The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033744	Citrobacter freundii strain FDAARGOS_549 chromosome, complete genome	4974986	259861	316105	4974986	tRNA,coat,terminase,holin,tail	Escherichia_phage(39.34%)	74	NA	NA
AYY47405.1|259861_260533_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.5	1.8e-80
AYY47406.1|260587_261106_-	DfsB family protein	NA	NA	NA	NA	NA
AYY47407.1|261279_261453_+	hypothetical protein	NA	Q6UAW0	Klebsiella_phage	66.7	1.4e-13
AYY47408.1|261668_262658_-	hypothetical protein	NA	NA	NA	NA	NA
AYY47409.1|262688_263234_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYY47410.1|263515_264913_-|tail	phage tail protein	tail	A0A1V0E5M2	Salmonella_phage	56.2	7.3e-124
AYY47411.1|264974_265211_-	cor protein	NA	Q5G8V7	Enterobacteria_phage	57.0	4.5e-18
AYY47412.1|265319_265994_-	hypothetical protein	NA	O64337	Escherichia_phage	53.3	1.7e-54
AYY47413.1|265994_266309_-	hypothetical protein	NA	O64336	Escherichia_phage	59.6	4.1e-27
AYY47414.1|266308_269518_-	host specificity protein J	NA	G8C7R4	Escherichia_phage	82.7	0.0e+00
AYY47415.1|269570_269939_-	hypothetical protein	NA	NA	NA	NA	NA
AYY47416.1|270018_270618_-|tail	tail assembly protein	tail	G8C7R3	Escherichia_phage	93.5	1.3e-98
AYY47417.1|270605_271337_-	peptidase P60	NA	G8C7R2	Escherichia_phage	88.4	5.1e-137
AYY47418.1|271349_272123_-|tail	phage minor tail protein L	tail	G8C7R1	Escherichia_phage	87.8	1.4e-132
AYY47419.1|272131_272482_-	hypothetical protein	NA	G8C7R0	Escherichia_phage	89.7	1.7e-53
AYY47420.1|272843_273587_-	hypothetical protein	NA	A0A0P0ZDC0	Stx2-converting_phage	53.1	2.6e-59
AYY47421.1|273654_274206_-	hypothetical protein	NA	A0A0P0J0J1	Acinetobacter_phage	52.0	4.3e-27
AYY47422.1|274279_274447_-	Arc family DNA binding domain-containing protein	NA	G9L6D7	Escherichia_phage	75.0	3.0e-16
AYY47423.1|274569_275001_+	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	52.2	1.7e-26
AYY47424.1|275791_276016_-	hypothetical protein	NA	NA	NA	NA	NA
AYY47425.1|276015_279147_-|tail	phage tail tape measure protein	tail	K7PMB9	Enterobacterial_phage	39.9	1.5e-161
AYY47426.1|279146_279434_-	hypothetical protein	NA	I6PD79	Cronobacter_phage	64.6	1.4e-18
AYY47427.1|279451_279790_-	hypothetical protein	NA	G8C7Q5	Escherichia_phage	89.3	6.8e-52
AYY47428.1|279831_280764_-|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	91.0	1.3e-153
AYY47429.1|280810_281260_-	hypothetical protein	NA	G8C7Q2	Escherichia_phage	93.3	1.0e-74
AYY47430.1|281249_281849_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	88.4	1.1e-97
AYY47431.1|281851_282205_-	hypothetical protein	NA	G8C7Q0	Escherichia_phage	89.7	1.6e-51
AYY47432.1|282206_282689_-	hypothetical protein	NA	G8C7P9	Escherichia_phage	88.1	2.5e-79
AYY47433.1|282691_282877_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	95.1	1.0e-25
AYY47434.1|282916_284056_-|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	84.0	3.7e-174
AYY47435.1|284073_284826_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	89.2	1.3e-119
AYY47436.1|284950_286054_-	hypothetical protein	NA	G8C7P5	Escherichia_phage	91.8	2.7e-190
AYY47437.1|286055_287459_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	90.0	9.9e-238
AYY47438.1|287463_289035_-|terminase	terminase	terminase	G8C7P3	Escherichia_phage	92.4	2.1e-305
AYY47439.1|289031_289520_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	76.4	8.6e-48
AYY51606.1|289551_290196_-	hypothetical protein	NA	I6S676	Salmonella_phage	89.5	2.1e-110
AYY47440.1|290269_290656_+	hypothetical protein	NA	NA	NA	NA	NA
AYY47441.1|290895_291111_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
AYY47442.1|291114_291666_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	39.0	4.9e-07
AYY47443.1|291644_292193_-	lysozyme	NA	K7PM52	Enterobacteria_phage	92.9	7.8e-98
AYY47444.1|292164_292443_-|holin	holin	holin	K7PGZ9	Enterobacteria_phage	97.8	5.1e-45
AYY47445.1|292596_292785_-	hypothetical protein	NA	NA	NA	NA	NA
AYY47446.1|292983_293523_-	hypothetical protein	NA	NA	NA	NA	NA
AYY47447.1|293777_294467_-	antiterminator	NA	I6PDF8	Cronobacter_phage	50.4	5.8e-58
AYY47448.1|294463_294601_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	86.0	2.7e-15
AYY47449.1|294597_295206_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	63.7	1.4e-47
AYY47450.1|295208_295415_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	70.6	5.3e-23
AYY47451.1|295414_296017_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	93.5	4.3e-105
