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1132463	1135360	5864574		Bacillus_virus(66.67%)	3	NA	NA
AYZ50863.1|1132463_1133300_-	transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	41.2	2.3e-08
AYZ50864.1|1133345_1134350_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.2	1.5e-14
AYZ50865.1|1134346_1135360_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.2	6.4e-13
>prophage 83
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1143663	1153617	5864574		Citrobacter_phage(20.0%)	11	NA	NA
AYZ50871.1|1143663_1144281_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.1	5.1e-53
AYZ50872.1|1144425_1144746_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ50873.1|1144839_1145247_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
AYZ50874.1|1145380_1146283_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.9	8.2e-60
AYZ50875.1|1146480_1147494_-	two-component system response regulator RssB	NA	Q6XM27	Feldmannia_irregularis_virus	27.7	2.6e-06
AYZ50876.1|1147583_1148483_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
AYZ50877.1|1148595_1149054_+	YchJ family protein	NA	NA	NA	NA	NA
AYZ50878.1|1149096_1149939_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	8.3e-14
AYZ50879.1|1150697_1151375_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
AYZ50880.1|1151374_1152085_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
AYZ50881.1|1152081_1153617_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	3.7e-20
>prophage 84
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1170050	1170839	5864574		Bacillus_virus(100.0%)	1	NA	NA
AYZ50889.1|1170050_1170839_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.4	7.7e-30
>prophage 85
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1176203	1182117	5864574		Mythimna_unipuncta_granulovirus(33.33%)	7	NA	NA
AYZ50895.1|1176203_1176434_-	putative cation transport regulator ChaB	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	46.7	1.2e-07
AYZ50896.1|1176699_1177800_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
AYZ50897.1|1177888_1178743_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.8	8.9e-48
AYZ50898.1|1178990_1179803_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
AYZ50899.1|1179806_1180199_-	SirB family protein	NA	NA	NA	NA	NA
AYZ50900.1|1180195_1181035_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AYZ50901.1|1181034_1182117_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	40.0	1.1e-07
>prophage 86
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1185331	1188207	5864574		Tupanvirus(50.0%)	2	NA	NA
AYZ50905.1|1185331_1186279_+	ribose-phosphate pyrophosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	3.0e-44
AYZ50906.1|1186527_1188207_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	24.8	5.5e-25
>prophage 87
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1209155	1210631	5864574		Enterobacteria_phage(100.0%)	1	NA	NA
AYZ50923.1|1209155_1210631_+	purine permease	NA	Q9KX94	Enterobacteria_phage	27.7	2.8e-25
>prophage 88
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1213657	1214116	5864574		Acinetobacter_phage(100.0%)	1	NA	NA
AYZ50926.1|1213657_1214116_-	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	36.6	1.6e-19
>prophage 89
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1220943	1225872	5864574		Morganella_phage(33.33%)	5	NA	NA
AYZ50930.1|1220943_1221471_+	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	58.2	1.3e-49
AYZ50931.1|1221549_1222044_-	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
AYZ50932.1|1222276_1223917_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.6	4.1e-134
AYZ50933.1|1224232_1225126_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYZ50934.1|1225185_1225872_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.4	1.8e-06
>prophage 90
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1242178	1242790	5864574		Geobacillus_virus(100.0%)	1	NA	NA
AYZ50947.1|1242178_1242790_-	membrane-bound lytic murein transglycosylase EmtA	NA	A0A0H3V0Q1	Geobacillus_virus	40.7	3.0e-05
>prophage 91
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1258280	1266365	5864574	tRNA	Bacillus_phage(66.67%)	7	NA	NA
AYZ55051.1|1258280_1259966_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.2	3.2e-33
AYZ50963.1|1260174_1260759_-	Slp family lipoprotein	NA	NA	NA	NA	NA
AYZ50964.1|1260802_1261498_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
AYZ50965.1|1261565_1263476_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.8	5.5e-90
AYZ50966.1|1263608_1263953_+	RidA family protein	NA	NA	NA	NA	NA
AYZ55052.1|1264120_1265263_-	alginate lyase	NA	NA	NA	NA	NA
AYZ50967.1|1265270_1266365_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	W8CYL7	Bacillus_phage	28.5	1.7e-14
>prophage 92
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1273531	1274887	5864574		Pandoravirus(100.0%)	1	NA	NA
AYZ50973.1|1273531_1274887_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	41.9	1.9e-44
>prophage 93
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1278786	1280346	5864574		Moraxella_phage(100.0%)	1	NA	NA
AYZ50977.1|1278786_1280346_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.0	6.6e-41
>prophage 94
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1287782	1287992	5864574		Morganella_phage(100.0%)	1	NA	NA
AYZ50985.1|1287782_1287992_-	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 95
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1293247	1295296	5864574		Moraxella_phage(100.0%)	1	NA	NA
AYZ50993.1|1293247_1295296_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.0	9.8e-85
>prophage 96
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1302765	1303419	5864574		Escherichia_phage(100.0%)	1	NA	NA
AYZ51000.1|1302765_1303419_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	53.6	1.3e-59
>prophage 97
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1312668	1313637	5864574		Pectobacterium_phage(50.0%)	2	NA	NA
AYZ51009.1|1312668_1312899_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	58.8	1.3e-14
AYZ51010.1|1312977_1313637_+	exodeoxyribonuclease X	NA	A0A0H4IT92	Pseudoalteromonas_phage	32.3	1.0e-14
>prophage 98
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1321107	1322583	5864574		Cyanophage(100.0%)	1	NA	NA
AYZ51017.1|1321107_1322583_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.8	3.7e-78
>prophage 99
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1326547	1333705	5864574		Listeria_phage(25.0%)	8	NA	NA
AYZ51021.1|1326547_1327870_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	36.8	1.5e-14
AYZ51022.1|1327885_1328830_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
AYZ51023.1|1328908_1329661_+	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.5	1.3e-15
AYZ51024.1|1329660_1330446_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
AYZ51025.1|1330653_1331664_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.0	1.3e-08
AYZ51026.1|1331672_1332284_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AYZ51027.1|1332407_1333070_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ51028.1|1333183_1333705_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
>prophage 100
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1337815	1344536	5864574	tRNA	Escherichia_coli_phage(33.33%)	8	NA	NA
AYZ51033.1|1337815_1338634_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	83.5	2.8e-59
AYZ51034.1|1338687_1339083_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ51035.1|1339122_1339866_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	28.7	2.5e-22
AYZ51036.1|1339862_1340885_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AYZ51037.1|1340918_1341128_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ51038.1|1341183_1341927_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AYZ51039.1|1342003_1342573_-	VOC family protein	NA	NA	NA	NA	NA
AYZ51040.1|1342802_1344536_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	3.4e-86
>prophage 101
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1351518	1353033	5864574		Brazilian_cedratvirus(100.0%)	1	NA	NA
AYZ51047.1|1351518_1353033_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2R8FG22	Brazilian_cedratvirus	28.4	2.6e-10
>prophage 102
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1370337	1371090	5864574		Bacillus_virus(100.0%)	1	NA	NA
AYZ51065.1|1370337_1371090_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	35.4	5.8e-27
>prophage 103
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1377785	1386475	5864574		Burkholderia_phage(40.0%)	9	NA	NA
AYZ51074.1|1377785_1379453_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	40.3	2.4e-17
AYZ51075.1|1379560_1379740_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
AYZ51076.1|1379815_1380727_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AYZ51077.1|1380910_1381822_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AYZ51078.1|1381796_1382291_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	50.7	2.1e-33
AYZ51079.1|1382271_1383705_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.7	2.2e-99
AYZ51080.1|1383761_1384457_-	phosphohydrolase	NA	S4W232	Pandoravirus	26.6	5.2e-06
AYZ51081.1|1384499_1384781_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ51082.1|1385419_1386475_+	porin	NA	Q1MVN1	Enterobacteria_phage	47.0	1.6e-86
>prophage 104
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1393657	1398775	5864574		Morganella_phage(50.0%)	3	NA	NA
AYZ51087.1|1393657_1394089_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	43.4	1.7e-23
AYZ51088.1|1394627_1395713_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYZ51089.1|1395712_1398775_+	efflux RND transporter permease subunit	NA	S5VL66	Leptospira_phage	22.0	5.8e-25
>prophage 105
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1410112	1413611	5864574		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
AYZ51099.1|1410112_1412374_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	33.9	1.4e-137
AYZ51100.1|1412378_1413611_-	Bcr/CflA family efflux MFS transporter	NA	S4TR35	Salmonella_phage	27.1	7.1e-30
>prophage 106
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1453840	1458820	5864574		Stx2-converting_phage(50.0%)	3	NA	NA
AYZ51139.1|1453840_1455013_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	81.2	6.2e-185
AYZ51140.1|1455187_1456612_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
AYZ51141.1|1456717_1458820_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.6	3.7e-63
>prophage 107
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1463389	1464289	5864574		Cellulophaga_phage(100.0%)	1	NA	NA
AYZ55060.1|1463389_1464289_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	89.5	5.4e-11
>prophage 108
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1469833	1470430	5864574		Klosneuvirus(100.0%)	1	NA	NA
AYZ51153.1|1469833_1470430_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A1V0SIZ6	Klosneuvirus	34.2	1.5e-17
>prophage 109
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1477398	1488421	5864574		Anomala_cuprea_entomopoxvirus(16.67%)	8	NA	NA
AYZ51158.1|1477398_1478691_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.5	8.8e-15
AYZ51159.1|1478693_1479479_-	ABC transporter permease	NA	NA	NA	NA	NA
AYZ51160.1|1479484_1480867_-	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	26.1	2.3e-29
AYZ55061.1|1480890_1482306_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.9	1.6e-54
AYZ51161.1|1482764_1482995_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ51162.1|1483439_1484444_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	6.8e-31
AYZ51163.1|1485603_1486770_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.2	2.4e-112
AYZ51164.1|1487014_1488421_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	29.1	1.5e-39
>prophage 110
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1493399	1502135	5864574		Catovirus(25.0%)	7	NA	NA
AYZ51169.1|1493399_1494329_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	31.5	3.1e-06
AYZ51170.1|1494389_1495820_-	undecaprenyl-phosphate galactose phosphotransferase WbaP	NA	NA	NA	NA	NA
AYZ51171.1|1495957_1497109_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
AYZ51172.1|1497182_1498559_-	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	30.0	6.2e-35
AYZ51173.1|1498575_1499997_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.6	8.1e-54
AYZ51174.1|1500091_1501126_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ51175.1|1501145_1502135_-	glycosyltransferase family 1 protein	NA	B6EFC4	Stygiolobus_rod-shaped_virus	32.4	2.2e-05
>prophage 111
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1511969	1518934	5864574		Bacillus_phage(25.0%)	5	NA	NA
AYZ55062.1|1511969_1512860_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.3e-46
AYZ51184.1|1513851_1515438_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.5	1.7e-36
AYZ51185.1|1515745_1517593_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
AYZ51186.1|1517620_1518202_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	3.9e-31
AYZ51187.1|1518292_1518934_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	37.9	3.8e-35
>prophage 112
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1543141	1545390	5864574		Bacillus_phage(100.0%)	2	NA	NA
AYZ51204.1|1543141_1544671_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	27.9	1.7e-28
AYZ51205.1|1544667_1545390_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	3.2e-30
>prophage 113
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1549742	1555573	5864574		Phage_TP(25.0%)	6	NA	NA
AYZ51209.1|1549742_1551104_+	U32 family peptidase	NA	Q6DW11	Phage_TP	91.8	3.6e-200
AYZ51210.1|1551347_1552241_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	2.7e-15
AYZ51211.1|1552241_1552712_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ51212.1|1552698_1553508_-	CadC family transcriptional regulator	NA	NA	NA	NA	NA
AYZ51213.1|1553925_1554699_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.1	1.7e-26
AYZ55064.1|1554709_1555573_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	22.5	1.2e-07
>prophage 114
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1564205	1565573	5864574		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AYZ51221.1|1564205_1565573_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	28.5	2.8e-43
>prophage 115
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1581627	1583661	5864574	tRNA	Indivirus(100.0%)	1	NA	NA
AYZ51235.1|1581627_1583661_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.3	6.8e-54
>prophage 116
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1598507	1608176	5864574		Enterobacteria_phage(83.33%)	10	NA	NA
AYZ51241.1|1598507_1599644_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	85.3	1.7e-142
AYZ51242.1|1599640_1601647_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	63.6	3.4e-239
AYZ51243.1|1601659_1602121_+	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
AYZ51244.1|1602245_1602713_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	78.6	3.3e-65
AYZ51245.1|1602766_1603486_-	two-component system response regulator YehT	NA	NA	NA	NA	NA
AYZ51246.1|1603479_1605168_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	84.5	5.5e-259
AYZ51247.1|1605378_1606137_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	69.8	9.5e-78
AYZ51248.1|1606419_1606533_+	protein YohO	NA	NA	NA	NA	NA
AYZ51249.1|1606507_1607245_-	ABC transporter permease	NA	NA	NA	NA	NA
AYZ51250.1|1607228_1608176_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.3	6.9e-09
>prophage 117
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1614745	1615300	5864574		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AYZ51255.1|1614745_1615300_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	36.5	1.9e-19
>prophage 118
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1619553	1620288	5864574		Streptococcus_phage(100.0%)	1	NA	NA
AYZ51260.1|1619553_1620288_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	41.6	1.3e-50
>prophage 119
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1636192	1637713	5864574		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AYZ51276.1|1636192_1637713_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.6	1.5e-10
>prophage 120
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1641470	1645894	5864574		Cellulophaga_phage(50.0%)	4	NA	NA
AYZ51280.1|1641470_1642139_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.8	6.9e-56
AYZ51281.1|1642505_1643342_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AYZ51282.1|1643394_1643592_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ51283.1|1643920_1645894_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	35.8	8.1e-12
>prophage 121
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1651013	1651871	5864574		Catovirus(100.0%)	1	NA	NA
AYZ51289.1|1651013_1651871_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.1	6.9e-24
>prophage 122
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1663129	1667439	5864574		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
AYZ51298.1|1663129_1664596_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	28.9	1.5e-42
AYZ51299.1|1664715_1665693_+	GTP-binding protein	NA	NA	NA	NA	NA
AYZ51300.1|1665735_1666443_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AYZ51301.1|1666869_1667439_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	39.8	3.1e-12
>prophage 123
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1673191	1682251	5864574		Vibrio_phage(50.0%)	9	NA	NA
AYZ51305.1|1673191_1674781_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	31.1	4.0e-17
AYZ51306.1|1674784_1675129_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ51307.1|1675459_1676656_-	Bcr/CflA family drug resistance efflux transporter	NA	S4TR35	Salmonella_phage	24.4	2.1e-23
AYZ51308.1|1676652_1677372_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
AYZ51309.1|1677520_1679278_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	40.5	4.9e-101
AYZ51310.1|1679415_1679700_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
AYZ51311.1|1679761_1680355_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
AYZ51312.1|1680435_1681194_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AYZ51313.1|1681243_1682251_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	49.2	9.1e-84
>prophage 124
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1690275	1695826	5864574		Ralstonia_phage(50.0%)	4	NA	NA
AYZ51318.1|1690275_1692216_-	hypothetical protein	NA	A0A077K801	Ralstonia_phage	29.4	5.9e-55
AYZ51319.1|1692208_1692982_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ51320.1|1693110_1693305_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ51321.1|1693336_1695826_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.5	6.6e-19
>prophage 125
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1701094	1709702	5864574		uncultured_Caudovirales_phage(25.0%)	7	NA	NA
AYZ51325.1|1701094_1702342_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	46.1	3.1e-65
AYZ51326.1|1702304_1703741_-	magnesium transporter	NA	NA	NA	NA	NA
