The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033815	Streptococcus pyogenes strain FDAARGOS_514 chromosome, complete genome	1899746	13489	60322	1899746	head,integrase,capsid,protease,terminase,tail,holin,portal	Streptococcus_phage(59.57%)	58	4868:4882	58512:58526
4868:4882	attL	AACTGGTAATATGAA	NA	NA	NA	NA
AYZ08611.1|13489_15322_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	41.0	2.2e-19
AYZ08612.1|15445_15592_-	nucleoside-diphosphate kinase	NA	NA	NA	NA	NA
AYZ08613.1|15655_15787_-	nucleoside diphosphate kinase	NA	NA	NA	NA	NA
AYZ08614.1|16074_16257_-	Paratox	NA	A3F673	Streptococcus_phage	71.7	1.0e-17
AYZ08615.1|16455_16665_-	XRE family transcriptional regulator	NA	A3F668	Streptococcus_phage	100.0	1.2e-30
AYZ08616.1|17105_17357_+	hypothetical protein	NA	A3F666	Streptococcus_phage	96.4	2.8e-42
AYZ08617.1|17620_17860_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ08618.1|17917_18274_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ08619.1|18389_19598_-	CHAP domain-containing protein	NA	Q938J4	Temperate_phage	87.5	2.9e-214
AYZ08620.1|19713_19941_-|holin	phage holin	holin	A7J2B3	Streptococcus_phage	98.7	7.6e-31
AYZ08621.1|19937_20213_-	hypothetical protein	NA	A7J2B2	Streptococcus_phage	100.0	2.6e-41
AYZ08622.1|20222_20840_-	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	88.3	1.1e-76
AYZ08623.1|20842_21274_-	DUF1617 family protein	NA	Q938J8	Temperate_phage	89.5	1.3e-63
AYZ08624.1|21285_23304_-	hyaluronidase	NA	Q938J9	Temperate_phage	71.6	4.4e-170
AYZ10371.1|23313_24381_-	hyaluronoglucosaminidase	NA	A7J2A8	Streptococcus_phage	72.9	7.5e-121
AYZ08625.1|24422_26570_-	peptidase	NA	Q938K1	Temperate_phage	93.7	0.0e+00
AYZ08626.1|26566_27274_-|tail	phage tail protein	tail	Q938K2	Temperate_phage	69.8	2.4e-91
AYZ08627.1|27273_31197_-|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	48.9	4.6e-240
AYZ08628.1|31406_31733_-	hypothetical protein	NA	J7KK85	Streptococcus_phage	75.9	1.3e-39
AYZ08629.1|31785_32397_-|tail	phage tail protein	tail	J7KKC8	Streptococcus_phage	76.2	3.8e-77
AYZ08630.1|32415_32841_-	hypothetical protein	NA	J7KBZ9	Streptococcus_phage	85.1	1.7e-68
AYZ08631.1|32837_33215_-	HK97 gp10 family phage protein	NA	J7KDM3	Streptococcus_phage	75.2	2.5e-47
AYZ08632.1|33211_33550_-|head,tail	head-tail adaptor protein	head,tail	J7KJ42	Streptococcus_phage	80.0	8.1e-45
AYZ08633.1|33546_33849_-	DNA packaging protein, QLRG family	NA	J7KC36	Streptococcus_phage	86.7	1.1e-42
AYZ08634.1|33993_35178_-|capsid	phage major capsid protein	capsid	J7KJ82	Streptococcus_phage	84.5	1.2e-180
AYZ08635.1|35203_35869_-|protease	Clp protease ClpP	protease	M1Q115	Streptococcus_phage	79.0	5.4e-93
AYZ08636.1|35846_37067_-|portal	phage portal protein	portal	J7KDU3	Streptococcus_phage	81.4	1.0e-185
AYZ08637.1|37100_37367_-	hypothetical protein	NA	Q938K9	Temperate_phage	86.4	6.2e-32
AYZ08638.1|37526_39281_-|terminase	terminase large subunit	terminase	J7KKD1	Streptococcus_phage	97.3	0.0e+00
AYZ08639.1|39295_39763_-|terminase	phage terminase small subunit P27 family	terminase	J7KC46	Streptococcus_phage	99.4	3.0e-82
AYZ08640.1|39934_40273_-	HNH endonuclease	NA	J7KH36	Streptococcus_phage	90.7	3.0e-55
AYZ08641.1|40269_40575_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ08642.1|40858_41299_-	ArpU family transcriptional regulator	NA	Q938L8	Temperate_phage	98.6	2.1e-77
AYZ08643.1|41337_41520_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ08644.1|41571_42207_-	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	68.9	2.2e-88
AYZ08645.1|42206_42608_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ08646.1|43197_43482_-	hypothetical protein	NA	A0A097PAV1	Streptococcus_pyogenes_phage	87.2	6.1e-38
AYZ08647.1|43478_43682_-	hypothetical protein	NA	A0A1P8VVP9	Streptococcus_phage	100.0	3.1e-07
AYZ08648.1|43665_43986_-	VRR-NUC domain-containing protein	NA	A0A1P8VVL5	Streptococcus_phage	94.3	7.1e-51
AYZ08649.1|43982_44396_-	hypothetical protein	NA	A0A2H4JHE6	uncultured_Caudovirales_phage	50.0	2.8e-15
AYZ08650.1|46120_46933_-	hypothetical protein	NA	A0A1P8VVM6	Streptococcus_phage	98.9	4.6e-155
AYZ08651.1|46935_47394_-	DUF669 domain-containing protein	NA	A0A1P8VVN0	Streptococcus_phage	99.3	5.0e-82
AYZ08652.1|50122_50437_-	XRE family transcriptional regulator	NA	A0A1P8VVN6	Streptococcus_phage	94.2	2.3e-49
AYZ08653.1|50583_50880_-	hypothetical protein	NA	A0A097PAT8	Streptococcus_pyogenes_phage	100.0	2.1e-49
AYZ08654.1|50957_51143_-	XRE family transcriptional regulator	NA	A0A1X9I6I3	Streptococcus_phage	72.1	3.3e-16
AYZ08655.1|51309_51549_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ08656.1|51699_51909_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ08657.1|51867_52113_-	hypothetical protein	NA	A0A097PAP6	Streptococcus_pyogenes_phage	96.3	4.2e-35
AYZ08658.1|52124_52364_-	XRE family transcriptional regulator	NA	A0A097PBE6	Streptococcus_pyogenes_phage	100.0	4.8e-36
AYZ08659.1|52437_52824_+	hypothetical protein	NA	A0A097PAT1	Streptococcus_pyogenes_phage	100.0	1.2e-65
AYZ08660.1|52812_53019_-	hypothetical protein	NA	A0A097PAQ9	Streptococcus_pyogenes_phage	92.8	1.4e-28
AYZ08661.1|53075_53855_+	hypothetical protein	NA	A0A1S5S7L0	Streptococcus_phage	57.4	6.2e-48
AYZ08662.1|53988_54135_-	hypothetical protein	NA	A0A097PAP2	Streptococcus_pyogenes_phage	92.3	6.6e-20
AYZ08663.1|54506_55295_+	phage repressor protein	NA	A0A1S5SD15	Streptococcus_phage	62.6	2.9e-85
AYZ08664.1|55304_55610_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ08665.1|55729_56818_+|integrase	site-specific integrase	integrase	A0A097PAS9	Streptococcus_pyogenes_phage	99.2	4.7e-203
AYZ08666.1|57180_57801_+	DUF3862 domain-containing protein	NA	NA	NA	NA	NA
AYZ08667.1|58057_60322_-	glycogen/starch/alpha-glucan family phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	43.7	1.2e-11
58512:58526	attR	TTCATATTACCAGTT	NA	NA	NA	NA
>prophage 2
CP033815	Streptococcus pyogenes strain FDAARGOS_514 chromosome, complete genome	1899746	134996	213108	1899746	integrase,capsid,protease,terminase,tail,holin,tRNA,portal	Streptococcus_phage(66.67%)	91	176094:176113	210493:210512
AYZ08733.1|134996_135692_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYZ08734.1|135710_136472_-	DUF3169 family protein	NA	NA	NA	NA	NA