AYY47452.1|296051_296300_-	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	90.2	4.8e-39
AYY47453.1|296410_296644_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	72.7	6.2e-28
AYY47454.1|296988_298518_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	29.3	1.1e-32
AYY47455.1|298685_299153_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	76.8	7.2e-44
AYY47456.1|299149_299461_-	hypothetical protein	NA	NA	NA	NA	NA
AYY47457.1|299479_300229_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	88.8	3.9e-124
AYY51607.1|300231_301071_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	30.6	3.1e-29
AYY51608.1|301135_301327_-	hypothetical protein	NA	NA	NA	NA	NA
AYY47458.1|301410_301950_-	regulator	NA	K7PJT7	Enterobacteria_phage	93.9	1.0e-89
AYY47459.1|301952_302186_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	89.6	3.4e-34
AYY47460.1|302289_302676_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	87.3	9.8e-55
AYY47461.1|302708_302900_+	hypothetical protein	NA	K7PGY7	Enterobacteria_phage	100.0	2.2e-23
AYY51609.1|303293_303587_+	hypothetical protein	NA	K7PJT6	Enterobacteria_phage	100.0	3.8e-51
AYY47462.1|303576_304023_+	XRE family transcriptional regulator	NA	K7PKS0	Enterobacteria_phage	100.0	9.6e-78
AYY47463.1|304007_304421_+	hypothetical protein	NA	K7PHF7	Enterobacteria_phage	100.0	1.9e-72
AYY47464.1|304456_304651_-	hypothetical protein	NA	NA	NA	NA	NA
AYY47465.1|305027_305234_+	cell division inhibitor protein	NA	K7PM31	Enterobacteria_phage	100.0	1.5e-33
AYY47466.1|305547_308082_+	exodeoxyribonuclease VIII	NA	H6WRX1	Salmonella_phage	50.8	3.5e-233
AYY47467.1|308096_309137_+	enterohemolysin	NA	K7PKR8	Enterobacteria_phage	74.8	2.5e-153
AYY47468.1|309176_309419_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	89.9	3.0e-33
AYY47469.1|309483_309696_+	hypothetical protein	NA	A0A0U2RY08	Escherichia_phage	64.8	4.3e-20
AYY47470.1|309697_310936_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	64.4	4.1e-155
AYY47471.1|310985_311921_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	94.1	6.3e-140
AYY47472.1|312014_313388_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	8.6e-53
AYY47473.1|313859_314843_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AYY47474.1|314995_316105_-	chemoreceptor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	23.0	2.8e-09
>prophage 2
CP033744	Citrobacter freundii strain FDAARGOS_549 chromosome, complete genome	4974986	543385	629142	4974986	head,tRNA,integrase,terminase,holin,tail,portal,capsid,protease	Klebsiella_phage(30.36%)	103	576863:576890	632030:632057
AYY47680.1|543385_544081_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	A0A0R6PI74	Moraxella_phage	35.4	5.8e-05
AYY47681.1|544139_546050_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.1	9.1e-93
AYY47682.1|546190_546535_+	RidA family protein	NA	NA	NA	NA	NA
AYY47683.1|546541_546721_-	YoaH family protein	NA	NA	NA	NA	NA
AYY47684.1|546801_548166_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	31.8	7.5e-41
AYY47685.1|548169_548748_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
AYY47686.1|548931_550296_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AYY47687.1|550426_552028_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AYY47688.1|552034_553594_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	5.1e-41
AYY47689.1|554053_555016_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
AYY47690.1|555074_555875_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
AYY47691.1|555887_556739_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
AYY47692.1|556799_557258_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
AYY47693.1|557690_558257_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
AYY47694.1|558253_559063_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
AYY47695.1|559126_560872_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
AYY47696.1|561091_561301_-	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
AYY47697.1|561313_561457_-	DUF2627 domain-containing protein	NA	NA	NA	NA	NA
AYY47698.1|562093_562378_-	hypothetical protein	NA	NA	NA	NA	NA
AYY47699.1|562452_562596_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
AYY47700.1|562760_563000_+	hypothetical protein	NA	NA	NA	NA	NA
AYY47701.1|563114_563906_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
AYY47702.1|564080_565454_+	MFS transporter	NA	NA	NA	NA	NA
AYY47703.1|565500_566382_-|protease	protease HtpX	protease	NA	NA	NA	NA