AYZ51327.1|1703909_1705553_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.5	8.3e-10
AYZ51328.1|1705629_1706280_-	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
AYZ51329.1|1706279_1707344_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	K7YGE1	Megavirus	55.6	4.5e-17
AYZ51330.1|1707416_1708469_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
AYZ51331.1|1708571_1709702_-	porin	NA	Q1MVN1	Enterobacteria_phage	60.9	3.0e-120
>prophage 126
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1713844	1725626	5864574		Pseudomonas_phage(33.33%)	8	NA	NA
AYZ51334.1|1713844_1716691_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	25.4	3.2e-41
AYZ51335.1|1716822_1719456_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.7	1.6e-92
AYZ51336.1|1719640_1720369_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
AYZ51337.1|1720412_1720601_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ51338.1|1720713_1722999_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.8	1.0e-284
AYZ51339.1|1723099_1724230_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.4	6.6e-176
AYZ51340.1|1724229_1724484_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	64.0	8.2e-26
AYZ51341.1|1724555_1725626_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	42.9	5.1e-08
>prophage 127
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1733482	1734688	5864574		Oenococcus_phage(100.0%)	1	NA	NA
AYZ51347.1|1733482_1734688_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	29.1	5.5e-27
>prophage 128
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1737793	1739242	5864574		Tupanvirus(100.0%)	1	NA	NA
AYZ51351.1|1737793_1739242_+	catalase	NA	A0A2K9L0T1	Tupanvirus	47.2	5.3e-101
>prophage 129
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1761393	1761945	5864574	integrase	Escherichia_phage(100.0%)	1	1757059:1757078	1767026:1767045
1757059:1757078	attL	TCGCCAGCGCCGCCAGACCG	NA	NA	NA	NA
AYZ51372.1|1761393_1761945_-|integrase	integrase	integrase	A0A2L1IV36	Escherichia_phage	51.6	1.6e-50
AYZ51372.1|1761393_1761945_-|integrase	integrase	integrase	A0A2L1IV36	Escherichia_phage	51.6	1.6e-50
1767026:1767045	attR	TCGCCAGCGCCGCCAGACCG	NA	NA	NA	NA
>prophage 130
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1781073	1781673	5864574		Salmonella_phage(100.0%)	1	NA	NA
AYZ51389.1|1781073_1781673_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	39.8	2.4e-07
>prophage 131
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1793484	1794504	5864574		Enterobacteria_phage(100.0%)	1	NA	NA
AYZ51401.1|1793484_1794504_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.8	4.6e-19
>prophage 132
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1798768	1800973	5864574		Salmonella_phage(66.67%)	4	NA	NA
AYZ51408.1|1798768_1799023_+	hypothetical protein	NA	J9Q735	Salmonella_phage	46.1	6.3e-10
AYZ51409.1|1799026_1799593_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	57.7	1.1e-46
AYZ55072.1|1799660_1800158_+	N-acetyltransferase	NA	NA	NA	NA	NA
AYZ51410.1|1800199_1800973_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	30.2	2.3e-10
>prophage 133
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1810825	1812343	5864574		Mollivirus(100.0%)	1	NA	NA
AYZ51420.1|1810825_1812343_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.4e-88
>prophage 134
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1818769	1819882	5864574		Brazilian_cedratvirus(100.0%)	1	NA	NA
AYZ55074.1|1818769_1819882_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.3	3.7e-22
>prophage 135
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1828332	1829418	5864574		Pandoravirus(100.0%)	1	NA	NA
AYZ51436.1|1828332_1829418_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.4	1.0e-88
>prophage 136
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1838539	1842049	5864574		Enterobacteria_phage(33.33%)	3	NA	NA
AYZ51443.1|1838539_1839436_+	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	78.5	5.0e-126
AYZ51444.1|1840069_1840939_+	hypothetical protein	NA	A0A1W6JPD1	Morganella_phage	51.3	1.5e-05
AYZ51445.1|1841143_1842049_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	23.3	3.5e-10
>prophage 137
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1845500	1847950	5864574		Enterobacteria_phage(50.0%)	2	NA	NA
AYZ51448.1|1845500_1847198_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.1	4.6e-48
AYZ55078.1|1847209_1847950_+	DNA-binding response regulator	NA	A0A2R2ZGH8	Clostridioides_phage	26.5	5.6e-14
>prophage 138
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1865881	1875780	5864574		Lactobacillus_phage(25.0%)	9	NA	NA
AYZ51463.1|1865881_1866808_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.1	8.0e-10
AYZ51464.1|1866897_1867896_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
AYZ51465.1|1867892_1868111_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ51466.1|1868103_1870128_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.0	6.8e-147
AYZ55079.1|1870202_1871243_-	cell division protein ZipA	NA	NA	NA	NA	NA
AYZ51467.1|1871476_1872238_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
AYZ51468.1|1872397_1873369_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	7.4e-75
AYZ51469.1|1873750_1874008_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AYZ51470.1|1874052_1875780_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.6	4.3e-17
>prophage 139
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1880030	1888688	5864574		Streptococcus_phage(25.0%)	10	NA	NA
AYZ55080.1|1880030_1880942_-	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	41.1	2.2e-57
AYZ51477.1|1881075_1882170_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	33.7	8.5e-27
AYZ51478.1|1882159_1883035_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
AYZ51479.1|1883034_1883868_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
AYZ51480.1|1883867_1884884_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYZ51481.1|1885110_1886010_-	Dyp-type peroxidase	NA	S4VVJ7	Pandoravirus	31.4	5.5e-24
AYZ51482.1|1886102_1886678_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
AYZ51483.1|1886739_1887189_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
AYZ51484.1|1887175_1887601_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
AYZ51485.1|1887812_1888688_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	32.9	2.0e-18
>prophage 140
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1921966	1923669	5864574		Rhodococcus_phage(50.0%)	2	NA	NA
AYZ51513.1|1921966_1922836_-	neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	36.1	3.3e-34
AYZ51514.1|1922955_1923669_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	2.4e-38
>prophage 141
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1930941	1932231	5864574		Enterobacteria_phage(100.0%)	1	NA	NA
AYZ51523.1|1930941_1932231_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.9	1.6e-64
>prophage 142
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1936340	1938016	5864574		Prochlorococcus_phage(100.0%)	2	NA	NA
AYZ51528.1|1936340_1937378_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.8	4.8e-72
AYZ51529.1|1937374_1938016_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.2	1.2e-28
>prophage 143
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1944412	1944622	5864574		Escherichia_phage(100.0%)	1	NA	NA
AYZ51533.1|1944412_1944622_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	82.8	3.2e-20
>prophage 144
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	1961472	2005637	5864574	integrase,terminase,tail,tRNA,holin	Salmonella_phage(54.55%)	51	1995587:1995602	2000844:2000859
AYZ51551.1|1961472_1961973_-	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	78.1	4.5e-60
AYZ51552.1|1961969_1962179_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ51553.1|1962175_1962802_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	83.1	2.0e-97
AYZ51554.1|1962803_1963097_-|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.7	2.4e-37
AYZ51555.1|1963083_1963488_-	hypothetical protein	NA	T1SA79	Salmonella_phage	82.6	3.5e-55
AYZ51556.1|1963600_1963849_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ51557.1|1966485_1966782_+	hypothetical protein	NA	T1SA06	Salmonella_phage	72.6	6.6e-27
AYZ51558.1|1967028_1967181_+	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	87.8	5.1e-15
AYZ51559.1|1967379_1969854_-	hypothetical protein	NA	T1S9I6	Salmonella_phage	94.8	0.0e+00
AYZ51560.1|1969858_1971661_-	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	73.3	3.8e-234
AYZ51561.1|1971657_1974471_-	hypothetical protein	NA	T1SBJ1	Salmonella_phage	90.1	0.0e+00
AYZ51562.1|1974481_1975021_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	68.2	6.0e-58
AYZ51563.1|1975022_1975487_-	hypothetical protein	NA	T1SA73	Salmonella_phage	79.9	3.4e-70
AYZ51564.1|1975486_1977964_-	hypothetical protein	NA	Q858G3	Salmonella_phage	85.1	0.0e+00
AYZ51565.1|1977963_1978569_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	81.0	3.9e-90
AYZ51566.1|1978568_1978892_-	hypothetical protein	NA	G9L6C8	Escherichia_phage	86.0	3.1e-46
AYZ51567.1|1978942_1979287_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	64.0	1.5e-33
AYZ51568.1|1979297_1979735_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.7	3.0e-68
AYZ51569.1|1979788_1980775_-	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	94.5	8.1e-178
AYZ51570.1|1980789_1981479_-	peptidase	NA	G9L6C4	Escherichia_phage	81.4	7.4e-69
AYZ51571.1|1981490_1981814_-|tRNA	phenylalanyl-tRNA synthetase subunit beta	tRNA	NA	NA	NA	NA
AYZ51572.1|1981810_1982110_-	hypothetical protein	NA	T1SBI9	Salmonella_phage	71.1	1.9e-34
AYZ51573.1|1982106_1983789_-|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	80.5	4.5e-261
AYZ51574.1|1983803_1984010_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	69.1	7.4e-09
AYZ51575.1|1984702_1985035_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ51576.1|1985372_1986842_-|terminase	terminase	terminase	Q858H3	Salmonella_phage	96.5	2.2e-288
AYZ51577.1|1986838_1987423_-|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	95.9	4.1e-97
AYZ51578.1|1987480_1987810_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	56.1	4.3e-27
AYZ51579.1|1987887_1988226_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	86.4	3.2e-49
AYZ51580.1|1988222_1988618_-	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	77.9	6.1e-52
AYZ51581.1|1989047_1989260_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	40.9	5.8e-09
AYZ55084.1|1989259_1989823_-	hypothetical protein	NA	A0A2H4FRZ0	Salmonella_phage	53.6	7.2e-30
AYZ51582.1|1990038_1990248_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ51583.1|1991850_1992204_-	DUF1064 domain-containing protein	NA	T1SA23	Salmonella_phage	71.6	3.4e-38
AYZ51584.1|1992329_1993100_-	DNA replication domain protein	NA	G9L6A8	Escherichia_phage	89.1	4.5e-59
AYZ51585.1|1993089_1994151_-	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	58.1	2.6e-129
AYZ51586.1|1994147_1994351_-	hypothetical protein	NA	Q858D5	Salmonella_phage	88.1	3.8e-26
AYZ51587.1|1994496_1994730_-	hypothetical protein	NA	Q858D6	Salmonella_phage	78.9	9.5e-29
AYZ51588.1|1994885_1995473_+	XRE family transcriptional regulator	NA	Q858D7	Salmonella_phage	64.5	2.5e-65
1995587:1995602	attL	TATTACCTTAAAGGTA	NA	NA	NA	NA
AYZ51589.1|1995836_1996139_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	48.5	2.3e-19
AYZ51590.1|1996135_1996957_+	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	89.7	2.8e-147
AYZ51591.1|1996953_1997853_+	recombinase RecT	NA	T1SBJ5	Salmonella_phage	76.8	2.4e-120
AYZ51592.1|1997899_1998148_+	AlpA family phage regulatory protein	NA	T1SA17	Salmonella_phage	85.4	1.2e-34
AYZ51593.1|1998257_1998551_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	73.2	4.7e-33
AYZ51594.1|1998543_1998702_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	84.6	2.7e-19
AYZ51595.1|1998698_1999292_+	adenine methylase	NA	T1SA14	Salmonella_phage	91.9	2.8e-109
AYZ51596.1|1999288_1999582_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ51597.1|1999549_2000800_-|integrase	site-specific integrase	integrase	T1S9J3	Salmonella_phage	85.1	1.2e-205
AYZ51598.1|2000992_2002570_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
2000844:2000859	attR	TACCTTTAAGGTAATA	NA	NA	NA	NA
AYZ51599.1|2002638_2004105_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.5	3.4e-87
AYZ51600.1|2004263_2005637_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	3.8e-40
>prophage 145
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2017137	2017569	5864574		Powai_lake_megavirus(100.0%)	1	NA	NA
AYZ55085.1|2017137_2017569_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	38.6	1.7e-18
>prophage 146
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2029754	2036115	5864574		Mycoplasma_phage(20.0%)	8	NA	NA
AYZ51619.1|2029754_2031041_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	38.6	1.2e-35
AYZ51620.1|2031148_2031349_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
AYZ51621.1|2031350_2031686_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AYZ51622.1|2031687_2033538_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.3	1.9e-103
AYZ51623.1|2033553_2034069_-	co-chaperone HscB	NA	NA	NA	NA	NA
AYZ51624.1|2034144_2034468_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	1.6e-21
AYZ51625.1|2034487_2034874_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
AYZ51626.1|2034900_2036115_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.6e-34
>prophage 147
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2050448	2064050	5864574	tRNA	Bacillus_phage(40.0%)	10	NA	NA
AYZ51639.1|2050448_2051702_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.1	2.5e-99
AYZ51640.1|2052027_2053218_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
AYZ51641.1|2053275_2053614_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
AYZ51642.1|2053679_2055017_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	33.1	3.0e-10
AYZ51643.1|2055003_2055708_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AYZ55086.1|2055721_2057158_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.0	1.6e-12
AYZ55087.1|2057829_2061717_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.3	1.0e-130
AYZ51644.1|2061770_2061902_-	phosphoribosylformyl-glycineamide synthetase	NA	NA	NA	NA	NA
AYZ51645.1|2061891_2063508_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
AYZ51646.1|2063504_2064050_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	34.0	2.4e-06
>prophage 148
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2068053	2075970	5864574		Lactobacillus_phage(25.0%)	9	NA	NA
AYZ51651.1|2068053_2068980_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	26.2	1.0e-09
AYZ51652.1|2069017_2069278_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	3.2e-17
AYZ51653.1|2069323_2069704_-	holo-ACP synthase	NA	NA	NA	NA	NA
AYZ51654.1|2069703_2070435_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AYZ55088.1|2070446_2071175_-	DNA repair protein RecO	NA	NA	NA	NA	NA
AYZ51655.1|2071373_2072279_-	GTPase Era	NA	NA	NA	NA	NA
AYZ51656.1|2072275_2072956_-	ribonuclease 3	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.5	2.8e-20
AYZ51657.1|2073180_2074155_-	signal peptidase I	NA	NA	NA	NA	NA
AYZ51658.1|2074170_2075970_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.7	5.0e-24
>prophage 149
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2081745	2086316	5864574	tRNA	Cafeteria_roenbergensis_virus(25.0%)	5	NA	NA
AYZ51667.1|2081745_2083077_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	1.1e-44
AYZ51668.1|2083121_2083505_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	69.9	3.1e-32
AYZ51669.1|2083817_2084507_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.7e-55
AYZ51670.1|2084613_2085687_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AYZ51671.1|2085890_2086316_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	4.6e-13
>prophage 150
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2091616	2093644	5864574		Burkholderia_virus(50.0%)	2	NA	NA
AYZ51676.1|2091616_2092915_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.5	1.2e-43
AYZ51677.1|2093188_2093644_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	46.7	3.3e-33
>prophage 151
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2099297	2101871	5864574		Enterobacteria_phage(100.0%)	1	NA	NA
AYZ51678.1|2099297_2101871_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	4.0e-128
>prophage 152
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2108674	2109745	5864574		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AYZ51685.1|2108674_2109745_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	8.1e-91
>prophage 153
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2125011	2127447	5864574		Staphylococcus_phage(50.0%)	2	NA	NA
AYZ51704.1|2125011_2125494_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	1.8e-29
AYZ51705.1|2126205_2127447_+	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	48.4	5.9e-101
>prophage 154
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2141293	2142115	5864574		Yersinia_phage(100.0%)	1	NA	NA
AYZ51717.1|2141293_2142115_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	36.1	3.5e-41
>prophage 155
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2148228	2150245	5864574		Morganella_phage(50.0%)	3	NA	NA
AYZ51726.1|2148228_2149137_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	51.7	2.9e-73
AYZ51727.1|2149320_2149509_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ55093.1|2150011_2150245_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	56.6	1.1e-16
>prophage 156
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2159739	2164601	5864574		uncultured_Caudovirales_phage(80.0%)	7	NA	NA
AYZ51729.1|2159739_2159958_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	65.7	3.4e-20
AYZ51730.1|2160226_2160454_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ51731.1|2160956_2161421_+	DNA-binding protein	NA	NA	NA	NA	NA
AYZ51732.1|2161724_2162150_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	71.4	7.3e-51
AYZ51733.1|2162162_2163452_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.2	1.1e-166
AYZ51734.1|2163496_2163817_-	ArsR family transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	43.8	1.3e-20
AYZ51735.1|2163902_2164601_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	67.2	1.4e-88
>prophage 157
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2174784	2176302	5864574		Pithovirus(100.0%)	1	NA	NA
AYZ51744.1|2174784_2176302_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	1.0e-14
>prophage 158
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2181252	2182047	5864574		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AYZ51750.1|2181252_2182047_-	antibiotic acetyltransferase	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	30.8	5.4e-07
>prophage 159
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2197468	2202759	5864574		Gordonia_phage(25.0%)	5	NA	NA
AYZ51765.1|2197468_2197714_+	glutaredoxin-like protein NrdH	NA	A0A0E3T8B5	Gordonia_phage	35.8	8.0e-10
AYZ51766.1|2197710_2198121_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