AYZ10373.1|136468_136684_-	transcriptional regulator	NA	NA	NA	NA	NA
AYZ08735.1|137042_139661_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.1	1.8e-62
AYZ08736.1|140047_141103_-	foldase	NA	NA	NA	NA	NA
AYZ08737.1|141165_141873_-	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	27.2	2.0e-08
AYZ08738.1|141938_143135_-	MFS transporter	NA	NA	NA	NA	NA
AYZ08739.1|143510_145316_-	oligoendopeptidase F	NA	NA	NA	NA	NA
AYZ08740.1|145328_146291_-	competence protein CoiA	NA	NA	NA	NA	NA
AYZ08741.1|146587_147304_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
AYZ08742.1|147422_148127_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
AYZ08743.1|148328_149357_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
AYZ08744.1|149363_150584_+	DUF3114 domain-containing protein	NA	NA	NA	NA	NA
AYZ08745.1|150697_151288_-	peptidase S11	NA	NA	NA	NA	NA
AYZ08746.1|151284_151533_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ08747.1|151517_151745_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ08748.1|151911_152517_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	53.2	1.8e-58
AYZ08749.1|152613_153654_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
AYZ08750.1|153724_155968_-	DNA internalization-related competence protein ComEC/Rec2	NA	M1PSD2	Streptococcus_phage	59.2	1.8e-55
AYZ08751.1|155948_156611_-	ComEA family DNA-binding protein	NA	NA	NA	NA	NA
AYZ08752.1|156810_157629_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AYZ10374.1|157668_158445_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
AYZ08753.1|158434_158713_+	GIY-YIG nuclease family protein	NA	W8W2G4	Invertebrate_iridovirus	36.0	1.8e-05
AYZ08754.1|160862_162482_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.5	1.9e-59
AYZ08755.1|162788_164333_-	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	29.1	1.1e-35
AYZ10375.1|164286_164511_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ08756.1|164580_165276_-	TIGR02206 family membrane protein	NA	NA	NA	NA	NA
AYZ08757.1|165379_166747_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
AYZ08758.1|166945_167992_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
AYZ08759.1|168092_168689_-	recombination protein RecR	NA	NA	NA	NA	NA
AYZ08760.1|168735_168927_-	penicillin-binding protein	NA	NA	NA	NA	NA
AYZ08761.1|169487_170267_-	formate-nitrite transporter	NA	NA	NA	NA	NA
AYZ08762.1|170390_170933_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ08763.1|171093_171615_-	transcription repressor NadR	NA	NA	NA	NA	NA
AYZ08764.1|171721_172417_-	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
AYZ08765.1|172655_173591_+	dihydroorotate oxidase	NA	A0A1V0SH91	Hokovirus	45.1	1.0e-65
AYZ08766.1|173890_175753_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	33.8	2.7e-89
176094:176113	attL	AATTATTTAACAGCGTCTTT	NA	NA	NA	NA
AYZ08767.1|176282_176465_-	Paratox	NA	A3F673	Streptococcus_phage	81.7	4.4e-21
AYZ08768.1|176531_177326_-	mitogenic factor	NA	A7J2B8	Streptococcus_phage	35.6	8.9e-26
AYZ08769.1|177570_178785_-|holin	holin	holin	A0A1P8VVM5	Streptococcus_phage	60.5	9.7e-165
AYZ08770.1|178896_179352_-|holin	holin	holin	A0A0M4R3G6	Streptococcus_phage	81.5	3.0e-63
AYZ08771.1|179362_179977_-	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	79.4	1.8e-66
AYZ08772.1|179979_180411_-	DUF1617 family protein	NA	A3F661	Streptococcus_phage	91.4	3.1e-65
AYZ08773.1|180419_182201_-	hypothetical protein	NA	Q938J9	Temperate_phage	41.7	4.4e-73
AYZ08774.1|182215_183325_-	hyaluronoglucosaminidase	NA	A7J2A8	Streptococcus_phage	65.9	1.2e-113
AYZ08775.1|183324_185283_-	peptidase	NA	M1PKG3	Streptococcus_phage	48.7	3.4e-95
AYZ08776.1|185279_185975_-	hypothetical protein	NA	A0A1B1P761	Bacillus_phage	32.2	4.7e-07
AYZ08777.1|185971_188335_-	hypothetical protein	NA	M1NRG5	Streptococcus_phage	50.1	3.6e-131
AYZ08778.1|188334_188706_-	hypothetical protein	NA	M1PL84	Streptococcus_phage	62.4	1.7e-35
AYZ08779.1|188720_188984_-	hypothetical protein	NA	A0A0B5A2F3	Streptococcus_phage	55.8	1.0e-18
AYZ08780.1|188994_189588_-|tail	phage tail protein	tail	M1PKG8	Streptococcus_phage	62.5	1.1e-60
AYZ08781.1|189600_189936_-	hypothetical protein	NA	A0A1P8BMR5	Lactococcus_phage	64.9	9.8e-35
AYZ08782.1|189936_190173_-	hypothetical protein	NA	A0A1P8BMT2	Lactococcus_phage	66.7	2.5e-21
AYZ08783.1|190165_190504_-	hypothetical protein	NA	A0A0B5A086	Streptococcus_phage	75.0	8.1e-45
AYZ08784.1|190463_190886_-	hypothetical protein	NA	A0A0B5A2F6	Streptococcus_phage	67.2	8.2e-47
AYZ08785.1|190895_191096_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ08786.1|191095_192007_-|capsid	phage major capsid protein	capsid	M1PFL0	Streptococcus_phage	67.0	2.9e-113
AYZ08787.1|192031_192493_-	DUF4355 domain-containing protein	NA	M1Q1L0	Streptococcus_phage	52.6	1.7e-37
AYZ08788.1|192573_193989_-|terminase	terminase	terminase	A0A0B5A091	Streptococcus_phage	74.0	1.5e-212
AYZ08789.1|194070_194286_-	hypothetical protein	NA	M1IRA5	Streptococcus_phage	72.4	4.1e-26
AYZ08790.1|194287_194554_-	hypothetical protein	NA	Q938K9	Temperate_phage	95.5	6.4e-37
AYZ08791.1|194775_195000_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ08792.1|195005_196499_-	hypothetical protein	NA	M1Q184	Streptococcus_phage	55.0	2.0e-87
AYZ08793.1|196491_197760_-|portal	phage portal protein	portal	M1PFL4	Streptococcus_phage	75.6	2.2e-188
AYZ08794.1|197756_198113_-	hypothetical protein	NA	M1PRL3	Streptococcus_phage	57.8	2.4e-07
AYZ08795.1|198260_198605_-	HNH endonuclease	NA	M1Q0W7	Streptococcus_phage	69.4	3.2e-41
AYZ08796.1|198712_199132_-	DUF1492 domain-containing protein	NA	A0A1X9I5B5	Streptococcus_phage	79.1	1.9e-56
AYZ08797.1|199207_199459_-	hypothetical protein	NA	M1PF60	Streptococcus_phage	59.0	1.6e-18
AYZ08798.1|199607_199925_-	DUF1372 family protein	NA	A1EAD7	Streptococcus_phage	71.4	9.0e-30
AYZ08799.1|199960_200473_-	hypothetical protein	NA	M1PFM2	Streptococcus_phage	85.9	1.7e-78
AYZ08800.1|200469_200802_-	hypothetical protein	NA	M1NS23	Streptococcus_phage	66.1	5.7e-35
AYZ08801.1|200812_202159_-	hypothetical protein	NA	A8ATM0	Listeria_phage	49.4	1.0e-122