AYY47704.1|566574_568623_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	1.2e-87
AYY47705.1|568642_569329_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AYY47706.1|569425_569923_-	GAF domain-containing protein	NA	NA	NA	NA	NA
AYY47707.1|570051_571335_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AYY47708.1|571303_573937_+	PqiB family protein	NA	NA	NA	NA	NA
AYY47709.1|574016_575438_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AYY47710.1|575535_575775_+	DUF1480 family protein	NA	NA	NA	NA	NA
AYY47711.1|575877_576069_+	DUF1482 family protein	NA	NA	NA	NA	NA
AYY47712.1|576069_576711_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.0	1.9e-55
576863:576890	attL	ATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
AYY51624.1|577051_577150_+	hypothetical protein	NA	S4TND2	Salmonella_phage	85.7	1.8e-05
AYY47713.1|577262_577934_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.0	2.2e-78
AYY47714.1|578142_579288_-	HNH endonuclease	NA	NA	NA	NA	NA
AYY47715.1|579748_580138_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	70.5	1.1e-50
AYY47716.1|580457_580700_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	76.6	9.9e-29
AYY47717.1|581061_581571_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
AYY47718.1|581572_582157_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	57.5	4.8e-61
AYY47719.1|582156_582768_-|tail	phage tail protein	tail	A0A0M4QWS3	Salmonella_phage	72.2	2.5e-76
AYY47720.1|582764_585344_-	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	46.6	5.6e-61
AYY47721.1|585385_588790_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	70.5	0.0e+00
AYY47722.1|588862_589540_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	73.8	2.7e-76
AYY47723.1|589437_590172_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	76.5	1.6e-114
AYY47724.1|590183_590879_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	71.9	1.6e-95
AYY47725.1|590887_591220_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	67.9	6.9e-41
AYY47726.1|591220_594523_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	65.1	0.0e+00
AYY51625.1|594522_594750_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	65.3	6.9e-24
AYY47727.1|594770_595133_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	55.9	1.8e-26
AYY47728.1|595195_595678_-|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	80.6	6.1e-62
AYY47729.1|595711_596113_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	86.5	5.8e-58
AYY47730.1|596109_596499_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	65.1	3.0e-43
AYY47731.1|596467_596818_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	74.8	3.2e-44
AYY51626.1|596814_597132_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	79.6	1.6e-39
AYY47732.1|597112_597499_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	58.2	4.3e-18
AYY47733.1|597596_598883_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	90.0	3.7e-215
AYY47734.1|598955_599876_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	80.4	1.6e-135
AYY47735.1|599912_601172_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.0	2.6e-221
AYY47736.1|601171_601351_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	69.5	5.6e-13
AYY47737.1|601344_603072_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	92.8	0.0e+00
AYY47738.1|603068_603566_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	93.3	6.4e-83
AYY47739.1|603686_603887_-	hypothetical protein	NA	Q6UAR8	Klebsiella_phage	87.9	6.5e-10
AYY47740.1|603883_604246_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	85.8	1.3e-56
AYY47741.1|604524_605064_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	80.0	3.8e-44
AYY47742.1|605421_605595_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
AYY47743.1|605798_606029_-	hypothetical protein	NA	NA	NA	NA	NA
AYY51627.1|606102_606291_-	cold-shock protein	NA	NA	NA	NA	NA
AYY47744.1|606301_606514_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	72.9	7.8e-22
AYY47745.1|606903_607437_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	40.9	1.8e-06
AYY47746.1|607418_607964_-	lysozyme	NA	K7PM52	Enterobacteria_phage	95.0	3.2e-99
AYY47747.1|607935_608214_-|holin	holin	holin	K7PGZ9	Enterobacteria_phage	97.8	5.1e-45
AYY47748.1|608369_608558_-	hypothetical protein	NA	NA	NA	NA	NA
AYY47749.1|609481_609697_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	80.6	5.9e-25
AYY47750.1|609993_610206_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