AYZ51767.1|2198093_2200238_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.2	2.1e-191
AYZ51768.1|2200248_2201211_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.2	1.5e-131
AYZ51769.1|2201556_2202759_+	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.7	1.1e-27
>prophage 160
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2217501	2225781	5864574	tRNA	Vibrio_phage(20.0%)	9	NA	NA
AYZ51783.1|2217501_2217687_-	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
AYZ51784.1|2217925_2220553_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	39.0	9.9e-82
AYZ51785.1|2220683_2221184_-	recombination regulator RecX	NA	NA	NA	NA	NA
AYZ51786.1|2221254_2222313_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.1	5.2e-114
AYZ51787.1|2222393_2222891_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	47.8	5.9e-28
AYZ51788.1|2223094_2223328_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ51789.1|2223356_2224238_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYZ51790.1|2224243_2225107_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AYZ51791.1|2225103_2225781_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	7.9e-07
>prophage 161
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2231395	2232361	5864574		Tetraselmis_virus(100.0%)	1	NA	NA
AYZ51799.1|2231395_2232361_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.2	1.0e-36
>prophage 162
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2272378	2273200	5864574		Brazilian_cedratvirus(100.0%)	1	NA	NA
AYZ51835.1|2272378_2273200_+	manganese/iron ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.4	2.6e-12
>prophage 163
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2281281	2282061	5864574		Cedratvirus(100.0%)	1	NA	NA
AYZ51844.1|2281281_2282061_+	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	28.3	1.8e-10
>prophage 164
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2291484	2296696	5864574		Planktothrix_phage(66.67%)	3	NA	NA
AYZ51856.1|2291484_2293428_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	39.5	1.3e-30
AYZ51857.1|2293427_2294588_-	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	39.8	1.0e-09
AYZ51858.1|2294584_2296696_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.3	6.2e-18
>prophage 165
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2306772	2309334	5864574		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
AYZ51870.1|2306772_2309334_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	3.0e-30
>prophage 166
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2315443	2319214	5864574		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
AYZ51878.1|2315443_2316436_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
AYZ51879.1|2316592_2317711_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	34.6	6.5e-06
AYZ51880.1|2317832_2318459_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.8	3.7e-35
AYZ51881.1|2318452_2319214_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	1.3e-58
>prophage 167
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2322286	2324319	5864574		Freshwater_phage(50.0%)	2	NA	NA
AYZ51887.1|2322286_2322892_-	adenylyl-sulfate kinase	NA	A0A1B0XTK9	Freshwater_phage	37.0	8.9e-10
AYZ51888.1|2322891_2324319_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.0	1.9e-31
>prophage 168
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2339306	2345605	5864574		Trichoplusia_ni_ascovirus(25.0%)	4	NA	NA
AYZ51902.1|2339306_2340095_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.6	1.8e-18
AYZ51903.1|2340283_2340955_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	24.6	3.0e-14
AYZ51904.1|2342588_2343887_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.6	3.7e-130
AYZ51905.1|2343967_2345605_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.3	1.1e-155
>prophage 169
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2349427	2354829	5864574		Erysipelothrix_phage(33.33%)	3	NA	NA
AYZ51909.1|2349427_2350771_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	26.9	2.0e-33
AYZ51910.1|2350895_2353649_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.3	3.1e-49
AYZ51911.1|2353689_2354829_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	40.7	1.1e-48
>prophage 170
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2362350	2363196	5864574		Vibrio_phage(100.0%)	1	NA	NA
AYZ51919.1|2362350_2363196_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.2	1.2e-41
>prophage 171
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2375729	2376485	5864574		Bacillus_phage(100.0%)	1	NA	NA
AYZ51928.1|2375729_2376485_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	31.1	4.2e-09
>prophage 172
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2387246	2389839	5864574	tRNA	environmental_halophage(50.0%)	3	NA	NA
AYZ51939.1|2387246_2388452_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.0	1.3e-73
AYZ51940.1|2388451_2388889_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
AYZ51941.1|2389029_2389839_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.8	1.9e-15
>prophage 173
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2394898	2395714	5864574		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
AYZ51946.1|2394898_2395714_-	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	23.8	2.5e-07
>prophage 174
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2428793	2439905	5864574		Deep-sea_thermophilic_phage(25.0%)	5	NA	NA
AYZ51986.1|2428793_2430047_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	29.4	6.5e-15
AYZ51987.1|2430274_2431606_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
AYZ51988.1|2431645_2433481_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	24.2	5.8e-20
AYZ51989.1|2433477_2437023_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	21.3	4.7e-10
AYZ51990.1|2437019_2439905_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	23.6	6.9e-60
>prophage 175
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2445380	2452420	5864574		Geobacillus_virus(33.33%)	8	NA	NA
AYZ51997.1|2445380_2446175_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	72.3	8.9e-119
AYZ51998.1|2446181_2447057_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AYZ51999.1|2447352_2449599_-	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	22.9	1.5e-09
AYZ52000.1|2449611_2450142_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AYZ52001.1|2450181_2450364_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ52002.1|2450583_2450808_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ52003.1|2450824_2451520_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
AYZ52004.1|2451706_2452420_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	46.8	1.0e-44
>prophage 176
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2455438	2464593	5864574		Staphylococcus_phage(33.33%)	8	NA	NA
AYZ52008.1|2455438_2457598_-	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	A0A2H4PQU7	Staphylococcus_phage	25.7	2.9e-18
AYZ52009.1|2457621_2457813_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ52010.1|2458220_2459237_+	HTH-type transcriptional regulator GalR	NA	NA	NA	NA	NA
AYZ52011.1|2459197_2459677_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYZ52012.1|2459673_2460447_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYZ55101.1|2460515_2461943_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	26.8	1.7e-35
AYZ52013.1|2461950_2463288_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
AYZ52014.1|2463582_2464593_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	29.5	9.9e-30
>prophage 177
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2470389	2471517	5864574		Bacillus_phage(100.0%)	1	NA	NA
AYZ52021.1|2470389_2471517_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.9	3.9e-11
>prophage 178
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2479752	2482244	5864574		Aichi_virus(50.0%)	2	NA	NA
AYZ52029.1|2479752_2481171_-	arabinose-proton symporter	NA	O13311	Aichi_virus	28.2	1.6e-25
AYZ52030.1|2481482_2482244_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.3	1.4e-20
>prophage 179
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2504362	2506036	5864574	integrase	Escherichia_phage(100.0%)	2	2504214:2504229	2508447:2508462
2504214:2504229	attL	ATAAAAATAAGAACTG	NA	NA	NA	NA
AYZ52053.1|2504362_2504968_+|integrase	integrase	integrase	A0A2L1IV36	Escherichia_phage	56.2	1.5e-57
AYZ52054.1|2505409_2506036_+	tyrosine recombinase	NA	A0A2L1IV36	Escherichia_phage	50.2	3.7e-51
2508447:2508462	attR	ATAAAAATAAGAACTG	NA	NA	NA	NA
>prophage 180
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2520596	2524736	5864574		Acinetobacter_phage(50.0%)	3	NA	NA
AYZ52068.1|2520596_2522147_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.1	4.5e-159
AYZ52069.1|2522823_2523555_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYZ52070.1|2523962_2524736_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	6.8e-23
>prophage 181
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2532033	2533590	5864574		Catovirus(100.0%)	1	NA	NA
AYZ52079.1|2532033_2533590_+	AMP-dependent synthetase	NA	A0A1V0SBX8	Catovirus	24.8	3.0e-17
>prophage 182
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2540952	2542128	5864574		Streptococcus_phage(100.0%)	1	NA	NA
AYZ52086.1|2540952_2542128_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	38.2	3.1e-43
>prophage 183
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2545506	2545947	5864574		Lactobacillus_phage(100.0%)	1	NA	NA
AYZ52089.1|2545506_2545947_+	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	46.2	6.2e-29
>prophage 184
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2567837	2568374	5864574		Salmonella_phage(100.0%)	1	NA	NA
AYZ52108.1|2567837_2568374_+	hypothetical protein	NA	A0A1B0VBR9	Salmonella_phage	37.6	7.8e-18
>prophage 185
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2581982	2582834	5864574		Staphylococcus_phage(100.0%)	1	NA	NA
AYZ52124.1|2581982_2582834_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.2e-47
>prophage 186
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2598500	2601548	5864574		Cyanophage(50.0%)	3	NA	NA
AYZ52137.1|2598500_2599451_+	transaldolase	NA	A0A127KNC6	Cyanophage	34.0	3.0e-12
AYZ52138.1|2599519_2600413_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYZ52139.1|2600822_2601548_-	LysM peptidoglycan-binding domain-containing protein	NA	I3PV79	Clostridium_phage	35.0	2.5e-11
>prophage 187
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2606272	2612355	5864574	tRNA	Catovirus(25.0%)	5	NA	NA
AYZ52145.1|2606272_2607790_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.1	1.0e-86
AYZ52146.1|2607799_2608898_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	3.1e-05
AYZ52147.1|2608983_2610717_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	1.2e-59
AYZ52148.1|2610722_2611436_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AYZ52149.1|2611458_2612355_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	3.6e-31
>prophage 188
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2624575	2630475	5864574		Pandoravirus(50.0%)	4	NA	NA
AYZ52163.1|2624575_2626009_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	2.6e-31
AYZ52164.1|2626196_2626688_+	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
AYZ52165.1|2626797_2627541_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AYZ52166.1|2627601_2630475_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.1	1.2e-261
>prophage 189
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2638650	2639883	5864574		Catovirus(100.0%)	1	NA	NA
AYZ52175.1|2638650_2639883_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.9	4.1e-102
>prophage 190
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2657365	2658022	5864574		Staphylococcus_phage(100.0%)	1	NA	NA
AYZ52193.1|2657365_2658022_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	5.6e-10
>prophage 191
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2665310	2666105	5864574		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AYZ52198.1|2665310_2666105_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.5	3.7e-08
>prophage 192
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2679695	2680850	5864574		Staphylococcus_phage(100.0%)	1	NA	NA
AYZ52213.1|2679695_2680850_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.4	8.1e-129
>prophage 193
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2700131	2701214	5864574		Geobacillus_virus(100.0%)	1	NA	NA
AYZ52237.1|2700131_2701214_+	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	38.1	4.9e-11
>prophage 194
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2721850	2723221	5864574		Streptococcus_phage(100.0%)	1	NA	NA
AYZ52256.1|2721850_2723221_+	pyridoxal-phosphate dependent enzyme	NA	A0A1X9I5F1	Streptococcus_phage	35.4	4.3e-44
>prophage 195
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2743219	2752236	5864574		Staphylococcus_phage(20.0%)	7	NA	NA
AYZ52276.1|2743219_2744047_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	42.9	4.7e-62
AYZ52277.1|2744145_2744601_+	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	36.1	6.4e-21
AYZ52278.1|2744694_2746878_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	4.5e-104
AYZ52279.1|2747000_2748413_-	cell division protein FtsP	NA	NA	NA	NA	NA
AYZ52280.1|2748497_2749235_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
AYZ52281.1|2749419_2751678_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.3	5.7e-86
AYZ52282.1|2751828_2752236_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	42.7	8.3e-20
>prophage 196
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2755529	2768738	5864574		Bacillus_virus(16.67%)	14	NA	NA
AYZ52287.1|2755529_2757425_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.9	3.2e-90
AYZ52288.1|2757455_2758031_-	esterase YqiA	NA	NA	NA	NA	NA
AYZ52289.1|2758030_2758858_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
AYZ52290.1|2758882_2759305_-	DUF1249 family protein	NA	NA	NA	NA	NA
AYZ52291.1|2759301_2759934_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	34.7	2.6e-20
AYZ52292.1|2760129_2761578_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
AYZ52293.1|2761747_2762416_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	50.7	1.4e-43
AYZ52294.1|2762421_2763582_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.9	2.2e-89
AYZ52295.1|2763627_2764419_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
AYZ55110.1|2764614_2765385_+	zinc transporter ZupT	NA	NA	NA	NA	NA
AYZ52296.1|2765446_2766100_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.3	1.2e-44
AYZ52297.1|2766477_2766759_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
AYZ52298.1|2766821_2767031_-	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
AYZ52299.1|2767304_2768738_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.6	2.0e-39
>prophage 197
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2773848	2775090	5864574		Sinorhizobium_phage(100.0%)	1	NA	NA
AYZ52303.1|2773848_2775090_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	51.0	1.4e-89
>prophage 198
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2784377	2844545	5864574	capsid,plate,portal,terminase,integrase,lysis,tail,head,tRNA,holin	Salmonella_phage(29.17%)	68	2792482:2792527	2825004:2825049
AYZ52315.1|2784377_2785391_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	3.1e-108
AYZ52316.1|2785628_2785844_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
AYZ52317.1|2786077_2787820_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.9	3.4e-70
AYZ52318.1|2787969_2789814_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
AYZ52319.1|2790055_2790700_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYZ52320.1|2790696_2791824_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ52321.1|2791820_2792327_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
2792482:2792527	attL	ACTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCA	NA	NA	NA	NA
AYZ52322.1|2792684_2792903_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	100.0	4.3e-39
AYZ52323.1|2792969_2794139_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	96.1	2.4e-205
AYZ52324.1|2794135_2794621_-|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	96.3	3.7e-83
AYZ52325.1|2794635_2797077_-|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	87.6	4.9e-309
AYZ52326.1|2797069_2797225_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	96.1	9.7e-22
AYZ52327.1|2797221_2797557_-|tail	phage tail assembly protein	tail	A0A218M4J8	Erwinia_phage	98.2	6.8e-52
AYZ52328.1|2797620_2798139_-|tail	phage major tail tube protein	tail	Q37845	Escherichia_phage	99.4	1.4e-93
AYZ52329.1|2798153_2799332_-|tail	phage tail sheath protein	tail	Q37844	Escherichia_phage	96.2	7.6e-215
AYZ52330.1|2799442_2800615_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	44.3	2.4e-43
AYZ52331.1|2800693_2800945_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ52332.1|2800954_2803090_-	hypothetical protein	NA	B3VD20	Klebsiella_phage	29.8	4.5e-56
AYZ52333.1|2803096_2803693_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	55.8	7.1e-52
AYZ52334.1|2803685_2804594_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	71.5	7.6e-114
AYZ52335.1|2804598_2804946_-|plate	baseplate assembly protein	plate	Q7Y4D7	Escherichia_virus	73.9	5.9e-43
AYZ52336.1|2804942_2805584_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	85.4	2.2e-99
AYZ52337.1|2805652_2806102_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	92.6	5.3e-68
AYZ52338.1|2806094_2806562_-|tail	phage tail protein	tail	O80312	Escherichia_phage	96.8	3.7e-80
AYZ52339.1|2806524_2806698_-|lysis	phage lysis protein	lysis	O80311	Escherichia_phage	98.2	6.2e-25
AYZ52340.1|2806669_2807083_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	70.8	9.9e-45
AYZ52341.1|2807079_2807577_-	lysozyme	NA	S4TUB1	Salmonella_phage	93.9	1.1e-87
AYZ52342.1|2807563_2807860_-|holin	holin	holin	O80308	Escherichia_phage	99.0	1.7e-46
AYZ52343.1|2807862_2808066_-|tail	phage tail protein	tail	A0A0M3ULF4	Salmonella_phage	91.0	2.4e-28
AYZ52344.1|2808065_2808575_-|head	head completion/stabilization protein	head	A0A218M4L7	Erwinia_phage	97.0	3.6e-89
AYZ52345.1|2808668_2809412_-|terminase	terminase	terminase	Q6K1I5	Salmonella_virus	89.6	5.6e-115
AYZ52346.1|2809416_2810484_-|capsid	phage major capsid protein, P2 family	capsid	O80304	Escherichia_phage	96.9	4.3e-193
AYZ52347.1|2810559_2811414_-|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	83.5	1.9e-130
AYZ52348.1|2811579_2813352_+	oxidoreductase	NA	A0A218M4M1	Erwinia_phage	97.5	0.0e+00
AYZ52349.1|2813348_2814095_+	hypothetical protein	NA	A0A218M4L2	Erwinia_phage	91.1	1.0e-132
AYZ52350.1|2814091_2815114_+|portal	phage portal protein	portal	A0A2I8TV74	Erwinia_phage	97.4	4.9e-194
AYZ52351.1|2815191_2816196_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ52352.1|2816363_2816558_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ52353.1|2816543_2816735_+	hypothetical protein	NA	A0A0M4R4Y4	Salmonella_phage	85.7	6.4e-07