AYZ08802.1|202155_202551_-	hypothetical protein	NA	A8ATL9	Listeria_phage	52.3	1.4e-19
AYZ08803.1|202915_203713_-	hypothetical protein	NA	J7KGZ1	Streptococcus_phage	83.8	1.3e-130
AYZ08804.1|203705_203906_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ08805.1|203902_204829_-	recombinase RecT	NA	M1NRN6	Streptococcus_phage	71.8	1.2e-90
AYZ08806.1|205217_205424_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ08807.1|205432_205573_-	hypothetical protein	NA	A0A1X9I6Y1	Streptococcus_phage	54.5	3.4e-05
AYZ08808.1|205569_205803_-	hypothetical protein	NA	Q938N1	Temperate_phage	96.1	2.8e-36
AYZ08809.1|205783_206170_-	DnaD domain protein	NA	Q938N2	Temperate_phage	51.9	8.1e-25
AYZ08810.1|206310_206565_-	transcriptional regulator	NA	A0A1S5S9Z1	Streptococcus_phage	41.3	7.7e-08
AYZ08811.1|206673_206859_-	hypothetical protein	NA	Q938N3	Temperate_phage	83.6	1.3e-20
AYZ08812.1|206860_207172_-	excisionase	NA	A0A1S5SA25	Streptococcus_phage	77.7	5.3e-43
AYZ08813.1|207441_207654_-	XRE family transcriptional regulator	NA	A0A1X9I583	Streptococcus_phage	56.7	1.1e-10
AYZ08814.1|207854_208610_+	XRE family transcriptional regulator	NA	A0A1S5S8S8	Streptococcus_phage	60.8	2.8e-77
AYZ08815.1|208621_209140_+	restriction endonuclease	NA	E8ZDN5	Streptococcus_phage	45.9	9.2e-32
AYZ08816.1|209263_210406_+|integrase	site-specific integrase	integrase	M1NRJ9	Streptococcus_phage	77.4	2.4e-173
AYZ08817.1|210494_210770_-	DNA-binding protein HU	NA	A7KV42	Bacillus_phage	73.0	2.6e-25
210493:210512	attR	AATTATTTAACAGCGTCTTT	NA	NA	NA	NA
AYZ08818.1|210868_211456_-	DUF2140 family protein	NA	NA	NA	NA	NA
AYZ08819.1|211433_212294_-	GDSL family lipase	NA	NA	NA	NA	NA
AYZ10376.1|212268_213108_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.7	1.2e-12
>prophage 3
CP033815	Streptococcus pyogenes strain FDAARGOS_514 chromosome, complete genome	1899746	230019	389787	1899746	head,integrase,capsid,terminase,tail,holin,tRNA,portal	Temperate_phage(43.22%)	182	377621:377636	392247:392262
AYZ08836.1|230019_232821_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	26.5	1.6e-77
AYZ08837.1|233093_233852_-	DivIVA domain-containing protein	NA	NA	NA	NA	NA
AYZ08838.1|233861_234653_-	RNA-binding protein	NA	NA	NA	NA	NA
AYZ08839.1|234652_234907_-	YggT family protein	NA	NA	NA	NA	NA
AYZ08840.1|234911_235568_-	cell division protein SepF	NA	NA	NA	NA	NA
AYZ08841.1|235579_236251_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AYZ08842.1|236253_237573_-	cell division protein FtsZ	NA	NA	NA	NA	NA
AYZ08843.1|237596_238961_-	cell division protein FtsA	NA	NA	NA	NA	NA
AYZ08844.1|239171_240320_-	cell division protein FtsQ/DivIB	NA	NA	NA	NA	NA
AYZ08845.1|240320_241403_-	UDP-N-acetylglucosamine--N-acetylmuramyl- (pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase	NA	NA	NA	NA	NA
AYZ08846.1|241402_242761_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
AYZ08847.1|243116_243368_-	DUF3165 family protein	NA	NA	NA	NA	NA
AYZ08848.1|243489_245331_-	translational GTPase TypA	NA	E4ZFJ7	Streptococcus_phage	31.4	2.0e-20
AYZ08849.1|245513_245903_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AYZ08850.1|245912_246884_-	ROK family glucokinase	NA	NA	NA	NA	NA
AYZ08851.1|246888_247092_-	DUF910 family protein	NA	NA	NA	NA	NA
AYZ08852.1|247233_247761_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
AYZ08853.1|247988_248615_+	prepilin peptidase	NA	NA	NA	NA	NA
AYZ08854.1|248696_249776_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
AYZ08855.1|249779_250424_-	DUF1027 domain-containing protein	NA	NA	NA	NA	NA
AYZ08856.1|250847_251825_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.9	6.2e-21
AYZ08857.1|252238_253276_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
AYZ08858.1|253262_253754_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	33.8	2.0e-15
AYZ08859.1|253743_254283_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
AYZ08860.1|254405_255398_-	asparagine synthetase A	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	38.5	2.4e-52
AYZ08861.1|255710_256661_-	carbamate kinase	NA	NA	NA	NA	NA
AYZ08862.1|256680_258012_-	Sapep family Mn(2+)-dependent dipeptidase	NA	NA	NA	NA	NA
AYZ08863.1|258028_259522_-	YfcC family protein	NA	NA	NA	NA	NA
AYZ08864.1|259691_260705_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AYZ08865.1|260744_261173_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYZ08866.1|261272_262508_-	arginine deiminase	NA	NA	NA	NA	NA
AYZ08867.1|262782_263463_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AYZ08868.1|263604_264078_+	arginine regulator	NA	NA	NA	NA	NA
AYZ08869.1|264244_264961_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ08870.1|264974_266054_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
AYZ08871.1|266126_267860_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.7	1.3e-26
AYZ08872.1|267856_268597_-	response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	32.4	8.0e-05
AYZ08873.1|268841_269024_-	Paratox	NA	A3F673	Streptococcus_phage	76.7	2.6e-18
AYZ08874.1|269088_269376_-	hypothetical protein	NA	Q938I9	Temperate_phage	100.0	2.4e-29
AYZ08875.1|269369_269945_-	phospholipase	NA	Q938J0	Temperate_phage	100.0	1.7e-111
AYZ08876.1|270421_271201_-	pyrogenic exotoxin SpeK	NA	Q938J1	Temperate_phage	100.0	5.4e-145
AYZ08877.1|271504_272371_-	DUF334 domain-containing protein	NA	Q938J2	Temperate_phage	100.0	3.7e-134
AYZ08878.1|272358_272883_-	DUF4065 domain-containing protein	NA	Q938J3	Temperate_phage	100.0	4.0e-99
AYZ08879.1|274334_274520_-	hypothetical protein	NA	Q938J5	Temperate_phage	100.0	1.7e-25
AYZ08880.1|274516_274813_-	hypothetical protein	NA	Q938J6	Temperate_phage	100.0	7.5e-47
AYZ08881.1|274823_275435_-	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	100.0	2.7e-91
AYZ08882.1|275437_275869_-	DUF1617 family protein	NA	Q938J8	Temperate_phage	100.0	1.1e-73
AYZ08883.1|275880_277764_-	hyaluronidase	NA	Q938J9	Temperate_phage	100.0	2.8e-256
AYZ08884.1|277778_278792_-	hyaluronoglucosaminidase	NA	Q938K0	Temperate_phage	100.0	1.2e-184
AYZ08885.1|278788_280933_-	peptidase	NA	Q938K1	Temperate_phage	100.0	0.0e+00
AYZ08886.1|280929_281646_-|tail	phage tail protein	tail	Q938K2	Temperate_phage	100.0	2.9e-137