AYY47751.1|610492_610924_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	60.0	4.6e-37
AYY47752.1|610938_611979_-	DUF968 domain-containing protein	NA	K7PJS6	Enterobacterial_phage	52.0	1.7e-101
AYY47753.1|611975_612335_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	64.4	4.0e-42
AYY47754.1|612337_612538_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	61.5	5.5e-17
AYY47755.1|612665_612905_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	59.7	4.4e-21
AYY47756.1|613439_614666_+	hypothetical protein	NA	NA	NA	NA	NA
AYY47757.1|614711_615014_-	hypothetical protein	NA	NA	NA	NA	NA
AYY47758.1|615429_615687_-	hypothetical protein	NA	NA	NA	NA	NA
AYY47759.1|615745_616654_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	54.7	1.1e-77
AYY47760.1|616991_617177_+	stress-induced acidophilic repeat motif-containing protein	NA	NA	NA	NA	NA
AYY47761.1|617269_617767_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AYY47762.1|617790_618297_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AYY47763.1|618343_618856_-	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
AYY47764.1|618865_619312_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AYY47765.1|619321_619825_-	hypothetical protein	NA	NA	NA	NA	NA
AYY47766.1|619965_620361_+	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
AYY47767.1|620545_620971_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AYY47768.1|621026_621437_-	hypothetical protein	NA	M9NZE4	Enterobacteria_phage	68.9	1.1e-08
AYY47769.1|621452_621998_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	76.5	6.4e-68
AYY47770.1|621909_623025_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	51.9	3.7e-46
AYY51628.1|623073_623628_-	hypothetical protein	NA	NA	NA	NA	NA
AYY47771.1|623631_623844_-	XRE family transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	59.7	3.8e-16
AYY47772.1|623949_624330_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	66.7	6.5e-19
AYY47773.1|624548_624764_+	hypothetical protein	NA	NA	NA	NA	NA
AYY51629.1|624821_625148_+	transcriptional regulator	NA	NA	NA	NA	NA
AYY47774.1|625289_627761_+	exonuclease	NA	K7P6V4	Enterobacteria_phage	38.5	1.9e-111
AYY47775.1|627806_628085_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	40.3	1.9e-12
AYY47776.1|628062_629142_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	53.9	1.4e-106
632030:632057	attR	ATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 3
CP033744	Citrobacter freundii strain FDAARGOS_549 chromosome, complete genome	4974986	870566	880144	4974986	protease	Bacillus_phage(28.57%)	8	NA	NA
AYY48010.1|870566_871970_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.6	3.9e-32
AYY48011.1|871966_872689_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	9.2e-30
AYY48012.1|872824_873157_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AYY48013.1|873316_874678_+	U32 family peptidase	NA	Q6DW11	Phage_TP	92.9	5.3e-204
AYY48014.1|874947_877224_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.4e-164
AYY48015.1|877254_877575_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
AYY48016.1|877898_878123_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
AYY48017.1|878197_880144_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.3	1.6e-39
>prophage 4
CP033744	Citrobacter freundii strain FDAARGOS_549 chromosome, complete genome	4974986	918278	926697	4974986	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
AYY48054.1|918278_920312_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	4.0e-54
AYY48055.1|920518_920977_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	68.0	5.1e-50
AYY51639.1|921019_921490_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	76.9	4.9e-64
AYY48056.1|921536_922256_-	two-component system response regulator YehT	NA	NA	NA	NA	NA
AYY48057.1|922252_923938_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.6	6.7e-281
AYY48058.1|924163_924895_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	93.5	1.8e-105
AYY48059.1|924946_925054_+	protein YohO	NA	NA	NA	NA	NA
AYY48060.1|925034_925766_-	ABC transporter permease	NA	NA	NA	NA	NA
AYY48061.1|925749_926697_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.1	2.6e-08
>prophage 5
CP033744	Citrobacter freundii strain FDAARGOS_549 chromosome, complete genome	4974986	1436085	1497844	4974986	head,tRNA,integrase,terminase,holin,tail,portal,capsid	Cronobacter_phage(81.58%)	59	1463956:1464002	1496355:1496401