AYZ52354.1|2816731_2817463_-	hypothetical protein	NA	Q37850	Escherichia_phage	93.4	2.0e-128
AYZ52355.1|2817545_2817986_-	DinI family protein	NA	A0A218M4I0	Erwinia_phage	95.6	1.5e-67
AYZ52356.1|2818103_2820326_-	replication endonuclease	NA	A0A0M3ULG0	Salmonella_phage	92.9	0.0e+00
AYZ52357.1|2820316_2820598_-	DUF3850 domain-containing protein	NA	A0A0P0I3U9	Klebsiella_phage	52.6	1.5e-12
AYZ52358.1|2820594_2820867_-	hypothetical protein	NA	A0A218M4I8	Erwinia_phage	71.1	9.1e-31
AYZ52359.1|2820863_2821445_-	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	78.9	2.8e-85
AYZ52360.1|2821441_2821669_-	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	73.6	6.9e-24
AYZ55111.1|2821668_2821896_-	DUF2732 domain-containing protein	NA	Q6K1F6	Salmonella_virus	76.5	8.7e-19
AYZ52361.1|2821961_2822162_-	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	84.8	5.3e-28
AYZ52362.1|2822163_2822376_-	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	84.1	4.7e-27
AYZ52363.1|2822383_2822893_-	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	99.4	4.3e-90
AYZ52364.1|2822923_2823187_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	100.0	3.1e-44
AYZ52365.1|2823319_2823895_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	66.0	8.9e-68
AYZ52366.1|2823894_2824929_+|integrase	site-specific integrase	integrase	A0A218M4I3	Erwinia_phage	98.8	1.9e-201
AYZ52367.1|2825145_2825469_-	DUF1889 family protein	NA	NA	NA	NA	NA
2825004:2825049	attR	ACTCATAATCGCTTGGTCGCTGGTTCAAGTCCAGCAGGGGCCACCA	NA	NA	NA	NA
AYZ52368.1|2826012_2826438_+	heme-binding protein	NA	NA	NA	NA	NA
AYZ52369.1|2826462_2827626_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
AYZ55112.1|2827684_2829598_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
AYZ52370.1|2829702_2830800_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
AYZ52371.1|2831395_2832466_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
AYZ52372.1|2832476_2833109_+	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
AYZ52373.1|2833119_2834541_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
AYZ52374.1|2834608_2836258_+	glycerone kinase	NA	NA	NA	NA	NA
AYZ52375.1|2836421_2837195_-	siderophore-interacting protein	NA	NA	NA	NA	NA
AYZ52376.1|2837434_2837980_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AYZ52377.1|2838177_2839584_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	1.2e-33
AYZ52378.1|2839620_2839953_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
AYZ52379.1|2840172_2841156_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
AYZ52380.1|2841452_2844545_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	33.9	4.3e-161
>prophage 199
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2855998	2857486	5864574		Bacillus_phage(100.0%)	1	NA	NA
AYZ52391.1|2855998_2857486_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	W8CYL7	Bacillus_phage	28.8	7.0e-08
>prophage 200
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2869487	2872448	5864574		Escherichia_phage(100.0%)	4	NA	NA
AYZ52401.1|2869487_2869862_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A222YZ88	Escherichia_phage	54.9	4.9e-27
AYZ52402.1|2869858_2870080_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	A0A222YXU1	Escherichia_phage	38.4	4.1e-05
AYZ52403.1|2870239_2871229_+	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AYZ52404.1|2871479_2872448_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	34.9	4.5e-40
>prophage 201
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2889179	2890325	5864574		Streptococcus_phage(100.0%)	1	NA	NA
AYZ52423.1|2889179_2890325_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	38.3	5.0e-46
>prophage 202
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2906552	2907326	5864574		Escherichia_phage(100.0%)	1	NA	NA
AYZ52439.1|2906552_2907326_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.2	5.8e-22
>prophage 203
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2912742	2921248	5864574		Streptococcus_phage(20.0%)	11	NA	NA
AYZ52444.1|2912742_2913606_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.7	9.6e-50
AYZ52445.1|2913669_2915751_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
AYZ52446.1|2915708_2916095_+	YraN family protein	NA	NA	NA	NA	NA
AYZ52447.1|2916306_2916897_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	5.4e-12
AYZ52448.1|2916906_2917482_+	osmotically-inducible protein OsmY	NA	NA	NA	NA	NA
AYZ52449.1|2917587_2918628_-	permease	NA	NA	NA	NA	NA
AYZ52450.1|2918697_2919348_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
AYZ52451.1|2919476_2919995_+	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	29.0	1.4e-11
AYZ52452.1|2919974_2920418_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ52453.1|2920473_2920758_+	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	52.6	2.3e-13
AYZ52454.1|2920744_2921248_-	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	33.3	3.4e-15
>prophage 204
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2928164	2930117	5864574		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AYZ52462.1|2928164_2930117_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.0	4.7e-52
>prophage 205
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2935516	2947156	5864574	protease	Cafeteria_roenbergensis_virus(25.0%)	8	NA	NA
AYZ52469.1|2935516_2938207_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.6	3.9e-25
AYZ52470.1|2938231_2939719_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
AYZ52471.1|2939746_2940199_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
AYZ52472.1|2940789_2942133_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	94.4	1.6e-64
AYZ52473.1|2942387_2942717_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
AYZ52474.1|2942946_2944284_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
AYZ52475.1|2944276_2945125_-	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	31.0	2.9e-22
AYZ52476.1|2945221_2947156_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.5	9.2e-117
>prophage 206
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2953742	2955183	5864574		Indivirus(50.0%)	2	NA	NA
AYZ52484.1|2953742_2954714_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.4	1.3e-07
AYZ52485.1|2954910_2955183_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	68.3	1.3e-16
>prophage 207
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2959233	2974447	5864574		Staphylococcus_phage(28.57%)	17	NA	NA
AYZ52492.1|2959233_2960046_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.8	3.7e-19
AYZ52493.1|2960255_2961233_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
AYZ55114.1|2961247_2962234_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	32.9	1.9e-41
AYZ52494.1|2962248_2962815_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	82.1	1.4e-57
AYZ52495.1|2962811_2963387_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AYZ52496.1|2963355_2963901_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AYZ52497.1|2963907_2964633_+	lipopolysaccharide ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	1.9e-22
AYZ52498.1|2964680_2966114_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
AYZ52499.1|2966136_2966424_+	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
AYZ52500.1|2966490_2966979_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AYZ52501.1|2967024_2967879_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
AYZ52502.1|2967875_2968148_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
AYZ52503.1|2968198_2968927_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
AYZ52504.1|2968923_2969577_-	isoprenoid biosynthesis protein ElbB	NA	NA	NA	NA	NA
AYZ52505.1|2969811_2972151_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.5	2.7e-38
AYZ52506.1|2972300_2973365_-	mannonate dehydratase	NA	NA	NA	NA	NA
AYZ52507.1|2973523_2974447_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	33.3	2.0e-16
>prophage 208
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2986825	2987314	5864574	protease	Pseudomonas_phage(100.0%)	1	NA	NA
AYZ55115.1|2986825_2987314_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.7	4.9e-27
>prophage 209
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2991218	2992586	5864574	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
AYZ52520.1|2991218_2992586_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.0	6.6e-21
>prophage 210
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	2999735	3001004	5864574		Oenococcus_phage(100.0%)	1	NA	NA
AYZ52527.1|2999735_3001004_-	SLC13/DASS family transporter	NA	Q6A201	Oenococcus_phage	33.3	2.3e-60
>prophage 211
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3019900	3020944	5864574		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
AYZ52546.1|3019900_3020944_-	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 212
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3049858	3051330	5864574	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
AYZ52570.1|3049858_3050368_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	8.8e-19
AYZ52571.1|3050382_3051330_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	39.5	8.4e-07
>prophage 213
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3071213	3076785	5864574		Tupanvirus(33.33%)	7	NA	NA
AYZ52608.1|3071213_3072398_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.6e-13
AYZ52609.1|3072468_3074583_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.2	6.2e-58
AYZ52610.1|3074679_3075150_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
AYZ52611.1|3075245_3075620_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
AYZ52612.1|3075744_3076032_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
AYZ52613.1|3076039_3076399_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
AYZ52614.1|3076398_3076785_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	40.6	2.7e-20
>prophage 214
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3082432	3084337	5864574		Tupanvirus(100.0%)	1	NA	NA
AYZ52622.1|3082432_3084337_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.0	1.4e-72
>prophage 215
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3088087	3092030	5864574		environmental_Halophage(50.0%)	3	NA	NA
AYZ52628.1|3088087_3090166_+	hypothetical protein	NA	H9YQA8	environmental_Halophage	85.5	4.1e-62
AYZ52629.1|3090155_3091376_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
AYZ52630.1|3091466_3092030_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	56.5	1.3e-58
>prophage 216
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3105029	3105857	5864574		Vibrio_phage(100.0%)	1	NA	NA
AYZ52644.1|3105029_3105857_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	52.0	4.2e-71
>prophage 217
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3120818	3126995	5864574		Staphylococcus_phage(50.0%)	3	NA	NA
AYZ52657.1|3120818_3122441_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	3.8e-140
AYZ52658.1|3122500_3124594_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
AYZ52659.1|3124604_3126995_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	9.5e-15
>prophage 218
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3131548	3135422	5864574		Caulobacter_virus(50.0%)	3	NA	NA
AYZ52662.1|3131548_3132763_-	RtcB family protein	NA	K4JX39	Caulobacter_virus	61.9	2.1e-135
AYZ52663.1|3133083_3134682_+	sigma 54-dependent transcriptional regulator	NA	NA	NA	NA	NA
AYZ52664.1|3134663_3135422_-	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	31.6	3.0e-23
>prophage 219
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3138424	3140872	5864574		Dickeya_phage(100.0%)	1	NA	NA
AYZ52668.1|3138424_3140872_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	83.3	1.6e-33
>prophage 220
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3158805	3160613	5864574		Enterococcus_phage(50.0%)	2	NA	NA
AYZ52683.1|3158805_3159546_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.9	1.5e-11
AYZ52684.1|3159542_3160613_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.7	2.6e-20
>prophage 221
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3169007	3170506	5864574		Anomala_cuprea_entomopoxvirus(100.0%)	2	NA	NA
AYZ55121.1|3169007_3169721_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.0	7.2e-11
AYZ52692.1|3169738_3170506_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	1.3e-13
>prophage 222
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3178073	3183834	5864574		Klosneuvirus(25.0%)	5	NA	NA
AYZ52700.1|3178073_3179339_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.9	4.9e-26
AYZ52701.1|3179456_3180971_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.9	1.5e-13
AYZ52702.1|3181003_3181858_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.7	7.0e-45
AYZ55122.1|3182114_3183173_-	cell division protein FtsX	NA	NA	NA	NA	NA
AYZ52703.1|3183165_3183834_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	9.5e-13
>prophage 223
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3186931	3191155	5864574		Dickeya_phage(50.0%)	4	NA	NA
AYZ52707.1|3186931_3187558_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	62.8	5.5e-31
AYZ52708.1|3187636_3189841_+	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	37.7	2.2e-119
AYZ55124.1|3189952_3190198_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	6.1e-10
AYZ52709.1|3190489_3191155_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	55.8	8.1e-57
>prophage 224
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3197457	3201564	5864574		Tupanvirus(66.67%)	3	NA	NA
AYZ52717.1|3197457_3199443_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.7	1.3e-20
AYZ52718.1|3199439_3200423_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	32.3	3.6e-37
AYZ52719.1|3200424_3201564_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	27.4	5.5e-29
>prophage 225
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3207917	3212114	5864574		Bacillus_virus(50.0%)	5	NA	NA
AYZ52726.1|3207917_3208688_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	27.5	1.6e-16
AYZ52727.1|3208693_3209110_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
AYZ52728.1|3209515_3210529_+	magnesium transporter	NA	NA	NA	NA	NA
AYZ52729.1|3210494_3210827_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYZ52730.1|3211160_3212114_+	hydroxyacid dehydrogenase	NA	A0A285PXZ1	Cedratvirus	32.8	2.5e-35
>prophage 226
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3224300	3226343	5864574		Indivirus(100.0%)	1	NA	NA
AYZ52741.1|3224300_3226343_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.2	6.8e-46
>prophage 227
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3237248	3239326	5864574		Bacillus_phage(100.0%)	2	NA	NA
AYZ52751.1|3237248_3237968_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
AYZ52752.1|3237964_3239326_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	24.5	5.6e-12
>prophage 228
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3246311	3246740	5864574		Stenotrophomonas_phage(100.0%)	1	NA	NA
AYZ52759.1|3246311_3246740_+	lysozyme	NA	A0A142EZW8	Stenotrophomonas_phage	34.5	4.1e-09
>prophage 229
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3284715	3290926	5864574		Bacillus_virus(66.67%)	5	NA	NA
AYZ52785.1|3284715_3286827_-	UDP-forming cellulose synthase catalytic subunit	NA	M1I277	Paramecium_bursaria_Chlorella_virus	33.9	3.3e-35
AYZ52786.1|3286847_3287651_-	cellulose synthase operon protein YhjQ	NA	NA	NA	NA	NA
AYZ52787.1|3287641_3288229_-	cellulose biosynthesis protein BcsO	NA	NA	NA	NA	NA
AYZ52788.1|3288932_3289946_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.4	1.9e-17
AYZ52789.1|3289942_3290926_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.9	1.4e-12
>prophage 230
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3300781	3303112	5864574		Escherichia_phage(100.0%)	1	NA	NA
AYZ52798.1|3300781_3303112_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	28.9	8.9e-66
>prophage 231
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3308259	3309231	5864574		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AYZ52804.1|3308259_3309231_+	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	26.3	4.9e-18
>prophage 232
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3312781	3314708	5864574		Morganella_phage(50.0%)	2	NA	NA
AYZ52809.1|3312781_3312994_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
AYZ52810.1|3313088_3314708_-	ABC transporter ATP-binding protein	NA	A0A1B0RXA0	Streptococcus_phage	26.5	6.4e-31
>prophage 233
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3319095	3320091	5864574		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
AYZ52815.1|3319095_3320091_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	24.8	2.0e-11
>prophage 234
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3324946	3326485	5864574		Staphylococcus_phage(100.0%)	1	NA	NA
AYZ52820.1|3324946_3326485_+	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	5.5e-16
>prophage 235
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3334974	3336822	5864574	tRNA	Tupanvirus(100.0%)	1	NA	NA
AYZ52828.1|3334974_3336822_-|tRNA	selenocysteinyl-tRNA-specific translation elongation factor SelB	tRNA	A0A2K9KZ60	Tupanvirus	25.1	3.1e-13
>prophage 236
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3352830	3361979	5864574		Rhizobium_phage(20.0%)	9	NA	NA
AYZ52845.1|3352830_3353082_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	53.4	7.6e-16
AYZ52846.1|3353193_3353625_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AYZ52847.1|3353870_3355415_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AYZ52848.1|3355424_3356696_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	33.9	2.1e-08
AYZ52849.1|3356747_3357635_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AYZ52850.1|3357631_3358429_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AYZ52851.1|3358591_3359617_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	1.0e-18
AYZ52852.1|3359626_3360820_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.6	3.4e-37
AYZ52853.1|3361034_3361979_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	36.1	1.5e-35
>prophage 237
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3374841	3379577	5864574		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
AYZ52865.1|3374841_3375318_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.7	2.4e-26
AYZ52866.1|3375444_3376254_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.6	3.4e-25
AYZ52867.1|3376446_3376614_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
AYZ52868.1|3376634_3376871_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
AYZ52869.1|3377088_3377754_-	JAB domain-containing protein	NA	NA	NA	NA	NA
AYZ55129.1|3377929_3379141_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	35.5	1.7e-44
AYZ55128.1|3379121_3379577_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	2.8e-48
>prophage 238
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3386207	3391234	5864574		Pseudomonas_phage(33.33%)	5	NA	NA
AYZ52876.1|3386207_3387884_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	23.2	8.2e-21