AYZ08887.1|281642_284903_-	tape measure domain-containing protein	NA	Q938K3	Temperate_phage	99.9	0.0e+00
AYZ08888.1|284892_285474_-	hypothetical protein	NA	Q938K4	Temperate_phage	100.0	1.3e-106
AYZ08889.1|285477_285912_-	hypothetical protein	NA	Q938K5	Temperate_phage	100.0	2.6e-72
AYZ08890.1|285950_286436_-|tail	phage tail protein	tail	Q938K6	Temperate_phage	100.0	1.6e-86
AYZ08891.1|286435_286834_-|capsid	capsid protein	capsid	Q79S87	Temperate_phage	100.0	3.5e-71
AYZ08892.1|286830_287187_-|capsid	capsid protein	capsid	Q79S88	Temperate_phage	100.0	4.5e-62
AYZ08893.1|287186_287519_-|capsid	minor capsid protein	capsid	Q79S86	Temperate_phage	100.0	9.6e-59
AYZ08894.1|287508_287925_-	hypothetical protein	NA	Q938K7	Temperate_phage	100.0	1.1e-56
AYZ08895.1|287978_288797_-|capsid	N4-gp56 family major capsid protein	capsid	Q79S85	Temperate_phage	100.0	4.0e-146
AYZ08896.1|288800_289415_-	hypothetical protein	NA	Q938K8	Temperate_phage	100.0	1.3e-96
AYZ08897.1|289540_289807_-	hypothetical protein	NA	Q938K9	Temperate_phage	100.0	1.5e-38
AYZ08898.1|289868_290108_-	hypothetical protein	NA	Q938L0	Temperate_phage	100.0	2.8e-36
AYZ08899.1|290079_291558_-|capsid	capsid protein	capsid	Q938L1	Temperate_phage	100.0	8.2e-275
AYZ08900.1|291562_293065_-|portal	phage portal protein	portal	Q938L2	Temperate_phage	100.0	5.4e-282
AYZ08901.1|293078_294290_-|terminase	PBSX family phage terminase large subunit	terminase	Q938L3	Temperate_phage	99.7	3.7e-225
AYZ08902.1|294372_294846_-	hypothetical protein	NA	Q938L4	Temperate_phage	99.4	4.3e-76
AYZ08903.1|294896_295274_-	ASCH domain-containing protein	NA	Q938L5	Temperate_phage	100.0	1.7e-67
AYZ08904.1|295334_295766_-	N-acetyltransferase	NA	B5SP24	Lactococcus_phage	56.9	3.0e-36
AYZ08905.1|295726_296404_-	hypothetical protein	NA	Q938L6	Temperate_phage	100.0	8.7e-131
AYZ08906.1|296382_296901_-	chromosome partitioning protein ParB	NA	Q938L7	Temperate_phage	100.0	1.5e-90
AYZ08907.1|296977_297163_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ08908.1|297137_297401_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ08909.1|297510_297732_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ08910.1|297877_298318_-	ArpU family transcriptional regulator	NA	Q938L8	Temperate_phage	100.0	5.0e-79
AYZ08911.1|298758_299265_-	DUF1642 domain-containing protein	NA	Q938L9	Temperate_phage	100.0	9.8e-95
AYZ08912.1|299428_299833_-	hypothetical protein	NA	Q938M1	Temperate_phage	100.0	6.0e-71
AYZ08913.1|299842_300112_-	hypothetical protein	NA	Q938M2	Temperate_phage	100.0	4.0e-47
AYZ08914.1|300108_300393_-	DUF3310 domain-containing protein	NA	Q938M3	Temperate_phage	100.0	5.4e-50
AYZ08915.1|300386_300638_-	hypothetical protein	NA	Q938M4	Temperate_phage	100.0	6.8e-41
AYZ08916.1|300634_300991_-	hypothetical protein	NA	A0A1P8VVP9	Streptococcus_phage	85.6	1.6e-51
AYZ08917.1|300987_301428_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A097PAS0	Streptococcus_pyogenes_phage	97.3	8.5e-79
AYZ08918.1|301427_301631_-	hypothetical protein	NA	Q938M6	Temperate_phage	100.0	4.7e-32
AYZ08919.1|301636_302056_-	single-stranded DNA-binding protein	NA	Q938M7	Temperate_phage	100.0	1.6e-71
AYZ08920.1|302048_302723_-	single-stranded DNA-binding protein	NA	Q938M8	Temperate_phage	100.0	2.5e-106
AYZ08921.1|302723_303206_-	siphovirus Gp157 family protein	NA	Q938M9	Temperate_phage	100.0	8.2e-51
AYZ08922.1|303227_303482_-	hypothetical protein	NA	Q938N0	Temperate_phage	100.0	7.4e-43
AYZ08923.1|303492_303633_-	hypothetical protein	NA	A0A1X9I6Y1	Streptococcus_phage	52.3	7.5e-05
AYZ08924.1|303844_304234_-	DnaD domain protein	NA	Q938N2	Temperate_phage	99.2	1.1e-58
AYZ08925.1|304379_304637_-	transcriptional regulator	NA	A0A1S5SFN6	Streptococcus_phage	46.4	1.2e-11
AYZ08926.1|304730_304916_-	hypothetical protein	NA	Q938N3	Temperate_phage	100.0	1.1e-24
AYZ08927.1|304944_305202_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ08928.1|305308_305521_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ08929.1|305447_305702_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ08930.1|305690_305891_+	KTSC domain-containing protein	NA	A0A1S5S8T9	Streptococcus_phage	72.3	6.3e-21
AYZ08931.1|306069_306798_-	oxidoreductase	NA	Q938N5	Temperate_phage	100.0	6.9e-134
AYZ08932.1|306808_307000_-	hypothetical protein	NA	A7J270	Streptococcus_phage	90.5	1.2e-24
AYZ08933.1|307795_308155_+	XRE family transcriptional regulator	NA	Q938N6	Temperate_phage	100.0	1.1e-60
AYZ08934.1|308168_308549_+	ImmA/IrrE family metallo-endopeptidase	NA	Q938N7	Temperate_phage	100.0	5.3e-69
AYZ08935.1|308559_309081_+	hypothetical protein	NA	Q938N8	Temperate_phage	100.0	2.3e-67
AYZ08936.1|309199_310354_+|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	100.0	2.8e-206
AYZ08937.1|310464_311571_-	peptide-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
AYZ08938.1|311613_312237_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
AYZ08939.1|312249_312960_-	cytochrome c biogenesis protein CcdA	NA	NA	NA	NA	NA
AYZ08940.1|313180_314113_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
AYZ08941.1|314204_315164_-	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AYZ08942.1|315751_315943_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ08943.1|316173_316953_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ08944.1|317168_319817_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.1	7.3e-149
AYZ08945.1|320330_320501_-	N-acetyltransferase	NA	NA	NA	NA	NA
AYZ08946.1|320934_321330_-	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
AYZ08947.1|321350_321605_-	DUF1912 family protein	NA	NA	NA	NA	NA
AYZ08948.1|322083_322836_+	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
AYZ08949.1|322891_323965_+	3-dehydroquinate synthase	NA	A9YVT7	Ostreococcus_tauri_virus	32.5	1.2e-30
AYZ08950.1|324400_324706_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AYZ08951.1|324707_325046_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AYZ08952.1|325098_325854_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYZ08953.1|326106_326985_-	shikimate dehydrogenase (NADP+)	NA	NA	NA	NA	NA
AYZ08954.1|327122_330629_-	glycoside hydrolase family 2 protein	NA	NA	NA	NA	NA
