The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033742	Citrobacter freundii strain FDAARGOS_550 chromosome, complete genome	4969137	367101	451528	4969137	capsid,tail,tRNA,integrase,portal,head,holin,terminase,protease	Enterobacteria_phage(28.33%)	100	400579:400606	449284:449311
AYY42758.1|367101_367797_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	A0A0R6PI74	Moraxella_phage	36.9	3.4e-05
AYY42759.1|367855_369766_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.1	7.0e-93
AYY42760.1|369906_370251_+	RidA family protein	NA	NA	NA	NA	NA
AYY42761.1|370257_370437_-	YoaH family protein	NA	NA	NA	NA	NA
AYY42762.1|370517_371882_+	aminodeoxychorismate synthase component 1	NA	S4VNU7	Pandoravirus	40.2	8.3e-40
AYY42763.1|371885_372464_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
AYY42764.1|372647_374012_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AYY42765.1|374142_375744_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AYY42766.1|375750_377310_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	5.1e-41
AYY42767.1|377769_378732_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
AYY42768.1|378790_379591_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
AYY42769.1|379603_380455_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
AYY42770.1|380515_380974_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
AYY42771.1|381406_381973_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
AYY42772.1|381969_382779_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
AYY42773.1|382842_384588_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
AYY42774.1|384807_385017_-	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
AYY42775.1|385029_385173_-	DUF2627 domain-containing protein	NA	NA	NA	NA	NA
AYY42776.1|385809_386094_-	hypothetical protein	NA	NA	NA	NA	NA
AYY42777.1|386168_386312_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
AYY42778.1|386476_386716_+	hypothetical protein	NA	NA	NA	NA	NA
AYY42779.1|386830_387622_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
AYY42780.1|387796_389170_+	MFS transporter	NA	NA	NA	NA	NA
AYY42781.1|389216_390098_-|protease	protease HtpX	protease	NA	NA	NA	NA
AYY42782.1|390290_392339_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.7	1.6e-87
AYY42783.1|392358_393045_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AYY42784.1|393141_393639_-	GAF domain-containing protein	NA	NA	NA	NA	NA
AYY42785.1|393767_395051_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AYY42786.1|395019_397653_+	PqiB family protein	NA	NA	NA	NA	NA
AYY42787.1|397732_399154_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
AYY42788.1|399251_399491_+	DUF1480 family protein	NA	NA	NA	NA	NA
AYY42789.1|399593_399785_+	DUF1482 family protein	NA	NA	NA	NA	NA
AYY42790.1|399785_400427_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.0	9.6e-55
400579:400606	attL	ATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
AYY42791.1|400911_401133_+	hypothetical protein	NA	NA	NA	NA	NA
AYY42792.1|401119_402679_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AYY42793.1|403448_403958_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
AYY42794.1|403959_404544_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	55.0	7.1e-57
AYY42795.1|404543_407201_-	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	49.2	4.7e-71
AYY42796.1|407242_410647_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	70.4	0.0e+00
AYY42797.1|410719_411397_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	71.1	2.7e-71
AYY42798.1|411294_412029_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	77.4	1.0e-116
AYY42799.1|412040_412736_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	71.0	1.0e-94
AYY42800.1|412744_413077_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	67.9	5.3e-41
AYY42801.1|413077_416380_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	65.7	0.0e+00
AYY46876.1|416379_416607_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	65.3	9.0e-24
AYY42802.1|416627_416990_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	55.9	7.4e-28