AYZ52877.1|3387878_3388058_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ52878.1|3388141_3388765_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	36.2	3.3e-20
AYZ52879.1|3388819_3389095_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AYZ52880.1|3389113_3391234_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis(diphosphate) 3'-diphosphatase	NA	A0A291L9W9	Bordetella_phage	34.5	2.8e-10
>prophage 239
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3406821	3407673	5864574		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AYZ52896.1|3406821_3407673_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	1.3e-14
>prophage 240
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3410916	3412308	5864574		environmental_Halophage(100.0%)	1	NA	NA
AYZ52899.1|3410916_3412308_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	95.9	1.6e-67
>prophage 241
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3423889	3427645	5864574		Acidithiobacillus_phage(50.0%)	5	NA	NA
AYZ52906.1|3423889_3424345_-	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	49.7	6.8e-31
AYZ55131.1|3424545_3425013_+	DUF3237 domain-containing protein	NA	NA	NA	NA	NA
AYZ52907.1|3425125_3426133_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
AYZ52908.1|3426134_3426437_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
AYZ52909.1|3426595_3427645_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.2	2.7e-70
>prophage 242
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3443087	3444254	5864574		Salmonella_phage(100.0%)	1	NA	NA
AYZ52923.1|3443087_3444254_+	Bcr/CflA family efflux MFS transporter	NA	S4TR35	Salmonella_phage	26.8	1.9e-24
>prophage 243
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3447940	3448903	5864574	transposase	Sodalis_phage(100.0%)	1	NA	NA
AYZ55134.1|3447940_3448903_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.7	7.4e-67
>prophage 244
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3456081	3457194	5864574		Bacillus_virus(100.0%)	1	NA	NA
AYZ52934.1|3456081_3457194_-	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	35.0	1.0e-27
>prophage 245
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3469458	3474801	5864574		Micromonas_sp._RCC1109_virus(50.0%)	6	NA	NA
AYZ52948.1|3469458_3471147_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	30.3	4.5e-59
AYZ52949.1|3471249_3471345_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
AYZ52950.1|3471928_3472018_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
AYZ52951.1|3472088_3472535_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYZ52952.1|3472605_3473439_+	EamA family transporter	NA	NA	NA	NA	NA
AYZ52953.1|3473616_3474801_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	24.0	1.3e-12
>prophage 246
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3480277	3483483	5864574		Tupanvirus(50.0%)	2	NA	NA
AYZ52960.1|3480277_3481771_-	hypothetical protein	NA	A0A2K9L727	Tupanvirus	29.0	7.2e-29
AYZ52961.1|3481767_3483483_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	27.3	2.6e-38
>prophage 247
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3490403	3491362	5864574		Synechococcus_phage(100.0%)	2	NA	NA
AYZ52967.1|3490403_3490832_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	37.3	2.5e-14
AYZ52968.1|3490948_3491362_-	heat shock chaperone IbpA	NA	M1UG22	Synechococcus_phage	37.5	1.0e-17
>prophage 248
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3494855	3496004	5864574		Oenococcus_phage(100.0%)	1	NA	NA
AYZ52972.1|3494855_3496004_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	1.0e-51
>prophage 249
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3501436	3508965	5864574		Bacillus_virus(33.33%)	7	NA	NA
AYZ52979.1|3501436_3503851_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	33.9	3.7e-115
AYZ52980.1|3503879_3504953_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
AYZ52981.1|3505101_3506202_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.3	6.9e-53
AYZ52982.1|3506206_3507607_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
AYZ52983.1|3508228_3508369_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
AYZ52984.1|3508384_3508744_+	ribonuclease P protein component	NA	NA	NA	NA	NA
AYZ52985.1|3508707_3508965_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	55.2	7.1e-17
>prophage 250
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3514934	3516425	5864574		Burkholderia_virus(100.0%)	1	NA	NA
AYZ52991.1|3514934_3516425_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	22.9	3.2e-08
>prophage 251
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3522382	3523720	5864574		Moraxella_phage(100.0%)	1	NA	NA
AYZ52999.1|3522382_3523720_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.2	4.5e-62
>prophage 252
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3529489	3537089	5864574		Bacillus_phage(25.0%)	7	NA	NA
AYZ53005.1|3529489_3530263_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.1	9.9e-14
AYZ53006.1|3530310_3531201_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
AYZ53007.1|3531200_3532160_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
AYZ53008.1|3532351_3533392_-	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	38.1	8.8e-50
AYZ53009.1|3533488_3533695_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ53010.1|3533708_3535538_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	42.9	7.3e-132
AYZ53011.1|3535718_3537089_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	37.4	5.6e-36
>prophage 253
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3551672	3552665	5864574		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
AYZ53026.1|3551672_3552665_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.5e-49
>prophage 254
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3555834	3561710	5864574		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
AYZ53029.1|3555834_3557703_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.5	1.9e-66
AYZ53030.1|3557885_3558305_+	D-ribose pyranase	NA	NA	NA	NA	NA
AYZ53031.1|3558315_3559821_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	22.1	1.5e-18
AYZ53032.1|3559826_3560792_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
AYZ53033.1|3560819_3561710_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	24.5	9.7e-05
>prophage 255
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3576016	3578806	5864574		uncultured_virus(100.0%)	1	NA	NA
AYZ53043.1|3576016_3578806_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	33.6	1.5e-75
>prophage 256
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3582698	3585166	5864574		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
AYZ53049.1|3582698_3584108_-	nitrogen assimilation regulatory protein	NA	Q56AR1	Bacillus_thuringiensis_phage	28.3	4.8e-06
AYZ53050.1|3584116_3585166_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.7	2.2e-08
>prophage 257
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3591990	3592908	5864574		Pandoravirus(100.0%)	1	NA	NA
AYZ53057.1|3591990_3592908_-	alpha/beta hydrolase	NA	S4W4Z4	Pandoravirus	28.1	6.7e-17
>prophage 258
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3631036	3632548	5864574		Bacillus_virus(100.0%)	1	NA	NA
AYZ53094.1|3631036_3632548_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.5	6.7e-14
>prophage 259
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3640843	3644371	5864574		Bacillus_thuringiensis_phage(33.33%)	4	NA	NA
AYZ53102.1|3640843_3641464_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	3.2e-63
AYZ53103.1|3641535_3642210_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
AYZ53104.1|3642302_3643676_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	23.3	4.5e-09
AYZ53105.1|3643672_3644371_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
>prophage 260
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3649005	3650340	5864574		Erwinia_phage(100.0%)	1	NA	NA
AYZ53111.1|3649005_3650340_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	30.3	1.1e-44
>prophage 261
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3667554	3670255	5864574		Escherichia_phage(50.0%)	3	NA	NA
AYZ53127.1|3667554_3668304_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	32.7	9.0e-20
AYZ53128.1|3668432_3669536_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
AYZ53129.1|3669592_3670255_-	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	34.0	3.5e-28
>prophage 262
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3686137	3688006	5864574		Acinetobacter_phage(100.0%)	1	NA	NA
AYZ55140.1|3686137_3688006_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	27.0	8.3e-06
>prophage 263
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3698083	3699730	5864574		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AYZ53149.1|3698083_3699730_+	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.6	1.4e-65
>prophage 264
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3709833	3716083	5864574		Vibrio_phage(33.33%)	5	NA	NA
AYZ53159.1|3709833_3710562_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.0	1.2e-21
AYZ53160.1|3710664_3712683_+	ATP-dependent DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.3	3.2e-112
AYZ53161.1|3712686_3713649_-	ribokinase	NA	NA	NA	NA	NA
AYZ53162.1|3713632_3715048_-	allantoin permease	NA	NA	NA	NA	NA
AYZ53163.1|3715066_3716083_-	ADP-ribosylglycohydrolase family protein	NA	A0A172WZB4	Catopsilia_pomona_nucleopolyhedrovirus	25.6	1.4e-07
>prophage 265
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3721616	3723555	5864574		Cafeteria_roenbergensis_virus(50.0%)	2	NA	NA
AYZ53169.1|3721616_3722882_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.8	8.3e-42
AYZ53170.1|3723225_3723555_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	2.5e-14
>prophage 266
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3727605	3733745	5864574		Catovirus(20.0%)	6	NA	NA
AYZ53174.1|3727605_3728736_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	27.6	8.8e-27
AYZ53175.1|3728732_3729995_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.1	2.0e-24
AYZ55143.1|3729991_3731059_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	4.3e-100
AYZ53176.1|3731076_3731958_+	glucose-1-phosphate thymidylyltransferase	NA	A0A291LA53	Escherichia_phage	66.7	2.7e-108
AYZ53177.1|3731935_3732610_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
AYZ55144.1|3732614_3733745_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	6.7e-19
>prophage 267
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3750266	3754125	5864574		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
AYZ53192.1|3750266_3751169_+	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	28.9	3.8e-17
AYZ53193.1|3751168_3751885_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
AYZ53194.1|3751962_3754125_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.3	2.1e-117
>prophage 268
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3757974	3759801	5864574		Catovirus(100.0%)	1	NA	NA
AYZ53199.1|3757974_3759801_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.6	1.6e-83
>prophage 269
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3776076	3782255	5864574		Alteromonas_phage(33.33%)	7	NA	NA
AYZ53213.1|3776076_3777525_+	DNA recombination protein RmuC	NA	R9RFD7	Alteromonas_phage	56.4	6.8e-08
AYZ53214.1|3777595_3778351_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
AYZ53215.1|3778364_3778970_+	SCP2 domain-containing protein	NA	NA	NA	NA	NA
AYZ53216.1|3778966_3780607_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.4	7.7e-40
AYZ53217.1|3780684_3780936_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
AYZ53218.1|3780939_3781479_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
AYZ53219.1|3781481_3782255_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	30.4	6.6e-26
>prophage 270
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3791458	3792073	5864574		Streptococcus_phage(100.0%)	1	NA	NA
AYZ53229.1|3791458_3792073_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	32.3	2.8e-19
>prophage 271
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3801940	3824764	5864574		uncultured_Mediterranean_phage(14.29%)	19	NA	NA
AYZ53233.1|3801940_3802891_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	31.6	5.1e-28
AYZ53234.1|3803892_3805077_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.6e-13
AYZ53235.1|3805090_3805288_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ53236.1|3805309_3805693_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
AYZ53237.1|3805694_3806240_+	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	29.1	3.1e-14
AYZ53238.1|3806395_3806824_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
AYZ53239.1|3806827_3807532_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
AYZ53240.1|3807889_3808387_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
AYZ53241.1|3808453_3808822_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
AYZ53242.1|3809147_3813176_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	30.2	1.1e-23
AYZ53243.1|3813252_3817476_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.2	2.9e-67
AYZ53244.1|3817886_3819227_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
AYZ53245.1|3819270_3819588_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
AYZ53246.1|3819591_3819897_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
AYZ53247.1|3820069_3821602_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	30.3	1.0e-09
AYZ53248.1|3821922_3823056_-	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
AYZ53249.1|3823052_3823823_-	thiazole synthase	NA	NA	NA	NA	NA
AYZ53250.1|3823824_3824025_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
AYZ53251.1|3824008_3824764_-	HesA/MoeB/ThiF family protein	NA	A0A1V0SCZ9	Indivirus	30.0	1.7e-10
>prophage 272
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3830147	3838916	5864574		Klosneuvirus(25.0%)	9	NA	NA
AYZ53257.1|3830147_3830819_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	31.8	1.4e-19
AYZ53258.1|3830861_3831452_+	DUF416 family protein	NA	NA	NA	NA	NA
AYZ53259.1|3831638_3831911_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	56.7	1.2e-19
AYZ55147.1|3831923_3832616_+	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
AYZ53260.1|3832619_3833054_-	zinc resistance sensor/chaperone ZraP	NA	NA	NA	NA	NA
AYZ53261.1|3833305_3834694_+	two-component system sensor histidine kinase ZraS	NA	NA	NA	NA	NA
AYZ53262.1|3834690_3836022_+	two-component system response regulator ZraR	NA	Q6XM27	Feldmannia_irregularis_virus	31.6	8.2e-08
AYZ53263.1|3836018_3837311_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
AYZ53264.1|3837326_3838916_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.4	7.1e-67
>prophage 273
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3852845	3856529	5864574		Dickeya_phage(100.0%)	1	NA	NA
AYZ53270.1|3852845_3856529_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	3.7e-26
>prophage 274
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3872244	3873033	5864574		Pseudomonas_phage(100.0%)	1	NA	NA
AYZ53287.1|3872244_3873033_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	46.3	3.3e-49
>prophage 275
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3884978	3886088	5864574		Mycoplasma_phage(100.0%)	1	NA	NA
AYZ53298.1|3884978_3886088_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
>prophage 276
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3893225	3893834	5864574		Lactococcus_phage(100.0%)	1	NA	NA
AYZ53305.1|3893225_3893834_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	40.7	7.8e-14
>prophage 277
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3899777	3902418	5864574		Escherichia_phage(50.0%)	2	NA	NA
AYZ53313.1|3899777_3901193_+	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.3	2.8e-200
AYZ53314.1|3901338_3902418_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.3	4.0e-29
>prophage 278
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3907194	3912476	5864574		uncultured_Mediterranean_phage(33.33%)	3	NA	NA
AYZ53322.1|3907194_3910020_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	0.0e+00
AYZ53323.1|3910266_3910794_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	96.4	3.5e-55
AYZ53324.1|3910880_3912476_-	lytic transglycosylase F	NA	K7RVN3	Vibrio_phage	30.3	1.1e-06
>prophage 279
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3924425	3925775	5864574		Moraxella_phage(100.0%)	1	NA	NA
AYZ53334.1|3924425_3925775_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.5e-158
>prophage 280
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3938132	3949452	5864574		Staphylococcus_phage(33.33%)	9	NA	NA
AYZ53345.1|3938132_3940091_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.5	2.7e-92
AYZ53346.1|3940210_3940435_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ53347.1|3940502_3941816_+	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
AYZ53348.1|3941968_3942652_-	sel1 repeat family protein	NA	NA	NA	NA	NA
AYZ53349.1|3942937_3945085_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.3	3.1e-33
AYZ53350.1|3945359_3946271_-	allose kinase	NA	NA	NA	NA	NA
AYZ53351.1|3946254_3946950_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
AYZ53352.1|3946960_3947941_-	D-allose ABC transporter permease	NA	NA	NA	NA	NA
AYZ53353.1|3947919_3949452_-	D-allose ABC transporter ATP-binding protein AlsA	NA	G3M9Y6	Bacillus_virus	26.5	1.1e-11
>prophage 281
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3956941	3958582	5864574		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
AYZ53363.1|3956941_3957628_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.5	1.2e-07
AYZ53364.1|3957823_3958582_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	27.0	3.9e-15
>prophage 282
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3964016	3965519	5864574		Burkholderia_virus(100.0%)	1	NA	NA
AYZ53372.1|3964016_3965519_+	proline/glycine betaine transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.2	1.4e-56
>prophage 283
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3968692	3970443	5864574		Indivirus(50.0%)	2	NA	NA
AYZ53376.1|3968692_3969610_-	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	42.2	2.1e-07
AYZ53377.1|3969759_3970443_-	TerC family protein	NA	A0A2R2YAT9	Pseudomonas_phage	42.8	3.8e-33
>prophage 284
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3983523	3989058	5864574		Cronobacter_phage(33.33%)	5	NA	NA
AYZ53389.1|3983523_3983817_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	2.1e-12
AYZ53390.1|3983860_3985507_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.3	1.5e-189
AYZ53391.1|3985641_3985995_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
AYZ53392.1|3986045_3986912_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ53393.1|3986934_3989058_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.2	7.9e-29
>prophage 285
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	3999915	4000446	5864574		Morganella_phage(100.0%)	1	NA	NA
AYZ53406.1|3999915_4000446_-	hypothetical protein	NA	A0A1W6JNX6	Morganella_phage	54.1	7.9e-47
>prophage 286
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4004144	4005122	5864574		Tupanvirus(100.0%)	1	NA	NA