AYZ08955.1|330558_332043_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AYZ08956.1|332042_333767_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	24.4	1.7e-13
AYZ08957.1|333756_334362_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
AYZ08958.1|334667_336113_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
AYZ08959.1|336193_337120_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
AYZ08960.1|337129_338080_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AYZ08961.1|338230_339154_+	ROK family protein	NA	NA	NA	NA	NA
AYZ08962.1|339764_341207_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
AYZ08963.1|341230_342925_-	hyaluronidase	NA	NA	NA	NA	NA
AYZ08964.1|342975_344016_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYZ08965.1|344121_345435_+	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
AYZ08966.1|345449_348155_+	alpha-mannosidase	NA	NA	NA	NA	NA
AYZ08967.1|348359_349610_-	sensor histidine kinase	NA	NA	NA	NA	NA
AYZ08968.1|350274_351630_-	RNA methyltransferase	NA	A0A2K5B251	Erysipelothrix_phage	33.0	1.1e-73
AYZ08969.1|351818_352001_-	Paratox	NA	J7KBZ4	Streptococcus_phage	81.4	1.1e-19
AYZ08970.1|352220_352976_+	exotoxin type A	NA	A0A097PAT7	Streptococcus_pyogenes_phage	99.6	2.2e-143
AYZ08971.1|353097_353757_-	hypothetical protein	NA	A0A097PBF7	Streptococcus_pyogenes_phage	100.0	8.5e-123
AYZ08972.1|353756_353978_-	hypothetical protein	NA	A0A097PAX7	Streptococcus_pyogenes_phage	84.5	2.5e-18
AYZ08973.1|353987_354761_-	hypothetical protein	NA	A0A097PAV0	Streptococcus_pyogenes_phage	100.0	3.9e-135
AYZ08974.1|354771_355374_-	hypothetical protein	NA	A0A097PAX9	Streptococcus_pyogenes_phage	98.8	7.8e-91
AYZ08975.1|355385_356150_-	CHAP domain-containing protein	NA	A0A097PAT3	Streptococcus_pyogenes_phage	100.0	1.5e-150
AYZ08976.1|356151_356484_-|holin	phage holin	holin	A0A097PBF6	Streptococcus_pyogenes_phage	100.0	5.7e-51
AYZ08977.1|356955_357303_-	DUF1366 domain-containing protein	NA	A0A097PAX5	Streptococcus_pyogenes_phage	100.0	3.5e-59
AYZ08978.1|357313_359176_-	hypothetical protein	NA	A0A097PAT0	Streptococcus_pyogenes_phage	99.7	0.0e+00
AYZ08979.1|359180_362621_-	CHAP domain-containing protein	NA	A0A097PBF5	Streptococcus_pyogenes_phage	99.9	0.0e+00
AYZ08980.1|362621_364106_-|tail	phage tail protein	tail	A0A097PAW9	Streptococcus_pyogenes_phage	99.8	4.3e-292
AYZ08981.1|364106_365912_-|tail	phage tail protein	tail	A0A097PAU2	Streptococcus_pyogenes_phage	99.7	8.8e-263
AYZ08982.1|365904_366363_-	hypothetical protein	NA	A0A097PAX1	Streptococcus_pyogenes_phage	100.0	2.3e-82
AYZ08983.1|366335_366653_-	hypothetical protein	NA	A0A097PAS6	Streptococcus_pyogenes_phage	100.0	4.9e-52
AYZ08984.1|366665_367172_-|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	100.0	2.6e-79
AYZ08985.1|367183_367594_-	DUF5072 domain-containing protein	NA	A0A097PAW5	Streptococcus_pyogenes_phage	100.0	1.4e-70
AYZ08986.1|367595_367991_-	hypothetical protein	NA	A0A097PAT9	Streptococcus_pyogenes_phage	100.0	1.8e-59
AYZ08987.1|367987_368299_-	hypothetical protein	NA	A0A097PAW7	Streptococcus_pyogenes_phage	99.0	2.6e-50
AYZ08988.1|368295_368640_-	hypothetical protein	NA	A0A097PAS2	Streptococcus_pyogenes_phage	100.0	1.1e-54
AYZ08989.1|368653_368947_-	hypothetical protein	NA	A0A097PBF3	Streptococcus_pyogenes_phage	100.0	2.0e-47
AYZ08990.1|368959_369850_-|capsid	phage capsid protein	capsid	A0A097PAW2	Streptococcus_pyogenes_phage	99.4	8.6e-86
AYZ08991.1|369867_370440_-	DUF4355 domain-containing protein	NA	A0A097PAW3	Streptococcus_pyogenes_phage	100.0	1.2e-72
AYZ08992.1|370589_370856_-	hypothetical protein	NA	A0A097PAR8	Streptococcus_pyogenes_phage	100.0	2.6e-38
AYZ08993.1|370862_371771_-|head	phage head morphogenesis protein	head	A0A097PBF2	Streptococcus_pyogenes_phage	100.0	4.2e-88
AYZ08994.1|371739_373065_-|portal	phage portal protein	portal	A0A097PAT2	Streptococcus_pyogenes_phage	99.5	1.8e-241
AYZ08995.1|374328_374709_-	hypothetical protein	NA	A0A097PAR5	Streptococcus_pyogenes_phage	100.0	1.0e-64
AYZ08996.1|375318_375753_-	ArpU family transcriptional regulator	NA	J7KDQ1	Streptococcus_phage	94.4	2.2e-71
AYZ08997.1|376203_376707_-	DUF1642 domain-containing protein	NA	A0A097PAV5	Streptococcus_pyogenes_phage	97.6	8.5e-91
AYZ08998.1|376993_377179_-	hypothetical protein	NA	A0A097PBF0	Streptococcus_pyogenes_phage	100.0	7.0e-27
AYZ08999.1|377344_377680_-	hypothetical protein	NA	A0A097PAS4	Streptococcus_pyogenes_phage	100.0	4.7e-45
377621:377636	attL	AAATCCCATTATAAAA	NA	NA	NA	NA
AYZ10377.1|377682_377967_-	hypothetical protein	NA	A0A097PAV1	Streptococcus_pyogenes_phage	91.5	5.0e-40
AYZ09000.1|378130_378544_-	hypothetical protein	NA	Q938M1	Temperate_phage	63.1	1.2e-34
AYZ09001.1|378540_378825_-	DUF3310 domain-containing protein	NA	A0A1P8VVP5	Streptococcus_phage	97.9	2.7e-49
AYZ09002.1|378818_379070_-	hypothetical protein	NA	A0A1P8VVV4	Streptococcus_phage	92.8	3.4e-40
AYZ09003.1|379066_379423_-	hypothetical protein	NA	A0A097PAU4	Streptococcus_pyogenes_phage	94.9	1.8e-58
AYZ09004.1|379406_379727_-	VRR-NUC domain-containing protein	NA	A0A1P8VVL5	Streptococcus_phage	99.1	5.8e-53
AYZ09005.1|381441_382254_-	hypothetical protein	NA	A0A1P8VVM6	Streptococcus_phage	98.9	4.6e-155
AYZ09006.1|382256_382715_-	DUF669 domain-containing protein	NA	A0A1P8VVN0	Streptococcus_phage	99.3	5.0e-82
AYZ09007.1|382730_383960_-	DEAD/DEAH box helicase	NA	A0A1P8VVM2	Streptococcus_phage	99.5	2.8e-236
AYZ09008.1|384061_384742_-	AAA family ATPase	NA	A0A1P8VVS4	Streptococcus_phage	100.0	1.6e-129
AYZ09009.1|384742_385225_-	siphovirus Gp157 family protein	NA	A0A1P8VVS5	Streptococcus_phage	99.4	4.6e-78
AYZ09010.1|385453_385768_-	XRE family transcriptional regulator	NA	A0A1P8VVN6	Streptococcus_phage	94.2	2.3e-49
AYZ09011.1|385951_386203_-	hypothetical protein	NA	A0A1P8VVV6	Streptococcus_phage	98.8	1.4e-41
AYZ09012.1|386297_386516_-	XRE family transcriptional regulator	NA	A0A1P8VVR5	Streptococcus_phage	100.0	4.1e-34
AYZ09013.1|386704_387064_+	XRE family transcriptional regulator	NA	A0A1P8VVN3	Streptococcus_phage	97.5	2.0e-57
AYZ09014.1|387047_387425_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1P8VVK5	Streptococcus_phage	99.2	5.8e-68