AYY42803.1|417052_417535_-|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	81.2	4.7e-62
AYY42804.1|417568_417970_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	85.7	4.9e-57
AYY42805.1|417966_418356_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	64.3	8.7e-43
AYY42806.1|418324_418675_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	74.8	3.2e-44
AYY46877.1|418671_418989_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	79.6	2.8e-39
AYY42807.1|418969_419347_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	59.5	3.2e-18
AYY42808.1|419444_420731_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	87.1	8.8e-209
AYY42809.1|420804_421725_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	80.1	6.0e-135
AYY42810.1|421761_423021_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.7	5.6e-224
AYY42811.1|423020_423200_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	74.6	3.0e-14
AYY42812.1|423193_424909_-|terminase	terminase large subunit	terminase	Q6UAY0	Klebsiella_phage	83.0	6.8e-289
AYY42813.1|424945_425380_-|terminase	terminase	terminase	Q6UAY1	Klebsiella_phage	89.6	2.3e-68
AYY42814.1|425606_426122_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	48.2	1.4e-32
AYY42815.1|426257_426620_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	85.8	1.3e-56
AYY42816.1|426889_427063_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
AYY42817.1|427269_427500_-	hypothetical protein	NA	NA	NA	NA	NA
AYY46878.1|427573_427762_-	cold-shock protein	NA	NA	NA	NA	NA
AYY42818.1|427772_427985_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	74.3	2.1e-22
AYY42819.1|428359_428905_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	46.2	1.0e-12
AYY42820.1|428883_429432_-	lysozyme	NA	K7PM52	Enterobacteria_phage	94.0	2.1e-98
AYY42821.1|429403_429682_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	98.9	1.5e-44
AYY42822.1|429835_430024_-	hypothetical protein	NA	NA	NA	NA	NA
AYY42823.1|430078_430258_+	hypothetical protein	NA	NA	NA	NA	NA
AYY42824.1|431454_431670_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	80.6	5.9e-25
AYY42825.1|431966_432179_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
AYY46879.1|432465_432897_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	59.2	3.9e-36
AYY42826.1|432911_433604_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	42.0	2.5e-64
AYY42827.1|433600_433960_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	63.6	2.3e-42
AYY46880.1|433962_434163_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	69.2	3.3e-22
AYY42828.1|434168_434768_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	95.5	1.1e-105
AYY42829.1|434802_435051_-	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	91.5	2.2e-39
AYY42830.1|435161_435395_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.4	8.9e-27
AYY42831.1|435670_436036_-	hypothetical protein	NA	NA	NA	NA	NA
AYY42832.1|436600_437056_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	86.5	9.2e-44
AYY42833.1|437052_437364_-	hypothetical protein	NA	NA	NA	NA	NA
AYY42834.1|437382_438132_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	86.3	4.8e-122
AYY42835.1|438134_439007_-	DNA-binding protein	NA	V5URT9	Shigella_phage	51.9	4.2e-85
AYY46881.1|439156_439696_-	regulator	NA	K7PJT7	Enterobacteria_phage	93.3	1.3e-89
AYY42836.1|439698_439932_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	90.9	1.2e-34
AYY42837.1|440035_440422_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	85.7	2.9e-54
AYY42838.1|440572_441046_+	hypothetical protein	NA	K7PLT9	Enterobacteria_phage	59.1	2.3e-53
AYY42839.1|441042_441975_+	hypothetical protein	NA	K7PGT0	Enterobacteria_phage	53.2	1.3e-87
AYY42840.1|442007_442214_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	66.2	1.4e-15
AYY42841.1|442574_442781_+	cell division inhibitor protein	NA	K7PM31	Enterobacteria_phage	98.5	4.3e-33
AYY42842.1|443040_443328_+	DNA breaking-rejoining protein	NA	H6WRX2	Salmonella_phage	77.9	6.2e-38
AYY42843.1|443454_446439_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	59.6	8.1e-298
AYY42844.1|446450_447536_+	enterohemolysin	NA	K7PKR8	Enterobacteria_phage	63.6	8.7e-125