AYZ53410.1|4004144_4005122_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.1	4.0e-28
>prophage 287
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4010805	4011351	5864574		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
AYZ53415.1|4010805_4011351_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.6	7.7e-29
>prophage 288
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4016210	4019442	5864574		Vibrio_phage(50.0%)	2	NA	NA
AYZ53419.1|4016210_4017536_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	30.1	2.5e-17
AYZ53420.1|4017546_4019442_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	40.5	1.3e-59
>prophage 289
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4025104	4029465	5864574		Pithovirus(50.0%)	3	NA	NA
AYZ53427.1|4025104_4026403_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
AYZ53428.1|4026554_4026980_+	HTH-type transcriptional repressor NsrR	NA	NA	NA	NA	NA
AYZ53429.1|4027017_4029465_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.3	9.3e-66
>prophage 290
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4065498	4072759	5864574		uncultured_Caudovirales_phage(33.33%)	7	NA	NA
AYZ53468.1|4065498_4066026_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	7.1e-56
AYZ53469.1|4066429_4067386_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYZ53470.1|4067572_4069075_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	9.0e-11
AYZ53471.1|4069085_4070111_+	ABC transporter permease	NA	NA	NA	NA	NA
AYZ53472.1|4070097_4071099_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
AYZ53473.1|4071211_4071724_+	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
AYZ53474.1|4071760_4072759_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	2.5e-70
>prophage 291
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4094736	4097533	5864574		Cronobacter_phage(50.0%)	2	NA	NA
AYZ53494.1|4094736_4095201_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	3.2e-52
AYZ53495.1|4095394_4097533_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.4	2.0e-266
>prophage 292
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4105346	4113124	5864574		Enterobacteria_phage(25.0%)	6	NA	NA
AYZ53502.1|4105346_4106294_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	23.3	6.0e-13
AYZ53503.1|4106673_4109382_+	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	26.7	1.2e-45
AYZ53504.1|4109449_4109836_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
AYZ53505.1|4109989_4111444_-	N-acetylglucosamine-binding protein GbpA	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	36.8	3.0e-19
AYZ53506.1|4111714_4112176_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AYZ53507.1|4112188_4113124_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	41.2	3.1e-54
>prophage 293
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4124159	4133084	5864574	tRNA	Klosneuvirus(33.33%)	7	NA	NA
AYZ53520.1|4124159_4127015_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.8	6.0e-141
AYZ53521.1|4127014_4127458_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
AYZ53522.1|4127580_4129092_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	1.6e-47
AYZ53523.1|4129250_4129370_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AYZ53524.1|4129359_4130457_+	lipopolysaccharide ABC transporter permease LptF	NA	NA	NA	NA	NA
AYZ53525.1|4130456_4131539_+	lipopolysaccharide ABC transporter permease LptG	NA	NA	NA	NA	NA
AYZ55159.1|4131581_4133084_-	ATP-binding protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	2.3e-83
>prophage 294
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4148327	4154992	5864574		Planktothrix_phage(33.33%)	6	NA	NA
AYZ53537.1|4148327_4149401_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	1.6e-22
AYZ53538.1|4149406_4150231_-	phosphodiesterase	NA	NA	NA	NA	NA
AYZ53539.1|4150241_4151129_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
AYZ53540.1|4151118_4151991_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AYZ53541.1|4152181_4153201_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	32.0	7.6e-46
AYZ53542.1|4153720_4154992_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	39.1	6.3e-82
>prophage 295
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4158830	4160471	5864574		Acidithiobacillus_phage(100.0%)	1	NA	NA
AYZ53548.1|4158830_4160471_-	restriction endonuclease	NA	K4I1H4	Acidithiobacillus_phage	28.7	2.1e-21
>prophage 296
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4165142	4167940	5864574		Staphylococcus_phage(100.0%)	2	NA	NA
AYZ55160.1|4165142_4165805_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	29.4	2.1e-12
AYZ53552.1|4166332_4167940_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	54.9	2.0e-157
>prophage 297
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4171535	4172621	5864574		Clostridium_botulinum_C_phage(100.0%)	1	NA	NA
AYZ53557.1|4171535_4172621_+	MBL fold metallo-hydrolase	NA	Q332B9	Clostridium_botulinum_C_phage	32.0	2.2e-06
>prophage 298
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4181757	4181976	5864574		Vibrio_phage(100.0%)	1	NA	NA
AYZ55162.1|4181757_4181976_-	AlpA family transcriptional regulator	NA	A0A1V0E8P5	Vibrio_phage	41.7	3.1e-05
>prophage 299
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4200941	4203588	5864574		Stx2-converting_phage(25.0%)	4	NA	NA
AYZ53573.1|4200941_4201199_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	50.0	3.5e-16
AYZ53574.1|4201447_4201546_-	hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	93.8	2.0e-09
AYZ53575.1|4202284_4203106_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.0	7.0e-42
AYZ53576.1|4203138_4203588_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	25.9	4.7e-08
>prophage 300
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4222208	4223573	5864574		Burkholderia_virus(100.0%)	1	NA	NA
AYZ53595.1|4222208_4223573_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.6	1.0e-45
>prophage 301
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4236279	4242003	5864574		Staphylococcus_phage(50.0%)	3	NA	NA
AYZ53602.1|4236279_4239009_-	ABC transporter ATP-binding protein/permease	NA	A0A2H4PQG7	Staphylococcus_phage	30.1	1.0e-20
AYZ55165.1|4239005_4240073_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYZ53603.1|4240605_4242003_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.9	2.6e-20
>prophage 302
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4250307	4253694	5864574	holin	Serratia_phage(100.0%)	1	NA	NA
AYZ53614.1|4250307_4253694_-|holin	choline trimethylamine-lyase	holin	A0A1S6UAD4	Serratia_phage	45.0	9.7e-05
>prophage 303
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4259444	4260029	5864574		Moraxella_phage(100.0%)	1	NA	NA
AYZ53623.1|4259444_4260029_-	TetR/AcrR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	32.3	5.0e-10
>prophage 304
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4276316	4278154	5864574		Streptococcus_phage(50.0%)	2	NA	NA
AYZ53642.1|4276316_4277528_+	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	32.7	1.8e-57
AYZ53643.1|4277527_4278154_+	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	52.3	2.5e-55
>prophage 305
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4281167	4289047	5864574	transposase	Diadromus_pulchellus_ascovirus(50.0%)	4	NA	NA
AYZ53645.1|4281167_4286381_+	RecQ family ATP-dependent DNA helicase	NA	Q9DSV4	Diadromus_pulchellus_ascovirus	32.3	3.6e-43
AYZ53646.1|4286391_4287039_-	LysE family translocator	NA	NA	NA	NA	NA
AYZ53647.1|4287085_4287901_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYZ53648.1|4288108_4289047_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.6	7.4e-72
>prophage 306
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4328689	4329712	5864574		Tupanvirus(100.0%)	1	NA	NA
AYZ53678.1|4328689_4329712_+	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	30.4	4.7e-11
>prophage 307
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4336715	4339871	5864574	transposase	Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
AYZ53684.1|4336715_4337777_+	SIS domain-containing protein	NA	M1I2B0	Paramecium_bursaria_Chlorella_virus	23.4	4.2e-07
AYZ53685.1|4337773_4338805_+	SIS domain-containing protein	NA	NA	NA	NA	NA
AYZ53686.1|4338944_4339871_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.3	1.7e-68
>prophage 308
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4343030	4344310	5864574		Shigella_phage(50.0%)	2	NA	NA
AYZ55169.1|4343030_4343768_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.7	5.8e-64
AYZ53689.1|4343770_4344310_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	60.6	7.1e-27
>prophage 309
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4357614	4360319	5864574		Streptococcus_phage(50.0%)	3	NA	NA
AYZ53704.1|4357614_4359204_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.8	1.2e-29
AYZ53705.1|4359421_4360033_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
AYZ53706.1|4360157_4360319_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	69.8	3.0e-13
>prophage 310
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4364984	4366307	5864574		Geobacillus_virus(100.0%)	1	NA	NA
AYZ53710.1|4364984_4366307_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	40.6	4.4e-78
>prophage 311
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4372611	4377862	5864574		Enterococcus_phage(33.33%)	3	NA	NA
AYZ53716.1|4372611_4373844_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	44.0	1.4e-86
AYZ53717.1|4374033_4375701_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.6	1.1e-41
AYZ53718.1|4375924_4377862_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	39.7	1.0e-11
>prophage 312
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4381826	4383251	5864574		Bacillus_phage(100.0%)	1	NA	NA
AYZ53725.1|4381826_4383251_+	two-component system sensor histidine kinase CreC	NA	W8CYF6	Bacillus_phage	26.0	2.8e-14
>prophage 313
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4394334	4395288	5864574		Synechococcus_phage(100.0%)	1	NA	NA
AYZ53735.1|4394334_4395288_+	transaldolase	NA	A0A0E3G6C9	Synechococcus_phage	34.4	2.8e-10
>prophage 314
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4399677	4407975	5864574		Chrysochromulina_ericina_virus(25.0%)	7	NA	NA
AYZ53741.1|4399677_4401594_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.4	1.1e-146
AYZ53742.1|4401681_4402815_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	33.9	1.2e-28
AYZ53743.1|4402981_4403929_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYZ53744.1|4404053_4404401_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ53745.1|4404477_4405011_-	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	54.9	4.0e-54
AYZ53746.1|4405027_4405471_-	transcriptional regulator	NA	NA	NA	NA	NA
AYZ53747.1|4405860_4407975_+	chitinase	NA	A0A1L5JGH0	Plodia_interpunctella_granulovirus	28.3	3.3e-35
>prophage 315
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4420947	4430741	5864574	tRNA,transposase	Tetraselmis_virus(33.33%)	7	NA	NA
AYZ53757.1|4420947_4422441_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	31.3	6.6e-30
AYZ53758.1|4422673_4423936_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
AYZ53759.1|4424084_4425260_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	49.3	3.2e-88
AYZ53760.1|4425312_4426248_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
AYZ53761.1|4426347_4426611_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
AYZ53762.1|4426941_4427880_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
AYZ55176.1|4427924_4430741_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	25.4	1.8e-76
>prophage 316
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4433748	4434684	5864574		Burkholderia_virus(100.0%)	1	NA	NA
AYZ53767.1|4433748_4434684_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	30.2	1.7e-07
>prophage 317
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4457238	4458387	5864574		Halovirus(100.0%)	1	NA	NA
AYZ53786.1|4457238_4458387_+	carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	31.9	1.3e-49
>prophage 318
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4465729	4468059	5864574		Bacillus_phage(33.33%)	3	NA	NA
AYZ53792.1|4465729_4466209_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.5e-28
AYZ53793.1|4466303_4466924_+	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	34.7	7.4e-20
AYZ53794.1|4467210_4468059_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	S4TT53	Salmonella_phage	30.7	7.5e-07
>prophage 319
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4480603	4486055	5864574		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
AYZ53806.1|4480603_4483510_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.6	2.9e-21
AYZ53807.1|4483697_4486055_-	DNA polymerase II	NA	D0FZR7	Heterocapsa_circularisquama_DNA_virus	37.1	6.1e-06
>prophage 320
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4492415	4493117	5864574		Bacillus_virus(100.0%)	1	NA	NA
AYZ53813.1|4492415_4493117_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	33.7	3.1e-22
>prophage 321
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4513890	4515615	5864574		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AYZ53832.1|4513890_4515615_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.3	4.6e-35
>prophage 322
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4541715	4542759	5864574		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
AYZ53857.1|4541715_4542759_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.5	1.7e-101
>prophage 323
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4547090	4547642	5864574		Thiobacimonas_phage(100.0%)	1	NA	NA
AYZ53862.1|4547090_4547642_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1B0T6G1	Thiobacimonas_phage	30.9	1.2e-13
>prophage 324
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4558893	4560318	5864574		Erysipelothrix_phage(100.0%)	1	NA	NA
AYZ53869.1|4558893_4560318_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	4.6e-41
>prophage 325
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4576387	4578674	5864574		uncultured_virus(50.0%)	3	NA	NA
AYZ55179.1|4576387_4576924_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	1.3e-17
AYZ53882.1|4576977_4577640_-	carbonate dehydratase	NA	NA	NA	NA	NA
AYZ53883.1|4577747_4578674_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.5	5.3e-22
>prophage 326
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4584041	4590807	5864574	tRNA	unidentified_phage(50.0%)	6	NA	NA
AYZ53891.1|4584041_4585439_-	polynucleotide adenylyltransferase	NA	H7BUW3	unidentified_phage	36.8	1.5e-28
AYZ53892.1|4585490_4586372_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AYZ53893.1|4586432_4586888_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
AYZ53894.1|4587052_4587769_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AYZ53895.1|4587768_4588305_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
AYZ53896.1|4588377_4590807_+	ATP-dependent helicase HrpB	NA	A0A0U2UIE6	Niemeyer_virus	32.4	3.0e-40
>prophage 327
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4612804	4613602	5864574		Planktothrix_phage(100.0%)	1	NA	NA
AYZ53915.1|4612804_4613602_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	1.6e-14
>prophage 328
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4620231	4620576	5864574		Lake_Baikal_phage(100.0%)	1	NA	NA
AYZ53919.1|4620231_4620576_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	1.6e-27
>prophage 329
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4624692	4630496	5864574	protease	uncultured_Mediterranean_phage(50.0%)	3	NA	NA
AYZ53924.1|4624692_4626132_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.5	1.8e-24
AYZ53925.1|4626322_4627480_+	CdaR family transcriptional regulator	NA	NA	NA	NA	NA
AYZ53926.1|4627517_4630496_-	viral enhancin protein	NA	Q9PYP4	Xestia_c-nigrum_granulosis_virus	22.8	1.3e-37
>prophage 330
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4640936	4641695	5864574		Flavobacterium_phage(100.0%)	1	NA	NA
AYZ53936.1|4640936_4641695_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.7	2.7e-24
>prophage 331
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4650538	4654656	5864574		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
AYZ53945.1|4650538_4651135_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.5	2.7e-27
AYZ53946.1|4651173_4654656_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.6	7.7e-207
>prophage 332
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4669426	4670458	5864574		Planktothrix_phage(100.0%)	1	NA	NA
AYZ53960.1|4669426_4670458_-	D-methionine ABC transporter, ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.2	1.1e-36
>prophage 333
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4681056	4683690	5864574		Cronobacter_phage(100.0%)	1	NA	NA
AYZ53964.1|4681056_4683690_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.2e-98
>prophage 334
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4687338	4688142	5864574		Indivirus(100.0%)	1	NA	NA
AYZ53967.1|4687338_4688142_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.9	1.9e-39
>prophage 335
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4692180	4696391	5864574		Lactobacillus_phage(33.33%)	5	NA	NA
AYZ53971.1|4692180_4693548_-	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	30.6	4.3e-12
AYZ53972.1|4693619_4694375_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AYZ53973.1|4694407_4695124_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYZ53974.1|4695126_4695594_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	60.1	2.9e-53
AYZ55187.1|4695659_4696391_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.8	1.1e-38
>prophage 336
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4700444	4701026	5864574		Caulobacter_phage(100.0%)	1	NA	NA
AYZ53977.1|4700444_4701026_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	29.6	1.1e-12
>prophage 337
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4711926	4713066	5864574		Brevibacillus_phage(100.0%)	1	NA	NA
AYZ53990.1|4711926_4713066_+	RNA ligase RtcB family protein	NA	A0A0K2CNT0	Brevibacillus_phage	26.0	3.0e-19
>prophage 338
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4737956	4739432	5864574		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AYZ54012.1|4737956_4739432_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.7	1.1e-45
>prophage 339
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4766490	4770201	5864574		Streptococcus_phage(66.67%)	3	NA	NA
AYZ54031.1|4766490_4767744_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.6	7.5e-96
AYZ54032.1|4767754_4768858_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.2	1.8e-61
AYZ54033.1|4769148_4770201_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.2	3.7e-112
>prophage 340
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4775079	4775823	5864574		Bacillus_virus(100.0%)	1	NA	NA
AYZ54038.1|4775079_4775823_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.8	1.3e-31
>prophage 341