AYZ10378.1|387856_388447_+	hypothetical protein	NA	A0A1P8VVT3	Streptococcus_phage	99.0	2.7e-104
AYZ09015.1|388620_389787_+|integrase	site-specific integrase	integrase	C5J953	Streptococcus_phage	42.2	7.0e-80
392247:392262	attR	TTTTATAATGGGATTT	NA	NA	NA	NA
>prophage 4
CP033815	Streptococcus pyogenes strain FDAARGOS_514 chromosome, complete genome	1899746	411707	491502	1899746	head,integrase,capsid,terminase,tail,holin,tRNA,portal	Streptococcus_phage(68.42%)	79	438060:438075	494224:494239
AYZ09031.1|411707_412643_-|tRNA	methionyl-tRNA formyltransferase	tRNA	M4QRX9	Synechococcus_phage	38.5	6.0e-05
AYZ09032.1|412704_415089_-	primosomal protein N'	NA	NA	NA	NA	NA
AYZ09033.1|415153_415471_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
AYZ09034.1|415486_416122_-	guanylate kinase	NA	S4VT50	Pandoravirus	45.3	4.9e-11
AYZ09035.1|416231_417839_-	ribonuclease Y	NA	NA	NA	NA	NA
AYZ09036.1|417968_418865_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	22.3	1.9e-08
AYZ09037.1|419063_420251_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
AYZ09038.1|420926_421586_+	3-oxoacid CoA-transferase subunit B	NA	NA	NA	NA	NA
AYZ09039.1|422468_423800_+	GntP family permease	NA	NA	NA	NA	NA
AYZ09040.1|423873_424356_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
AYZ09041.1|424500_425970_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ09042.1|425983_427138_-	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
AYZ09043.1|427582_427909_-	cell division regulator GpsB	NA	NA	NA	NA	NA
AYZ09044.1|428027_428543_-	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
AYZ09045.1|428623_429232_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	33.9	3.2e-23
AYZ09046.1|429218_431384_+	penicillin-binding protein	NA	NA	NA	NA	NA
AYZ09047.1|431850_433188_-	aminopeptidase C	NA	R4TV59	Phaeocystis_globosa_virus	37.0	1.4e-68
AYZ09048.1|433372_434197_-	NAD(+) synthetase	NA	G3MA24	Bacillus_virus	57.1	1.5e-71
AYZ09049.1|434193_435654_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	42.0	1.1e-98
AYZ09050.1|435823_437203_-	amino acid permease	NA	NA	NA	NA	NA
AYZ09051.1|437371_438289_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.2	1.6e-90
438060:438075	attL	CCATAAATGTTTTCAA	NA	NA	NA	NA
AYZ09052.1|438352_438577_-	DUF4059 family protein	NA	NA	NA	NA	NA
AYZ09053.1|438680_439424_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.2	1.0e-28
AYZ09054.1|439423_440227_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AYZ09055.1|440421_441765_-	DEAD/DEAH box helicase	NA	A0A1V0SBR7	Catovirus	28.1	3.9e-42
AYZ09056.1|441922_442933_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
AYZ09057.1|442934_445190_-	penicillin-binding protein	NA	NA	NA	NA	NA
AYZ10379.1|445193_445517_-	cell division protein FtsL	NA	NA	NA	NA	NA
AYZ09058.1|445521_446535_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
AYZ09059.1|447005_448256_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	55.6	2.2e-116
AYZ09060.1|448248_449070_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	36.8	4.7e-38
AYZ09061.1|449259_449442_-	Paratox	NA	A3F673	Streptococcus_phage	83.3	1.5e-21
AYZ09062.1|449674_450661_+	deoxyribonuclease	NA	A7J2B8	Streptococcus_phage	100.0	1.4e-169
AYZ09063.1|450774_451398_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ09064.1|451611_452814_-	CHAP domain-containing protein	NA	Q938J4	Temperate_phage	98.2	6.5e-238
AYZ09065.1|452929_453157_-|holin	phage holin	holin	A7J2B3	Streptococcus_phage	100.0	2.0e-31
AYZ09066.1|453153_453426_-	hypothetical protein	NA	A7J2B2	Streptococcus_phage	91.0	7.2e-36
AYZ09067.1|453435_454053_-	DUF1366 domain-containing protein	NA	Q938J7	Temperate_phage	89.3	5.0e-77
AYZ09068.1|454049_454487_-	DUF1617 family protein	NA	Q938J8	Temperate_phage	98.6	9.1e-73
AYZ09069.1|454498_456514_-	hyaluronidase	NA	Q938J9	Temperate_phage	73.4	3.3e-186
AYZ09070.1|457526_459506_-	peptidase	NA	A7J2A7	Streptococcus_phage	92.5	0.0e+00
AYZ09071.1|459515_460358_-|tail	phage tail protein	tail	A7J2A6	Streptococcus_phage	97.9	8.8e-157
AYZ09072.1|460369_464752_-|tail	phage tail protein	tail	A7J2A5	Streptococcus_phage	75.9	3.3e-223
AYZ09073.1|464766_465000_-	hypothetical protein	NA	A7J2A4	Streptococcus_phage	97.4	6.4e-33
AYZ09074.1|465074_465530_-	hypothetical protein	NA	A7J2A3	Streptococcus_phage	98.0	3.5e-75
AYZ09075.1|465583_466183_-|tail	phage major tail protein, TP901-1 family	tail	A7J2A2	Streptococcus_phage	97.1	1.7e-90
AYZ09076.1|466194_466554_-	hypothetical protein	NA	A7J2A1	Streptococcus_phage	98.3	1.2e-57
AYZ09077.1|466557_466902_-	HK97 gp10 family phage protein	NA	A7J2A0	Streptococcus_phage	98.2	5.1e-55
AYZ09078.1|466898_467177_-	hypothetical protein	NA	A7J299	Streptococcus_phage	100.0	1.9e-47
AYZ09079.1|467187_467544_-	hypothetical protein	NA	A7J298	Streptococcus_phage	100.0	4.6e-59
AYZ09080.1|467555_468443_-|capsid	phage capsid protein	capsid	A7J297	Streptococcus_phage	100.0	2.1e-161
AYZ09081.1|468455_469025_-	DUF4355 domain-containing protein	NA	A7J296	Streptococcus_phage	98.9	1.1e-81
AYZ09082.1|469192_469459_-	hypothetical protein	NA	Q938K9	Temperate_phage	95.5	1.1e-36
AYZ09083.1|469463_469652_-	hypothetical protein	NA	A7J294	Streptococcus_phage	100.0	7.4e-24
AYZ09084.1|469679_471128_-|head	phage head morphogenesis protein	head	A7J293	Streptococcus_phage	99.6	1.3e-277
AYZ09085.1|471087_472620_-|portal	phage portal protein	portal	A7J292	Streptococcus_phage	99.6	9.9e-292
AYZ09086.1|472635_473913_-|terminase	PBSX family phage terminase large subunit	terminase	A7J291	Streptococcus_phage	100.0	1.1e-246
AYZ10380.1|473902_474355_-|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	100.0	6.9e-76
AYZ09087.1|474444_474861_-	transcriptional regulator	NA	A7J289	Streptococcus_phage	99.3	3.3e-72
AYZ09088.1|474993_475266_-	hypothetical protein	NA	A7J287	Streptococcus_phage	73.3	5.7e-25
AYZ09089.1|475429_476752_-	DEAD/DEAH box helicase	NA	A7J284	Streptococcus_phage	97.0	1.4e-249
AYZ09090.1|476748_477024_-	VRR-NUC domain-containing protein	NA	A7J283	Streptococcus_phage	96.7	2.9e-45
AYZ09091.1|477389_479774_-	DNA primase	NA	A7J282	Streptococcus_phage	98.0	5.7e-286
AYZ09092.1|479778_481701_-	DNA polymerase	NA	A7J280	Streptococcus_phage	98.3	0.0e+00