AYY42845.1|447574_447817_+	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	88.6	3.0e-33
AYY42846.1|447881_448154_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	63.3	1.5e-28
AYY42847.1|448122_449208_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	68.4	4.8e-147
AYY42848.1|449544_449883_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
449284:449311	attR	ATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
AYY42849.1|449903_450776_-	copper resistance D family protein	NA	NA	NA	NA	NA
AYY42850.1|450779_451154_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AYY42851.1|451297_451528_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	1.0e-14
>prophage 2
CP033742	Citrobacter freundii strain FDAARGOS_550 chromosome, complete genome	4969137	629109	646818	4969137		Prochlorococcus_phage(16.67%)	16	NA	NA
AYY43038.1|629109_630114_+	NAD-dependent epimerase	NA	A0A0K0KW07	Prochlorococcus_phage	31.3	3.6e-16
AYY43039.1|630172_631339_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	55.0	1.1e-114
AYY43040.1|631537_632944_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	1.8e-37
AYY43041.1|633071_633968_-	alpha-1,2-fucosyltransferase	NA	A0A2H4UUT1	Bodo_saltans_virus	31.7	5.7e-29
AYY43042.1|633979_634717_-	glycosyltransferase	NA	F2Y1U7	Organic_Lake_phycodnavirus	31.7	1.8e-09
AYY43043.1|634719_635883_-	oligosaccharide repeat unit polymerase	NA	NA	NA	NA	NA
AYY43044.1|635885_636539_-	antibiotic acetyltransferase	NA	M1GXE1	Acanthocystis_turfacea_Chlorella_virus	28.3	6.4e-06
AYY43045.1|636539_637808_-	O90/O127 family O-antigen flippase	NA	NA	NA	NA	NA
AYY43046.1|637820_639197_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	27.1	8.4e-32
AYY43047.1|639200_640649_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	32.4	1.4e-56
AYY43048.1|640641_641142_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
AYY43049.1|641144_642110_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	9.3e-86
AYY43050.1|642113_643232_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	66.9	1.5e-132
AYY43051.1|643242_644271_-	glycosyltransferase	NA	NA	NA	NA	NA
AYY43052.1|644692_645586_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.9	6.2e-44
AYY43053.1|645822_646818_-	SDR family oxidoreductase	NA	A0A0K1L6Z1	Scale_drop_disease_virus	28.1	5.5e-09
>prophage 3
CP033742	Citrobacter freundii strain FDAARGOS_550 chromosome, complete genome	4969137	690211	699789	4969137	protease	Bacillus_phage(28.57%)	8	NA	NA
AYY43084.1|690211_691615_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.2	5.0e-32
AYY43085.1|691611_692334_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	1.2e-29
AYY43086.1|692469_692802_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AYY43087.1|692961_694323_+	U32 family peptidase	NA	Q6DW11	Phage_TP	92.9	4.1e-204
AYY43088.1|694592_696869_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	1.4e-164
AYY43089.1|696899_697220_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
AYY43090.1|697543_697768_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.7	3.6e-17
AYY43091.1|697842_699789_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.3	1.6e-39
>prophage 4
CP033742	Citrobacter freundii strain FDAARGOS_550 chromosome, complete genome	4969137	747911	756330	4969137	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
AYY43137.1|747911_749945_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	4.0e-54
AYY43138.1|750151_750610_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	68.0	5.1e-50
AYY46891.1|750652_751123_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	76.9	4.9e-64
AYY43139.1|751169_751889_-	two-component system response regulator YehT	NA	NA	NA	NA	NA
AYY43140.1|751885_753571_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.6	6.7e-281
AYY43141.1|753796_754528_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	93.5	1.8e-105
AYY43142.1|754579_754687_+	protein YohO	NA	NA	NA	NA	NA
AYY43143.1|754667_755399_-	ABC transporter permease	NA	NA	NA	NA	NA
AYY43144.1|755382_756330_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	25.3	1.7e-07
>prophage 5