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4783149	4783992	5864574		Brazilian_cedratvirus(100.0%)	1	NA	NA
AYZ54046.1|4783149_4783992_-	phosphonate ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	26.6	9.1e-13
>prophage 342
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4794641	4798752	5864574		Brazilian_cedratvirus(66.67%)	5	NA	NA
AYZ55193.1|4794641_4795460_-	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.9	1.0e-16
AYZ54055.1|4795473_4796283_-	cysteine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYZ54056.1|4796997_4797174_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ54057.1|4797281_4797977_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.1	8.9e-06
AYZ54058.1|4797969_4798752_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	23.3	5.1e-10
>prophage 343
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4810415	4811462	5864574		Bacillus_virus(100.0%)	1	NA	NA
AYZ54069.1|4810415_4811462_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	6.8e-34
>prophage 344
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4819518	4820286	5864574		Planktothrix_phage(100.0%)	1	NA	NA
AYZ54076.1|4819518_4820286_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.1	5.0e-26
>prophage 345
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4844772	4854017	5864574		Bacillus_phage(60.0%)	7	NA	NA
AYZ55195.1|4844772_4845684_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.9	4.2e-104
AYZ54103.1|4845774_4846680_+	fructokinase	NA	NA	NA	NA	NA
AYZ54104.1|4846728_4847091_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AYZ54105.1|4847378_4850513_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	27.4	2.9e-11
AYZ54106.1|4850509_4851712_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	26.4	2.8e-07
AYZ54107.1|4852016_4852706_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	3.3e-37
AYZ54108.1|4852727_4854017_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	28.3	5.9e-27
>prophage 346
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4871151	4875491	5864574	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
AYZ54125.1|4871151_4872279_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.6	2.5e-90
AYZ54126.1|4872301_4872634_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
AYZ54127.1|4872661_4874509_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
AYZ54128.1|4874519_4875491_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.8	7.2e-46
>prophage 347
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4880500	4882168	5864574		Indivirus(50.0%)	2	NA	NA
AYZ54135.1|4880500_4881604_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.0	5.5e-50
AYZ54136.1|4881697_4882168_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	7.8e-30
>prophage 348
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4894278	4899808	5864574		Moraxella_phage(50.0%)	4	NA	NA
AYZ54148.1|4894278_4896936_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	30.2	1.6e-23
AYZ54149.1|4897000_4898647_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
AYZ54150.1|4898665_4899034_+	holo-[acyl-carrier-protein] synthase	NA	NA	NA	NA	NA
AYZ54151.1|4899052_4899808_+	3-oxoacyl-ACP reductase FabG	NA	F2NZ40	Diadromus_pulchellus_ascovirus	31.1	2.5e-14
>prophage 349
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4906697	4907405	5864574		Brazilian_cedratvirus(100.0%)	1	NA	NA
AYZ54158.1|4906697_4907405_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.3	1.8e-14
>prophage 350
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4921613	4925338	5864574		Lactobacillus_phage(100.0%)	3	NA	NA
AYZ54171.1|4921613_4923317_-	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	26.4	8.3e-21
AYZ54172.1|4923327_4923648_-	NIPSNAP family protein	NA	NA	NA	NA	NA
AYZ54173.1|4923637_4925338_-	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	26.7	5.5e-25
>prophage 351
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4937688	4942738	5864574	protease	Agrobacterium_phage(25.0%)	4	NA	NA
AYZ54186.1|4937688_4938312_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
AYZ54187.1|4938444_4939719_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.1	2.8e-130
AYZ54188.1|4939902_4942257_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.1	1.0e-223
AYZ54189.1|4942465_4942738_+	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	61.8	8.5e-21
>prophage 352
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4946118	4946814	5864574		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AYZ54194.1|4946118_4946814_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	8.4e-89
>prophage 353
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4951241	4954785	5864574		Bacillus_phage(100.0%)	2	NA	NA
AYZ54199.1|4951241_4953014_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.8	1.7e-48
AYZ54200.1|4953006_4954785_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	7.5e-41
>prophage 354
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4959247	4960174	5864574		Lactobacillus_phage(100.0%)	1	NA	NA
AYZ54205.1|4959247_4960174_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	21.3	2.7e-05
>prophage 355
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4969953	4971063	5864574		Bacillus_phage(100.0%)	1	NA	NA
AYZ54218.1|4969953_4971063_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	32.1	9.2e-13
>prophage 356
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4980213	4989609	5864574		Enterobacteria_phage(33.33%)	10	NA	NA
AYZ54226.1|4980213_4981287_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	43.3	4.5e-73
AYZ55198.1|4981398_4981662_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
AYZ54227.1|4981661_4981802_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
AYZ54228.1|4981798_4982497_-	N-acetyltransferase	NA	NA	NA	NA	NA
AYZ54229.1|4982598_4984053_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.0	3.3e-18
AYZ54230.1|4984027_4984498_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ54231.1|4984634_4985201_-	maltose O-acetyltransferase	NA	NA	NA	NA	NA
AYZ54232.1|4985361_4985580_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
AYZ54233.1|4985606_4985981_-	Hha toxicity modulator TomB	NA	NA	NA	NA	NA
AYZ54234.1|4986462_4989609_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.9	7.0e-50
>prophage 357
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	4995125	5002828	5864574	transposase	Sodalis_phage(25.0%)	9	NA	NA
AYZ54238.1|4995125_4995914_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.8	3.2e-52
AYZ54239.1|4995979_4996153_-	DUF2496 domain-containing protein	NA	NA	NA	NA	NA
AYZ54240.1|4996167_4996695_-	primosomal replication protein N''	NA	NA	NA	NA	NA
AYZ54241.1|4996764_4997142_+	DUF454 family protein	NA	NA	NA	NA	NA
AYZ54242.1|4997292_4997844_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.2	2.3e-28
AYZ54243.1|4997936_4999847_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.2	6.0e-44
AYZ54244.1|4999904_5000237_+	nucleoid-associated protein, YbaB/EbfC family	NA	NA	NA	NA	NA
AYZ54245.1|5000236_5000842_+	recombination protein RecR	NA	NA	NA	NA	NA
AYZ54246.1|5000953_5002828_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.0	1.2e-110
>prophage 358
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5013225	5018436	5864574		uncultured_virus(50.0%)	5	NA	NA
AYZ54255.1|5013225_5015727_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.0	7.2e-114
AYZ54256.1|5015833_5016244_+	HTH-type transcriptional regulator CueR	NA	NA	NA	NA	NA
AYZ54257.1|5016240_5016705_-	NfeD family protein	NA	NA	NA	NA	NA
AYZ54258.1|5016701_5017619_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
AYZ54259.1|5017755_5018436_+	iron ABC transporter ATP-binding protein FetA	NA	F2Y165	Organic_Lake_phycodnavirus	28.6	1.1e-13
>prophage 359
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5021612	5022299	5864574		Planktothrix_phage(100.0%)	1	NA	NA
AYZ55200.1|5021612_5022299_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.5	5.9e-34
>prophage 360
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5030441	5032223	5864574		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
AYZ54270.1|5030441_5032223_+	glyoxylate carboligase	NA	A0A0P0CRC5	Ostreococcus_lucimarinus_virus	27.7	7.8e-38
>prophage 361
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5039836	5040982	5864574		Streptococcus_phage(100.0%)	1	NA	NA
AYZ54276.1|5039836_5040982_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	42.0	4.8e-49
>prophage 362
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5053028	5055789	5864574	tRNA	Moumouvirus(50.0%)	3	NA	NA
AYZ54289.1|5053028_5054414_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.1	1.0e-45
AYZ54290.1|5054708_5054921_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
AYZ54291.1|5054922_5055789_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	6.5e-30
>prophage 363
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5066579	5067293	5864574		Bacillus_virus(100.0%)	1	NA	NA
AYZ54301.1|5066579_5067293_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	35.6	7.0e-14
>prophage 364
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5073619	5074495	5864574		Burkholderia_virus(100.0%)	1	NA	NA
AYZ54308.1|5073619_5074495_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	27.8	4.0e-19
>prophage 365
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5081267	5086357	5864574	tRNA	Acinetobacter_phage(33.33%)	5	NA	NA
AYZ54314.1|5081267_5082743_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.0	4.5e-47
AYZ54315.1|5082768_5083005_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ54316.1|5083117_5084635_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.1	1.9e-85
AYZ54317.1|5084970_5085384_+	DNA breaking-rejoining protein	NA	NA	NA	NA	NA
AYZ54318.1|5085484_5086357_-	class A extended-spectrum beta-lactamase OXY-2-1	NA	A0A1B0VBP7	Salmonella_phage	74.5	1.8e-112
>prophage 366
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5096619	5101264	5864574		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
AYZ54328.1|5096619_5097339_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.3	7.6e-08
AYZ54329.1|5097331_5098099_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	24.1	1.7e-13
AYZ54330.1|5098095_5099202_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYZ54331.1|5099212_5100163_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AYZ54332.1|5100334_5101264_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	26.5	1.6e-13
>prophage 367
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5108499	5109900	5864574		Bacillus_phage(100.0%)	1	NA	NA
AYZ54338.1|5108499_5109900_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	26.4	1.6e-17
>prophage 368
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5135670	5136420	5864574		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
AYZ54359.1|5135670_5136420_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.0	6.9e-20
>prophage 369
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5168371	5171086	5864574		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
AYZ55204.1|5168371_5171086_+	cation-transporting P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	27.1	1.2e-66
>prophage 370
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5181715	5183759	5864574		Bacillus_virus(50.0%)	2	NA	NA
AYZ54394.1|5181715_5182759_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.3	3.5e-14
AYZ54395.1|5182748_5183759_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.7	1.6e-11
>prophage 371
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5188733	5193411	5864574		Streptococcus_phage(50.0%)	5	NA	NA
AYZ54400.1|5188733_5190200_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	23.2	9.0e-16
AYZ54401.1|5190434_5191286_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYZ54402.1|5191335_5191977_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AYZ54403.1|5191991_5192657_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AYZ54404.1|5192649_5193411_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	3.5e-19
>prophage 372
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5196536	5197241	5864574		Planktothrix_phage(100.0%)	1	NA	NA
AYZ54408.1|5196536_5197241_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.9	3.1e-22
>prophage 373
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5202710	5214245	5864574	holin	Catovirus(25.0%)	10	NA	NA
AYZ54413.1|5202710_5204375_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	6.1e-61
AYZ54414.1|5204389_5205862_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AYZ54415.1|5205872_5206466_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
AYZ54416.1|5206594_5208628_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	28.1	2.0e-21
AYZ54417.1|5208850_5209003_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
AYZ54418.1|5209148_5209730_-	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	30.9	1.4e-12
AYZ54419.1|5209804_5210590_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AYZ54420.1|5210769_5211567_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AYZ54421.1|5211627_5212683_-	ABC transporter permease	NA	NA	NA	NA	NA
AYZ54422.1|5212700_5214245_-	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.0	6.8e-14
>prophage 374
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5225688	5230462	5864574		Tupanvirus(50.0%)	2	NA	NA
AYZ54433.1|5225688_5229570_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	28.7	1.8e-55
AYZ54434.1|5229667_5230462_-	iron-enterobactin ABC transporter ATP-binding protein	NA	M1HRF1	Paramecium_bursaria_Chlorella_virus	25.9	2.6e-09
>prophage 375
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5234268	5236410	5864574		Plodia_interpunctella_granulovirus(100.0%)	1	NA	NA
AYZ54438.1|5234268_5236410_-	chitinase	NA	A0A1L5JGH0	Plodia_interpunctella_granulovirus	28.1	4.8e-34
>prophage 376
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5245334	5248952	5864574		Burkholderia_phage(50.0%)	4	NA	NA
AYZ54448.1|5245334_5245739_-	helix-turn-helix domain-containing protein	NA	A0A1S5NNJ5	Burkholderia_phage	33.3	6.1e-07
AYZ54449.1|5245719_5246013_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AYZ54450.1|5246200_5247289_-	oxidoreductase	NA	NA	NA	NA	NA
AYZ54451.1|5247449_5248952_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.1e-16
>prophage 377
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5266061	5279903	5864574	tRNA	Cedratvirus(20.0%)	13	NA	NA
AYZ54465.1|5266061_5267090_+	dihydrofolate reductase	NA	A0A285PXZ1	Cedratvirus	34.4	1.6e-30
AYZ54466.1|5267128_5268073_-	sugar kinase	NA	NA	NA	NA	NA
AYZ54467.1|5268084_5269086_-	ABC transporter permease	NA	NA	NA	NA	NA
AYZ54468.1|5269085_5270072_-	ABC transporter permease	NA	NA	NA	NA	NA
AYZ54469.1|5270068_5271622_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.6e-15
AYZ54470.1|5271618_5272599_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYZ54471.1|5273009_5275319_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase GatCAB subunit C	tRNA	A0A077SK27	Escherichia_phage	33.1	1.2e-83
AYZ54472.1|5275315_5275531_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ54473.1|5275502_5276045_-	acireductone dioxygenase	NA	NA	NA	NA	NA
AYZ54474.1|5276041_5276731_-	acireductone synthase	NA	NA	NA	NA	NA
AYZ54475.1|5276904_5278065_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AYZ54476.1|5278065_5278695_-	hypothetical protein	NA	A0A0F7L444	uncultured_marine_virus	49.3	1.3e-51
AYZ55207.1|5278679_5279903_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	34.1	3.7e-63
>prophage 378
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5283074	5285146	5864574		Bacillus_virus(50.0%)	2	NA	NA
AYZ54480.1|5283074_5284640_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.6	4.9e-44
AYZ54481.1|5284717_5285146_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	40.7	2.5e-19
>prophage 379
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5289235	5289886	5864574		Morganella_phage(50.0%)	2	NA	NA
AYZ54487.1|5289235_5289445_+	cold shock-like protein CspE	NA	A0A1W6JNX5	Morganella_phage	80.6	4.5e-22
AYZ54488.1|5289502_5289886_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	50.0	6.8e-24
>prophage 380
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5294678	5297121	5864574		Stx2-converting_phage(50.0%)	2	NA	NA
AYZ54495.1|5294678_5295878_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.7	1.1e-104
AYZ54496.1|5296020_5297121_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	51.6	1.0e-08
>prophage 381
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5304129	5312311	5864574	tRNA	Staphylococcus_phage(33.33%)	5	NA	NA
AYZ54504.1|5304129_5306712_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.2	5.9e-188
AYZ54505.1|5306938_5307421_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
AYZ54506.1|5307775_5309554_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	35.2	7.3e-28
AYZ54507.1|5309617_5311288_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
AYZ54508.1|5311585_5312311_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	1.7e-28
>prophage 382
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5318168	5319233	5864574		Pseudomonas_phage(100.0%)	1	NA	NA
AYZ54515.1|5318168_5319233_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.6	1.1e-47
>prophage 383
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5323281	5324943	5864574		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
AYZ54518.1|5323281_5324943_-	asparagine synthase B	NA	H8ZJK1	Ostreococcus_tauri_virus	39.0	1.0e-84
>prophage 384
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5329569	5339521	5864574	tRNA	Vibrio_phage(25.0%)	7	NA	NA
AYZ54523.1|5329569_5331522_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	3.2e-08
AYZ54524.1|5331700_5333368_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	92.1	1.1e-309
AYZ54525.1|5333804_5335208_+	chitoporin	NA	NA	NA	NA	NA
AYZ54526.1|5335255_5335588_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ54527.1|5335641_5336937_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.7	1.2e-59
AYZ54528.1|5336991_5338131_-	tricarballylate utilization 4Fe-4S protein TcuB	NA	NA	NA	NA	NA
AYZ54529.1|5338117_5339521_-	FAD-dependent tricarballylate dehydrogenase TcuA	NA	A0A2P0ZL82	Lactobacillus_phage	26.6	6.6e-08
>prophage 385
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5342522	5343296	5864574		Mycobacterium_phage(100.0%)	1	NA	NA
AYZ54534.1|5342522_5343296_-	esterase	NA	W0LK50	Mycobacterium_phage	39.0	6.9e-07
>prophage 386
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5349740	5351225	5864574		Staphylococcus_phage(100.0%)	1	NA	NA
AYZ55209.1|5349740_5351225_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.8	1.9e-21
>prophage 387
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5359414	5366917	5864574		Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
AYZ54548.1|5359414_5361463_-	K(+)-transporting ATPase subunit B	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.6	1.6e-26
AYZ54549.1|5361484_5363164_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
AYZ54550.1|5363163_5363253_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