AYZ09093.1|481743_482307_-	DUF2815 family protein	NA	D2J040	Enterococcus_phage	57.9	5.6e-51
AYZ09094.1|482320_483478_-	DUF2800 domain-containing protein	NA	A7J278	Streptococcus_phage	99.2	8.5e-219
AYZ09095.1|483477_483777_-	hypothetical protein	NA	A7J277	Streptococcus_phage	99.0	2.3e-43
AYZ09096.1|483864_484068_-	hypothetical protein	NA	A7J276	Streptococcus_phage	94.0	1.2e-30
AYZ09097.1|484213_484597_-	hypothetical protein	NA	A7J274	Streptococcus_phage	93.7	5.9e-60
AYZ09098.1|484793_484964_-	hypothetical protein	NA	A7J273	Streptococcus_phage	92.9	9.0e-21
AYZ09099.1|484992_485250_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ09100.1|485337_485568_-	hypothetical protein	NA	A7J271	Streptococcus_phage	92.0	3.4e-31
AYZ09101.1|485588_485780_-	hypothetical protein	NA	A7J270	Streptococcus_phage	100.0	7.3e-27
AYZ09102.1|486418_486769_+	XRE family transcriptional regulator	NA	M1I9X0	Streptococcus_phage	85.3	1.2e-48
AYZ09103.1|486782_487166_+	ImmA/IrrE family metallo-endopeptidase	NA	A7J268	Streptococcus_phage	99.2	1.5e-68
AYZ09104.1|487176_487728_+	hypothetical protein	NA	A7J267	Streptococcus_phage	94.0	1.5e-88
AYZ09105.1|487903_488992_+|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	72.6	6.4e-152
AYZ09106.1|489134_490763_-	ABC transporter permease	NA	NA	NA	NA	NA
AYZ09107.1|490767_491502_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	2.2e-26
494224:494239	attR	CCATAAATGTTTTCAA	NA	NA	NA	NA
>prophage 5
CP033815	Streptococcus pyogenes strain FDAARGOS_514 chromosome, complete genome	1899746	975910	988287	1899746		Synechococcus_phage(28.57%)	8	NA	NA
AYZ09519.1|975910_979624_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	26.7	3.9e-39
AYZ09520.1|979857_981312_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	3.7e-54
AYZ09521.1|981339_982362_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	41.7	2.4e-63
AYZ09522.1|982529_983084_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.1	2.4e-25
AYZ09523.1|983267_984815_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase PurH	NA	E3SNU8	Prochlorococcus_phage	52.4	3.4e-45
AYZ09524.1|984873_985998_-	CHAP domain-containing protein	NA	F8HGP2	Streptococcus_phage	28.6	1.3e-06
AYZ09525.1|986252_987518_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
AYZ09526.1|987795_988287_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.3	2.5e-18
>prophage 6
CP033815	Streptococcus pyogenes strain FDAARGOS_514 chromosome, complete genome	1899746	1265917	1271951	1899746		Streptococcus_phage(100.0%)	8	NA	NA
AYZ09776.1|1265917_1266553_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	63.4	2.7e-65
AYZ09777.1|1266570_1267446_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	47.6	1.5e-71
AYZ09778.1|1268109_1268433_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	62.3	1.0e-28
AYZ09779.1|1268437_1269301_+	rRNA (cytidine-2'-O-)-methyltransferase	NA	M1PLC5	Streptococcus_phage	74.7	1.9e-114
AYZ09780.1|1269327_1269720_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ09781.1|1269766_1270396_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AYZ09782.1|1270693_1271050_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	66.7	2.8e-40
AYZ09783.1|1271123_1271951_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	79.5	3.8e-128
>prophage 7
CP033815	Streptococcus pyogenes strain FDAARGOS_514 chromosome, complete genome	1899746	1533262	1543866	1899746		Streptococcus_phage(57.14%)	9	NA	NA
AYZ10020.1|1533262_1535473_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	69.1	2.9e-268
AYZ10021.1|1535580_1536744_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	65.1	5.8e-143
AYZ10022.1|1536740_1537427_+	3-dehydroquinase	NA	W6LP76	Streptococcus_phage	68.9	7.0e-88
AYZ10023.1|1537520_1538687_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	32.8	4.5e-34
AYZ10024.1|1538747_1539089_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	39.3	1.3e-18
AYZ10025.1|1539309_1540662_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.0	4.5e-30
AYZ10026.1|1540741_1542019_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
AYZ10027.1|1542048_1542489_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ10028.1|1542723_1543866_+	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	27.3	1.4e-24
>prophage 8
CP033815	Streptococcus pyogenes strain FDAARGOS_514 chromosome, complete genome	1899746	1688218	1761327	1899746	head,integrase,capsid,protease,terminase,tail,holin,tRNA,portal	Streptococcus_phage(73.58%)	84	1700781:1700796	1706717:1706732
AYZ10161.1|1688218_1689415_-|integrase	site-specific integrase	integrase	A3F610	Streptococcus_phage	99.0	3.9e-227
AYZ10162.1|1689725_1690466_-	hypothetical protein	NA	A3F611	Streptococcus_phage	100.0	1.6e-130
AYZ10163.1|1690476_1690869_-	ImmA/IrrE family metallo-endopeptidase	NA	A3F612	Streptococcus_phage	68.7	2.2e-38
AYZ10164.1|1690872_1691223_-	XRE family transcriptional regulator	NA	A0A1S5SAD3	Streptococcus_phage	63.5	1.2e-35
AYZ10165.1|1691511_1691787_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ10166.1|1691821_1692034_+	XRE family transcriptional regulator	NA	M1Q1B4	Streptococcus_phage	52.9	1.7e-13
AYZ10167.1|1692361_1692697_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ10168.1|1692912_1693632_+	hypothetical protein	NA	A3F617	Streptococcus_phage	78.7	4.6e-106
AYZ10169.1|1693645_1693963_+	DNA-binding protein	NA	A3F618	Streptococcus_phage	99.0	1.7e-52
AYZ10170.1|1694055_1694247_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ10171.1|1694367_1694556_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ10172.1|1694542_1695883_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	84.7	7.1e-209
AYZ10173.1|1695875_1696637_+	hypothetical protein	NA	A0A220GFI5	Streptococcus_phage	55.3	1.5e-27
AYZ10174.1|1697448_1697676_+	hypothetical protein	NA	C5J991	Streptococcus_phage	47.9	2.7e-12
AYZ10431.1|1697689_1697896_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ10175.1|1697912_1698347_+	hypothetical protein	NA	Q938M1	Temperate_phage	57.3	6.5e-31
AYZ10176.1|1698343_1698628_+	hypothetical protein	NA	A0A097PAV1	Streptococcus_pyogenes_phage	88.3	3.6e-38