AYY48499.1|1436085_1436853_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AYY48500.1|1436897_1437446_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AYY48501.1|1437464_1437713_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AYY48502.1|1437966_1439328_-	signal recognition particle protein	NA	NA	NA	NA	NA
AYY48503.1|1439493_1440285_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
AYY48504.1|1440303_1441593_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AYY48505.1|1441642_1442236_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AYY48506.1|1442232_1442427_-	molecular chaperone GrpE	NA	NA	NA	NA	NA
AYY48507.1|1442358_1443237_+	NAD(+) kinase	NA	NA	NA	NA	NA
AYY48508.1|1443322_1444984_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AYY48509.1|1445133_1445478_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AYY48510.1|1445528_1445825_-	RnfH family protein	NA	NA	NA	NA	NA
AYY48511.1|1445808_1446264_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AYY51661.1|1446406_1446889_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	1.2e-28
AYY48512.1|1447471_1458700_+	BapA prefix-like domain-containing protein	NA	NA	NA	NA	NA
AYY48513.1|1458800_1460210_+	type I secretion protein TolC	NA	NA	NA	NA	NA
AYY48514.1|1460206_1462393_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	29.4	3.2e-17
AYY51662.1|1462400_1463564_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
1463956:1464002	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
AYY51663.1|1464087_1464330_+	hypothetical protein	NA	NA	NA	NA	NA
AYY51664.1|1464586_1465762_-	hypothetical protein	NA	NA	NA	NA	NA
AYY48515.1|1466420_1466753_-	hypothetical protein	NA	A0A222YZ97	Escherichia_phage	54.1	4.5e-24
AYY51665.1|1466858_1468559_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	80.6	4.4e-224
AYY48516.1|1468561_1469107_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	73.1	3.0e-65
AYY48517.1|1469078_1469804_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	51.0	1.3e-55
AYY48518.1|1469793_1470330_-|tail	tail assembly chaperone	tail	F1BUK2	Cronobacter_phage	35.2	5.8e-21
AYY48519.1|1470342_1472346_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	77.5	2.6e-146
AYY48520.1|1472356_1472944_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	83.1	1.1e-92
AYY48521.1|1472936_1474121_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	80.9	1.1e-181
AYY48522.1|1474117_1474447_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	68.8	9.3e-38
AYY48523.1|1474443_1476504_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	68.6	2.5e-269
AYY48524.1|1476691_1476949_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	57.3	4.9e-18
AYY48525.1|1476935_1477124_-	hypothetical protein	NA	F1BUL1	Cronobacter_phage	75.8	2.0e-21
AYY48526.1|1477053_1477434_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	64.2	1.2e-28
AYY48527.1|1477433_1477775_-	M15 family peptidase	NA	F1BUL3	Cronobacter_phage	94.1	6.9e-52
AYY48528.1|1477761_1478064_-|holin	holin	holin	A0A0M5M1H1	Salmonella_phage	55.3	1.4e-19
AYY48529.1|1478074_1478530_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.8	5.9e-59
AYY48530.1|1478526_1479654_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	80.5	2.2e-171
AYY48531.1|1479650_1480358_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	75.6	3.7e-100
AYY48532.1|1480354_1480861_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	68.7	6.2e-65
AYY48533.1|1480857_1481346_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	1.1e-63
AYY48534.1|1481406_1482108_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	69.0	1.7e-89
AYY48535.1|1482111_1483134_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.8	1.0e-159
AYY48536.1|1483195_1483999_-|capsid	phage capsid protein	capsid	F1BUM4	Cronobacter_phage	56.8	9.8e-81
AYY48537.1|1484160_1485936_+|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	83.6	5.2e-292
AYY48538.1|1485932_1486994_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.8	1.0e-162
AYY48539.1|1486990_1487314_+	transcriptional regulator	NA	F1BUM8	Cronobacter_phage	93.3	4.7e-50
AYY48540.1|1487287_1487506_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	47.2	3.6e-06
AYY48541.1|1487621_1489637_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.9	1.0e-299
AYY48542.1|1489638_1489851_-	hypothetical protein	NA	NA	NA	NA	NA
AYY48543.1|1489847_1490717_-	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.0	2.7e-132