AYZ54551.1|5363563_5363770_+	DUF2517 family protein	NA	NA	NA	NA	NA
AYZ54552.1|5364024_5365467_+	deoxyribodipyrimidine photo-lyase	NA	F2Y1K1	Organic_Lake_phycodnavirus	32.0	6.7e-56
AYZ54553.1|5365435_5366917_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.9	2.9e-46
>prophage 388
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5372718	5373510	5864574		Kaumoebavirus(100.0%)	1	NA	NA
AYZ54561.1|5372718_5373510_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	27.9	1.5e-09
>prophage 389
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5389420	5392134	5864574		Escherichia_phage(100.0%)	3	NA	NA
AYZ54576.1|5389420_5390227_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	42.7	9.3e-47
AYZ54577.1|5390236_5390881_-	aldolase	NA	A0A077SK32	Escherichia_phage	58.7	5.5e-58
AYZ54578.1|5390877_5392134_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	49.3	1.2e-93
>prophage 390
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5418729	5422248	5864574		Vibrio_phage(33.33%)	4	NA	NA
AYZ54605.1|5418729_5419449_+	nicotinamide riboside transporter PnuC	NA	A0A2I7SAC7	Vibrio_phage	26.9	1.6e-18
AYZ54606.1|5419445_5420390_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.1	3.1e-25
AYZ54607.1|5420508_5420880_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ54608.1|5421195_5422248_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	48.6	1.8e-82
>prophage 391
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5426637	5433161	5864574		Tupanvirus(33.33%)	7	NA	NA
AYZ54613.1|5426637_5427654_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.7	2.6e-78
AYZ54614.1|5427859_5429335_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A2R8FG22	Brazilian_cedratvirus	26.6	5.7e-10
AYZ54615.1|5429402_5430191_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
AYZ55211.1|5430345_5430495_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
AYZ54616.1|5430638_5431412_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYZ54617.1|5431411_5432101_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
AYZ54618.1|5432102_5433161_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	33.9	3.1e-18
>prophage 392
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5440336	5441068	5864574		Enterobacteria_phage(100.0%)	1	NA	NA
AYZ54626.1|5440336_5441068_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	52.3	7.8e-53
>prophage 393
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5448683	5453637	5864574		Catovirus(50.0%)	4	NA	NA
AYZ54634.1|5448683_5450219_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	40.0	1.4e-80
AYZ54635.1|5450319_5451702_+	amino acid permease	NA	NA	NA	NA	NA
AYZ54636.1|5451801_5452278_-	kinase inhibitor	NA	NA	NA	NA	NA
AYZ55213.1|5452347_5453637_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	3.8e-18
>prophage 394
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5457434	5458157	5864574		Staphylococcus_phage(100.0%)	1	NA	NA
AYZ54641.1|5457434_5458157_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.1e-09
>prophage 395
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5464720	5465626	5864574		Streptococcus_phage(100.0%)	1	NA	NA
AYZ54647.1|5464720_5465626_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	29.6	3.7e-28
>prophage 396
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5475653	5477393	5864574		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
AYZ54660.1|5475653_5477393_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.0	3.3e-17
>prophage 397
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5482537	5490825	5864574		Micromonas_pusilla_virus(25.0%)	7	NA	NA
AYZ54665.1|5482537_5483383_+	transketolase	NA	G9E5U1	Micromonas_pusilla_virus	29.2	4.4e-07
AYZ54666.1|5483382_5484375_+	transketolase family protein	NA	NA	NA	NA	NA
AYZ54667.1|5484675_5486040_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.5	1.3e-45
AYZ54668.1|5486724_5488869_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.4	2.6e-43
AYZ54669.1|5488911_5489880_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
AYZ54670.1|5490012_5490273_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AYZ54671.1|5490558_5490825_-	DksA/TraR family C4-type zinc finger protein	NA	A0A1S6UBD1	Serratia_phage	52.3	4.7e-16
>prophage 398
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5495011	5495734	5864574		Planktothrix_phage(100.0%)	1	NA	NA
AYZ54674.1|5495011_5495734_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.3	9.5e-35
>prophage 399
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5499605	5500118	5864574		Escherichia_phage(100.0%)	1	NA	NA
AYZ54679.1|5499605_5500118_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	31.8	4.5e-15
>prophage 400
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5504028	5511089	5864574		Klosneuvirus(33.33%)	6	NA	NA
AYZ54684.1|5504028_5505069_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	35.0	6.0e-06
AYZ54685.1|5505221_5506598_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	24.8	2.0e-25
AYZ54686.1|5506668_5507385_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYZ54687.1|5507430_5508345_-	L,D-transpeptidase	NA	NA	NA	NA	NA
AYZ54688.1|5508535_5509318_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
AYZ54689.1|5509496_5511089_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	1.1e-59
>prophage 401
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5518731	5521164	5864574		Citrobacter_phage(100.0%)	1	NA	NA
AYZ54695.1|5518731_5521164_-	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	42.0	1.0e-08
>prophage 402
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5525614	5527468	5864574		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
AYZ54700.1|5525614_5527468_+	glutathione ABC transporter ATP-binding protein GsiA	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	22.9	3.6e-09
>prophage 403
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5537303	5539295	5864574		Stx2-converting_phage(50.0%)	2	NA	NA
AYZ54710.1|5537303_5538506_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.2	7.2e-96
AYZ54711.1|5538536_5539295_-	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	27.2	1.6e-11
>prophage 404
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5546858	5558396	5864574		Bacillus_phage(33.33%)	13	NA	NA
AYZ54718.1|5546858_5547122_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	71.8	1.6e-27
AYZ54719.1|5547325_5547616_+	DUF1418 family protein	NA	NA	NA	NA	NA
AYZ54720.1|5547599_5548322_+	nitroreductase NfsA	NA	NA	NA	NA	NA
AYZ54721.1|5548438_5549341_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.5	3.5e-34
AYZ54722.1|5549430_5549910_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
AYZ54723.1|5550258_5551371_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AYZ55218.1|5551473_5552607_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	7.7e-31
AYZ54724.1|5552617_5553571_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AYZ54725.1|5553567_5554413_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AYZ54726.1|5554470_5554959_+	DUF2593 family protein	NA	NA	NA	NA	NA
AYZ54727.1|5555001_5556132_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.4	1.4e-29
AYZ55219.1|5556210_5556927_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.8	3.2e-35
AYZ54728.1|5556923_5558396_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	32.8	4.3e-26
>prophage 405
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5561657	5564494	5864574		Planktothrix_phage(50.0%)	4	NA	NA
AYZ54733.1|5561657_5562386_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	2.7e-29
AYZ54734.1|5562710_5563226_-	lipoprotein	NA	NA	NA	NA	NA
AYZ54735.1|5563343_5563667_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ54736.1|5563663_5564494_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	28.9	2.8e-06
>prophage 406
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5579441	5593049	5864574	protease	Vibrio_phage(42.86%)	9	NA	NA
AYZ54749.1|5579441_5581388_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	39.6	4.2e-37
AYZ54750.1|5581456_5581687_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.4e-16
AYZ54751.1|5582011_5582329_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.4e-13
AYZ54752.1|5582359_5584642_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.6e-165
AYZ54753.1|5585554_5586538_+	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	36.4	9.6e-46
AYZ54754.1|5586534_5589774_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	27.5	2.0e-84
AYZ54755.1|5589791_5591105_+	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
AYZ54756.1|5591101_5592037_+	type I-F CRISPR-associated protein Csy2	NA	NA	NA	NA	NA
AYZ54757.1|5592047_5593049_+	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YYX4	Vibrio_phage	40.2	1.0e-47
>prophage 407
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5596070	5612676	5864574	tRNA	Escherichia_phage(25.0%)	10	NA	NA
AYZ54761.1|5596070_5597792_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.7	2.8e-16
AYZ54762.1|5597792_5599559_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	26.7	9.8e-25
AYZ54763.1|5599673_5600666_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.3	9.6e-62
AYZ54764.1|5601173_5601668_+	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AYZ54765.1|5601803_5605943_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.2	5.0e-88
AYZ54766.1|5606062_5606674_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AYZ54767.1|5606682_5608026_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.3	2.3e-82
AYZ54768.1|5608116_5609409_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.5	6.2e-93
AYZ54769.1|5609609_5612048_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.1	5.2e-218
AYZ54770.1|5612058_5612676_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.6	3.4e-73
>prophage 408
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5619810	5623037	5864574		Tetraselmis_virus(100.0%)	2	NA	NA
AYZ54779.1|5619810_5620551_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	1.0e-20
AYZ54780.1|5620754_5623037_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.9	1.9e-161
>prophage 409
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5627086	5628175	5864574		Streptococcus_phage(100.0%)	1	NA	NA
AYZ54784.1|5627086_5628175_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.4	1.6e-81
>prophage 410
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5633261	5637814	5864574		Bacillus_phage(100.0%)	3	NA	NA
AYZ54788.1|5633261_5633549_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	5.5e-10
AYZ54789.1|5633764_5636029_+	ComEC family protein	NA	NA	NA	NA	NA
AYZ54790.1|5636065_5637814_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.5	5.1e-58
>prophage 411
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5655133	5663499	5864574	tRNA	Enterobacteria_phage(20.0%)	5	NA	NA
AYZ54804.1|5655133_5656213_-	hypothetical protein	NA	Q1MVN1	Enterobacteria_phage	53.8	6.7e-101
AYZ54805.1|5656802_5658203_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.8	8.5e-80
AYZ55222.1|5658515_5659718_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	30.6	3.5e-42
AYZ54806.1|5660045_5662661_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.4	3.7e-20
AYZ54807.1|5662725_5663499_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	2.3e-31
>prophage 412
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5670208	5672116	5864574		Tupanvirus(100.0%)	1	NA	NA
AYZ54814.1|5670208_5672116_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	1.5e-50
>prophage 413
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5684900	5686955	5864574		Bacillus_phage(100.0%)	1	NA	NA
AYZ54825.1|5684900_5686955_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	26.9	2.1e-18
>prophage 414
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5703703	5705851	5864574		Bacillus_phage(100.0%)	1	NA	NA
AYZ54830.1|5703703_5705851_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	24.7	2.2e-23
>prophage 415
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5715306	5715966	5864574	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
AYZ54840.1|5715306_5715966_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	53.9	3.8e-46
>prophage 416
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5723018	5724029	5864574		Enterobacteria_phage(100.0%)	1	NA	NA
AYZ54846.1|5723018_5724029_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.9	3.4e-22
>prophage 417
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5728361	5729249	5864574		Morganella_phage(100.0%)	2	NA	NA
AYZ54850.1|5728361_5728574_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	82.1	4.9e-24
AYZ54851.1|5729021_5729249_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	60.3	3.3e-18
>prophage 418
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5744096	5745479	5864574		Enterobacteria_phage(100.0%)	1	NA	NA
AYZ54868.1|5744096_5745479_+	purine permease	NA	Q9KX94	Enterobacteria_phage	26.4	1.3e-19
>prophage 419
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5758833	5759574	5864574		Planktothrix_phage(100.0%)	1	NA	NA
AYZ54884.1|5758833_5759574_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	1.5e-35
>prophage 420
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5768474	5769377	5864574		Bacillus_phage(100.0%)	1	NA	NA
AYZ54894.1|5768474_5769377_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.9	8.0e-15
>prophage 421
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5772550	5779127	5864574		Serratia_phage(50.0%)	4	NA	NA
AYZ54899.1|5772550_5774848_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	44.2	5.0e-05
AYZ54900.1|5774899_5775220_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
AYZ54901.1|5775240_5776317_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
AYZ54902.1|5776625_5779127_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.4	2.1e-12
>prophage 422
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5791422	5829076	5864574	capsid,portal,integrase,terminase,plate,tail,head	Enterobacteria_phage(45.45%)	50	5791332:5791351	5825477:5825496
5791332:5791351	attL	AAACCCGGAGCAATCCGGGT	NA	NA	NA	NA
AYZ54915.1|5791422_5792430_-|integrase	integrase	integrase	A0A0M4RTQ0	Salmonella_phage	52.1	1.5e-99
AYZ54916.1|5792517_5792820_-	XRE family transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	56.0	1.7e-22
AYZ54917.1|5792915_5793248_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ55226.1|5793439_5793637_+	DUF4761 domain-containing protein	NA	NA	NA	NA	NA
AYZ54918.1|5793653_5794040_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ54919.1|5794055_5794328_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ54920.1|5794396_5794621_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ54921.1|5794617_5795166_+	3'-5' exoribonuclease	NA	NA	NA	NA	NA
AYZ54922.1|5795174_5795402_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	40.6	4.2e-05
AYZ54923.1|5795398_5796352_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	56.3	1.7e-84
AYZ54924.1|5796351_5796558_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	74.6	4.5e-22
AYZ54925.1|5796550_5796778_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ54926.1|5796923_5797472_+	AsnC family protein	NA	NA	NA	NA	NA
AYZ54927.1|5797468_5800075_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	50.7	1.5e-191
AYZ54928.1|5800243_5801218_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ54929.1|5801525_5801945_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ54930.1|5802310_5803363_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.1	2.5e-140
AYZ54931.1|5803362_5805084_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	66.0	2.8e-226
AYZ54932.1|5805243_5806077_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	64.8	1.9e-95
AYZ54933.1|5806101_5807151_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	55.1	1.0e-106
AYZ54934.1|5807198_5808095_+|terminase	terminase	terminase	B9A7B6	Serratia_phage	73.5	1.5e-90
AYZ54935.1|5808197_5808695_+|head	head completion/stabilization protein	head	B9A7B7	Serratia_phage	67.9	1.1e-58
AYZ54936.1|5808694_5808895_+|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	63.1	9.7e-14
AYZ54937.1|5808885_5809167_+	hypothetical protein	NA	B9A7B8	Serratia_phage	55.8	6.3e-19
AYZ54938.1|5809163_5809715_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	41.3	1.3e-28
AYZ54939.1|5809955_5810255_+	peptidase	NA	NA	NA	NA	NA
AYZ54940.1|5810251_5810713_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	47.7	3.3e-33
AYZ54941.1|5810709_5811351_+	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	47.8	3.4e-44
AYZ54942.1|5811350_5811935_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.8	2.8e-61
AYZ54943.1|5811931_5812297_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	58.3	1.4e-29
AYZ54944.1|5812283_5813183_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	60.5	1.7e-89
AYZ54945.1|5813175_5813772_+|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	47.0	3.0e-42
AYZ54946.1|5813778_5815914_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ54947.1|5815923_5816175_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ54948.1|5816253_5817426_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	44.3	6.3e-44
AYZ54949.1|5817522_5818011_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	61.1	6.8e-53
AYZ54950.1|5818025_5820785_-|tail	phage tail tape measure protein	tail	B9A7B3	Serratia_phage	70.6	1.9e-208
AYZ54951.1|5820774_5820951_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	71.4	3.0e-11
AYZ54952.1|5820947_5821247_-|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	74.0	4.1e-32
AYZ54953.1|5821301_5821817_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	64.7	2.2e-57
AYZ54954.1|5821816_5822998_-|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	69.5	1.0e-155
AYZ54955.1|5823150_5824305_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	79.9	3.0e-176
AYZ54956.1|5824349_5824598_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ54957.1|5824613_5824856_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ54958.1|5825002_5825386_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	55.1	6.3e-38
AYZ54959.1|5825604_5825832_-	hypothetical protein	NA	NA	NA	NA	NA
5825477:5825496	attR	AAACCCGGAGCAATCCGGGT	NA	NA	NA	NA
AYZ54960.1|5825852_5826449_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
AYZ54961.1|5826823_5826997_+	stress-induced protein	NA	Q9KX95	Enterobacteria_phage	86.2	1.1e-05
AYZ54962.1|5827237_5828560_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	86.9	1.0e-199
AYZ54963.1|5828581_5829076_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	78.1	3.3e-39
>prophage 423
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5845859	5846924	5864574		Cronobacter_phage(100.0%)	1	NA	NA
AYZ54978.1|5845859_5846924_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	78.1	3.9e-93
>prophage 424
CP033844	Klebsiella oxytoca strain FDAARGOS_500 chromosome, complete genome	5864574	5855183	5855738	5864574		Infectious_spleen_and_kidney_necrosis_virus(100.0%)	1	NA	NA
AYZ54988.1|5855183_5855738_+	O-acetyl-ADP-ribose deacetylase	NA	A0A140G0J9	Infectious_spleen_and_kidney_necrosis_virus	46.5	1.3e-28