AYZ10177.1|1698629_1699262_+	SAM-dependent DNA methyltransferase	NA	L0P368	Streptococcus_phage	65.7	3.4e-81
AYZ10178.1|1699251_1699779_+	DUF1642 domain-containing protein	NA	A0A141E0J6	Streptococcus_phage	42.5	4.2e-24
AYZ10179.1|1699944_1700226_+	hypothetical protein	NA	A3F632	Streptococcus_phage	92.2	4.5e-33
AYZ10180.1|1700222_1700561_+	XRE family transcriptional regulator	NA	A3F633	Streptococcus_phage	92.0	1.5e-54
AYZ10181.1|1700562_1701390_+	prohibitin family protein	NA	A3F634	Streptococcus_phage	99.6	8.7e-117
1700781:1700796	attL	GAAAATCAAAAAGATT	NA	NA	NA	NA
AYZ10182.1|1701404_1701806_+	transcriptional regulator	NA	A3F635	Streptococcus_phage	100.0	2.7e-71
AYZ10183.1|1701965_1702541_+|integrase	site-specific integrase	integrase	A3F636	Streptococcus_phage	99.5	7.4e-107
AYZ10184.1|1702694_1702988_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ10185.1|1703045_1703249_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ10433.1|1703274_1703661_+	hypothetical protein	NA	A3F638	Streptococcus_phage	93.0	1.4e-64
AYZ10432.1|1703686_1703959_+	HNH endonuclease	NA	A3F639	Streptococcus_phage	95.6	4.8e-48
AYZ10186.1|1704099_1704417_+|terminase	terminase	terminase	A3F640	Streptococcus_phage	99.0	3.9e-49
AYZ10187.1|1704429_1706160_+|terminase	terminase large subunit	terminase	A3F641	Streptococcus_phage	97.0	0.0e+00
AYZ10188.1|1706150_1706375_+	hypothetical protein	NA	A3F642	Streptococcus_phage	97.3	2.0e-36
AYZ10189.1|1706527_1707715_+|portal	phage portal protein	portal	A3F643	Streptococcus_phage	96.2	5.6e-218
1706717:1706732	attR	GAAAATCAAAAAGATT	NA	NA	NA	NA
AYZ10190.1|1707695_1708502_+|protease	Clp protease ClpP	protease	A3F644	Streptococcus_phage	98.1	4.6e-147
AYZ10191.1|1708518_1709652_+|capsid	phage major capsid protein	capsid	A3F645	Streptococcus_phage	96.8	3.2e-202
AYZ10192.1|1709838_1710147_+	hypothetical protein	NA	A3F647	Streptococcus_phage	98.0	7.8e-47
AYZ10193.1|1710139_1710502_+|head,tail	phage head-tail adapter protein	head,tail	A3F648	Streptococcus_phage	97.5	1.1e-60
AYZ10194.1|1710503_1710902_+	hypothetical protein	NA	A3F649	Streptococcus_phage	100.0	2.9e-70
AYZ10195.1|1710894_1711275_+	hypothetical protein	NA	A3F650	Streptococcus_phage	99.2	7.4e-63
AYZ10196.1|1711286_1711871_+|tail	phage tail protein	tail	A3F651	Streptococcus_phage	90.2	3.1e-92
AYZ10197.1|1711963_1712266_+	hypothetical protein	NA	A3F652	Streptococcus_phage	96.0	1.8e-48
AYZ10198.1|1712303_1712507_-	hypothetical protein	NA	NA	NA	NA	NA
AYZ10199.1|1712491_1716592_+|tail	phage tail tape measure protein	tail	A3F654	Streptococcus_phage	68.4	0.0e+00
AYZ10200.1|1716604_1717375_+|tail	phage tail protein	tail	A3F655	Streptococcus_phage	87.5	2.1e-128
AYZ10201.1|1717371_1719423_+	hypothetical protein	NA	A3F656	Streptococcus_phage	85.3	0.0e+00
AYZ10202.1|1720431_1722336_+	hyaluronidase	NA	Q938J9	Temperate_phage	83.8	1.5e-212
AYZ10203.1|1722347_1722776_+	DUF1617 family protein	NA	Q938J8	Temperate_phage	84.3	8.1e-58
AYZ10204.1|1722778_1723411_+	hypothetical protein	NA	Q938J7	Temperate_phage	49.5	2.0e-44
AYZ10205.1|1723422_1723695_+	hypothetical protein	NA	A7J2B2	Streptococcus_phage	91.0	5.5e-36
AYZ10206.1|1723691_1723919_+|holin	phage holin	holin	A7J2B3	Streptococcus_phage	98.7	7.6e-31
AYZ10207.1|1724021_1725242_+	CHAP domain-containing protein	NA	Q938J4	Temperate_phage	87.5	2.1e-212
AYZ10208.1|1725379_1726504_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	48.8	2.0e-92
AYZ10209.1|1726716_1727499_+	exotoxin	NA	A0A097PAT7	Streptococcus_pyogenes_phage	45.8	4.3e-49
AYZ10210.1|1727611_1727800_+	Paratox	NA	A3F673	Streptococcus_phage	84.7	1.2e-21
AYZ10211.1|1728390_1729005_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	52.3	6.2e-51
AYZ10212.1|1729135_1729921_-	ABC transporter permease	NA	NA	NA	NA	NA
AYZ10213.1|1729930_1730629_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.3	6.6e-09
AYZ10214.1|1730628_1731000_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYZ10215.1|1731184_1734295_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	29.8	2.2e-120
AYZ10216.1|1734374_1735388_+	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
AYZ10217.1|1735450_1736953_+	pyruvate kinase	NA	NA	NA	NA	NA
AYZ10218.1|1737170_1737728_+	signal peptidase I	NA	NA	NA	NA	NA
AYZ10219.1|1737903_1739718_+	glutamine--fructose-6-phosphate aminotransferase	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	38.9	5.2e-98
AYZ10220.1|1739913_1740249_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
AYZ10221.1|1740355_1740997_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AYZ10222.1|1741006_1741636_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.5	1.3e-27
AYZ10223.1|1741651_1742488_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYZ10224.1|1742857_1743631_+	hypothetical protein	NA	NA	NA	NA	NA
AYZ10225.1|1744000_1745236_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
AYZ10226.1|1745355_1746678_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
AYZ10227.1|1747207_1749526_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.2	3.5e-131
AYZ10228.1|1749888_1750137_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
AYZ10229.1|1750173_1750785_+	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
AYZ10230.1|1750795_1750984_+	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
AYZ10231.1|1750996_1751536_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
AYZ10232.1|1751576_1751777_+	CsbD family protein	NA	J7KJ36	Streptococcus_phage	50.0	1.8e-07
AYZ10233.1|1751784_1752276_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
AYZ10234.1|1752438_1753080_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYZ10235.1|1753222_1753765_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYZ10236.1|1753882_1754584_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	4.9e-36
AYZ10237.1|1754598_1757235_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
AYZ10238.1|1757326_1757923_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AYZ10239.1|1757933_1758890_+	aromatic acid exporter family protein	NA	NA	NA	NA	NA
AYZ10240.1|1758986_1760327_+	DUF2130 domain-containing protein	NA	NA	NA	NA	NA
AYZ10241.1|1760442_1761327_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