AYY48544.1|1490707_1490941_-	DUF2732 family protein	NA	NA	NA	NA	NA
AYY48545.1|1491007_1491409_-	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	2.2e-49
AYY48546.1|1491408_1491837_-	hypothetical protein	NA	F1BUN5	Cronobacter_phage	54.0	3.3e-27
AYY48547.1|1492259_1492721_+	hypothetical protein	NA	NA	NA	NA	NA
AYY51666.1|1492769_1493273_-	hypothetical protein	NA	F1BUN6	Cronobacter_phage	71.3	3.9e-59
AYY48548.1|1493310_1493514_-	hypothetical protein	NA	F1BUN7	Cronobacter_phage	52.0	7.8e-11
AYY48549.1|1493659_1494226_+	Repressor protein CI	NA	F1BUN8	Cronobacter_phage	58.6	4.0e-65
AYY48550.1|1494225_1495239_+|integrase	site-specific integrase	integrase	F1BUN9	Cronobacter_phage	86.1	3.3e-174
AYY48551.1|1496602_1497844_+	DUF4102 domain-containing protein	NA	A0A1B5FPC6	Escherichia_phage	48.5	3.3e-104
1496355:1496401	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
>prophage 6
CP033744	Citrobacter freundii strain FDAARGOS_549 chromosome, complete genome	4974986	1854866	1902165	4974986	tRNA,plate,protease	Staphylococcus_phage(25.0%)	42	NA	NA
AYY48855.1|1854866_1855625_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYY48856.1|1855821_1856742_-	agmatinase	NA	NA	NA	NA	NA
AYY48857.1|1856979_1858956_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYY48858.1|1858964_1859096_-	virulence promoting factor	NA	NA	NA	NA	NA
AYY48859.1|1859743_1860898_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	5.3e-128
AYY48860.1|1861297_1862692_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	25.5	1.4e-26
AYY48861.1|1862769_1863267_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
AYY48862.1|1863361_1864069_+	deoxyribonuclease I	NA	NA	NA	NA	NA
AYY48863.1|1864143_1864875_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYY48864.1|1864894_1865842_+	glutathione synthase	NA	NA	NA	NA	NA
AYY48865.1|1865945_1866581_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
AYY51679.1|1866580_1866997_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
AYY48866.1|1866993_1867974_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
AYY48867.1|1867991_1868696_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AYY48868.1|1868714_1869281_+	YggT family protein	NA	NA	NA	NA	NA
AYY48869.1|1869277_1869568_+	YggU family protein	NA	NA	NA	NA	NA
AYY48870.1|1869575_1870169_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
AYY48871.1|1870161_1871298_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
AYY48872.1|1871413_1872460_-	L-asparaginase 2	NA	NA	NA	NA	NA
AYY48873.1|1872648_1873368_-	DUF2884 family protein	NA	NA	NA	NA	NA
AYY48874.1|1873417_1873744_-	DUF469 domain-containing protein	NA	NA	NA	NA	NA
AYY48875.1|1873743_1874463_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AYY51680.1|1874623_1875676_+	adenine DNA glycosylase	NA	NA	NA	NA	NA
AYY48876.1|1875703_1875973_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYY48877.1|1876059_1877145_+	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	4.5e-12
AYY48878.1|1877356_1878613_+	nucleoside permease	NA	NA	NA	NA	NA
AYY48879.1|1878665_1880801_-	ornithine decarboxylase	NA	NA	NA	NA	NA
AYY48880.1|1881269_1881977_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
AYY48881.1|1883495_1884353_+	hypothetical protein	NA	NA	NA	NA	NA
AYY48882.1|1884553_1885033_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
AYY48883.1|1885035_1886403_-	hypothetical protein	NA	NA	NA	NA	NA
AYY48884.1|1886413_1889938_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AYY48885.1|1889961_1891383_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AYY48886.1|1891387_1892143_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
AYY48887.1|1892139_1894875_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.7	8.2e-87
AYY48888.1|1894883_1895693_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AYY48889.1|1895697_1897041_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AYY48890.1|1897043_1897577_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AYY51681.1|1897573_1898872_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AYY48891.1|1898888_1899935_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AYY48892.1|1899901_1901737_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AYY48893.1|1901739_1902165_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 7
CP033744	Citrobacter freundii strain FDAARGOS_549 chromosome, complete genome	4974986	3314070	3327586	4974986	capsid	Enterobacteria_phage(66.67%)	14	NA	NA
AYY51734.1|3314070_3315573_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.0	5.7e-82
AYY50136.1|3315720_3316740_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	32.0	3.2e-44
AYY50137.1|3317208_3318462_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	41.1	1.0e-76
AYY50138.1|3318499_3320368_-	hypothetical protein	NA	A0A1B3AYT3	Gordonia_phage	27.8	2.4e-21
AYY50139.1|3320806_3321382_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	51.4	5.1e-39
AYY50140.1|3321398_3321641_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.4e-19
AYY50141.1|3321637_3322441_-|capsid	capsid protein	capsid	Q7M2A2	Enterobacteria_phage	26.1	1.1e-12
AYY50142.1|3322992_3323259_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	63.6	5.2e-23
AYY50143.1|3323255_3323855_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	78.1	1.1e-49
AYY50144.1|3323847_3324147_+	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	67.7	1.3e-30
AYY50145.1|3324139_3324589_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	66.4	1.4e-44
AYY51735.1|3324693_3324921_+	hypothetical protein	NA	NA	NA	NA	NA
AYY50146.1|3324917_3325238_+	hypothetical protein	NA	NA	NA	NA	NA
AYY50147.1|3325252_3327586_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.7	0.0e+00
>prophage 8
CP033744	Citrobacter freundii strain FDAARGOS_549 chromosome, complete genome	4974986	4716928	4723881	4974986		uncultured_Caudovirales_phage(57.14%)	8	NA	NA
AYY51349.1|4716928_4718179_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	9.4e-22
AYY51350.1|4718314_4718824_-	DedA family protein	NA	NA	NA	NA	NA
AYY51351.1|4718998_4719241_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	77.9	1.5e-29
AYY51352.1|4719628_4720327_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	67.2	2.5e-88
AYY51783.1|4720412_4720733_+	ArsR family transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	1.4e-19
AYY51353.1|4720777_4722067_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.0	2.7e-165
AYY51354.1|4722079_4722505_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	7.3e-51
AYY51355.1|4723386_4723881_+	hypothetical protein	NA	A0A1B0VBR9	Salmonella_phage	32.4	3.4e-07
>prophage 9
CP033744	Citrobacter freundii strain FDAARGOS_549 chromosome, complete genome	4974986	4818514	4828552	4974986	tRNA	Tupanvirus(14.29%)	10	NA	NA
AYY51447.1|4818514_4819498_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
AYY51448.1|4819513_4821901_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AYY51449.1|4821905_4822205_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AYY51450.1|4822358_4823339_+	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.8	6.7e-15
AYY51451.1|4823399_4823951_+	glutathione peroxidase	NA	NA	NA	NA	NA
AYY51452.1|4823950_4824700_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	7.1e-09
AYY51453.1|4824777_4825242_+	endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.2	3.5e-14
AYY51454.1|4825558_4826272_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AYY51455.1|4826333_4827776_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.3	7.7e-52
AYY51456.1|4827772_4828552_-	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	26.7	7.9e-11
>prophage 1
CP033743	Citrobacter freundii strain FDAARGOS_549 plasmid unnamed, complete sequence	127175	0	12032	127175	integrase	Pseudomonas_phage(50.0%)	12	3261:3273	16348:16360
AYY47054.1|1754_2294_-	hypothetical protein	NA	NA	NA	NA	NA
AYY47055.1|2334_2622_-	conjugal transfer protein	NA	NA	NA	NA	NA
AYY47056.1|2618_3779_-	plasmid transfer ATPase TraJ	NA	NA	NA	NA	NA
3261:3273	attL	TCCGGAACCTGTT	NA	NA	NA	NA
AYY47057.1|3790_4597_-	conjugal transfer protein	NA	NA	NA	NA	NA
AYY47058.1|4593_5067_-	hypothetical protein	NA	NA	NA	NA	NA
AYY47059.1|5199_6408_-	type IX secretion system membrane protein PorP/SprF	NA	NA	NA	NA	NA
AYY47060.1|6510_7347_-	hypothetical protein	NA	NA	NA	NA	NA
AYY47061.1|7491_7695_-	hypothetical protein	NA	NA	NA	NA	NA
AYY47062.1|7987_9148_-|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	43.7	3.2e-48
AYY47063.1|9862_10894_-	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
AYY47064.1|10890_11565_-	prepilin peptidase	NA	NA	NA	NA	NA
AYY47179.1|11549_12032_-	pilus assembly protein	NA	A0A0A8J856	Ralstonia_phage	36.2	6.8e-05
16348:16360	attR	AACAGGTTCCGGA	NA	NA	NA	NA
>prophage 2
CP033743	Citrobacter freundii strain FDAARGOS_549 plasmid unnamed, complete sequence	127175	27852	31998	127175		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
AYY47080.1|27852_28890_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	31.2	1.0e-21
AYY47081.1|28936_29266_-	hypothetical protein	NA	NA	NA	NA	NA
AYY47082.1|29600_31133_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
AYY47083.1|31524_31998_-	chromosome partitioning protein ParB	NA	A0A0R6PHV6	Moraxella_phage	35.5	6.9e-18
>prophage 3
CP033743	Citrobacter freundii strain FDAARGOS_549 plasmid unnamed, complete sequence	127175	42211	44289	127175		Bacillus_phage(100.0%)	2	NA	NA
AYY47093.1|42211_43612_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.3	1.4e-18
AYY47094.1|43608_44289_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
>prophage 4
CP033743	Citrobacter freundii strain FDAARGOS_549 plasmid unnamed, complete sequence	127175	49383	56634	127175		uncultured_Caudovirales_phage(33.33%)	5	NA	NA
AYY47101.1|49383_50121_+	peptidase M23	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
AYY47102.1|50154_50352_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AYY47103.1|50392_52834_-	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.4	2.6e-84
AYY47104.1|52961_53402_-	hypothetical protein	NA	NA	NA	NA	NA
AYY47105.1|53487_56634_-	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.2	5.2e-61
>prophage 5
CP033743	Citrobacter freundii strain FDAARGOS_549 plasmid unnamed, complete sequence	127175	60007	63335	127175		Bacillus_phage(66.67%)	4	NA	NA
AYY47109.1|60007_60688_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
AYY47110.1|60680_62156_+	Cu(+)/Ag(+) sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.5	3.6e-28
AYY47111.1|62406_62838_+	silver-binding protein SilE	NA	NA	NA	NA	NA
AYY47112.1|62984_63335_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	51.4	6.0e-19
>prophage 6
CP033743	Citrobacter freundii strain FDAARGOS_549 plasmid unnamed, complete sequence	127175	70172	77245	127175	integrase	Escherichia_phage(50.0%)	10	67940:67954	78855:78869
67940:67954	attL	CCGCCTGCTCCAGAC	NA	NA	NA	NA
AYY47120.1|70172_70952_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	1.0e-50
AYY47121.1|71236_71446_+	hypothetical protein	NA	NA	NA	NA	NA
AYY47122.1|71925_72237_-	hypothetical protein	NA	NA	NA	NA	NA
AYY47123.1|72623_72917_-	hypothetical protein	NA	NA	NA	NA	NA
AYY47124.1|73021_73303_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AYY47125.1|73302_73941_-	chromosome partitioning protein ParA	NA	A0A222YXS3	Escherichia_phage	45.8	9.9e-44
AYY47126.1|74176_75148_+	plasmid segregation protein parM	NA	A0A222YXF2	Escherichia_phage	42.9	2.0e-64
AYY47127.1|75152_75542_+	plasmid stability protein	NA	A0A222YWJ6	Escherichia_phage	43.9	3.2e-05
AYY47128.1|75545_76817_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.7	2.3e-156
AYY47129.1|76816_77245_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	51.2	1.8e-28
78855:78869	attR	GTCTGGAGCAGGCGG	NA	NA	NA	NA
>prophage 7
CP033743	Citrobacter freundii strain FDAARGOS_549 plasmid unnamed, complete sequence	127175	80646	84624	127175		Rhodococcus_phage(50.0%)	4	NA	NA
AYY47134.1|80646_81156_+	antirestriction protein ArdA	NA	A0A222ZHP3	Rhodococcus_phage	30.8	6.3e-09
AYY47135.1|81198_81387_+	hypothetical protein	NA	NA	NA	NA	NA
AYY47136.1|82235_82568_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AYY47137.1|82635_84624_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.3	2.9e-25
>prophage 8
CP033743	Citrobacter freundii strain FDAARGOS_549 plasmid unnamed, complete sequence	127175	91412	98212	127175		uncultured_Caudovirales_phage(40.0%)	12	NA	NA
AYY47145.1|91412_91652_+	antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
AYY47146.1|91651_91939_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	4.0e-29
AYY47147.1|92009_92168_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
AYY47148.1|93070_93427_+	hypothetical protein	NA	NA	NA	NA	NA
AYY47149.1|93469_94288_+	SAM-dependent DNA methyltransferase	NA	H7BVT3	unidentified_phage	34.4	6.8e-13
AYY47150.1|94367_94859_+	antirestriction protein	NA	NA	NA	NA	NA
AYY47151.1|94903_95227_+	hypothetical protein	NA	NA	NA	NA	NA
AYY47152.1|95189_95447_-	XRE family transcriptional regulator	NA	A0A248SLB9	Klebsiella_phage	48.3	2.3e-07
AYY47153.1|95497_95710_+	hypothetical protein	NA	NA	NA	NA	NA
AYY47154.1|96201_96348_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
AYY47155.1|96402_96972_+	hypothetical protein	NA	NA	NA	NA	NA
AYY47156.1|97378_98212_+	DUF945 domain-containing protein	NA	A0A1L2CVW9	Pectobacterium_phage	40.2	2.5e-47