CP033742	Citrobacter freundii strain FDAARGOS_550 chromosome, complete genome	4969137	1196459	1298644	4969137	capsid,tail,tRNA,portal,head,holin,terminase,protease	Escherichia_phage(16.07%)	109	NA	NA
AYY43525.1|1196459_1197191_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
AYY43526.1|1197309_1198113_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
AYY43527.1|1198185_1199166_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
AYY43528.1|1199156_1199795_-	DUF1007 family protein	NA	NA	NA	NA	NA
AYY43529.1|1200215_1201199_+	autoinducer 2 ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYY43530.1|1201302_1202811_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.4	4.6e-15
AYY43531.1|1202803_1203793_+	ABC transporter permease	NA	NA	NA	NA	NA
AYY43532.1|1203794_1204748_+	ABC transporter permease	NA	NA	NA	NA	NA
AYY43533.1|1204765_1206403_+	ribulokinase	NA	NA	NA	NA	NA
AYY43534.1|1206399_1206999_+	SIS domain-containing protein	NA	NA	NA	NA	NA
AYY43535.1|1206975_1207239_-	hypothetical protein	NA	NA	NA	NA	NA
AYY43536.1|1207323_1208601_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
AYY43537.1|1208595_1209744_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
AYY43538.1|1209832_1210675_-	aldose 1-epimerase	NA	NA	NA	NA	NA
AYY43539.1|1210674_1212114_-	MFS transporter	NA	NA	NA	NA	NA
AYY43540.1|1212187_1215454_-	DUF5107 domain-containing protein	NA	NA	NA	NA	NA
AYY43541.1|1215568_1216762_+	ROK family transcriptional regulator	NA	NA	NA	NA	NA
AYY43542.1|1216765_1217659_-	DNA-binding transcriptional regulator HcaR	NA	NA	NA	NA	NA
AYY43543.1|1217794_1219156_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
AYY43544.1|1219152_1219671_+	3-phenylpropionate/cinnamic acid dioxygenase subunit beta	NA	NA	NA	NA	NA
AYY43545.1|1219670_1219991_+	bifunctional 3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit	NA	NA	NA	NA	NA
AYY43546.1|1219987_1220800_+	3-(cis-5,6-dihydroxycyclohexa-1, 3-dien-1-yl)propanoate dehydrogenase	NA	NA	NA	NA	NA
AYY43547.1|1220809_1222012_+	phenylpropionate dioxygenase ferredoxin reductase subunit	NA	NA	NA	NA	NA
AYY43548.1|1222104_1223358_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.4	3.9e-100
AYY43549.1|1223684_1224875_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
AYY43550.1|1224976_1225315_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
AYY43551.1|1225375_1226713_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	34.1	1.4e-10
AYY43552.1|1226709_1227453_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AYY46910.1|1227475_1228906_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	25.6	1.6e-12
AYY43553.1|1229541_1233429_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.7	1.9e-129
AYY43554.1|1233685_1235236_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
AYY43555.1|1235248_1235785_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
AYY43556.1|1235802_1236438_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
AYY43557.1|1236441_1237806_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
AYY43558.1|1237815_1238709_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
AYY46911.1|1238826_1239675_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AYY43559.1|1239919_1240309_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	72.1	8.7e-51
AYY43560.1|1240628_1240871_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	75.9	2.6e-29
AYY43561.1|1241140_1241617_+	DUF4065 domain-containing protein	NA	D0UIM3	Aggregatibacter_phage	42.4	1.2e-22
AYY43562.1|1242240_1243605_-|tail	phage tail protein	tail	A0A1V0E5M2	Salmonella_phage	51.1	1.1e-108
AYY43563.1|1243667_1243904_-	cor protein	NA	K7PLZ0	Enterobacterial_phage	57.1	1.5e-18
AYY43564.1|1244012_1244687_-	hypothetical protein	NA	O64337	Escherichia_phage	52.4	7.7e-55
AYY43565.1|1244687_1245005_-	hypothetical protein	NA	C0LP47	Escherichia_virus	55.0	3.1e-22
AYY43566.1|1244997_1248180_-	host specificity protein J	NA	O64335	Escherichia_phage	62.9	0.0e+00
AYY43567.1|1248233_1248821_-|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	47.9	1.4e-47
AYY43568.1|1248820_1249531_-	peptidase P60	NA	F1C573	Cronobacter_phage	71.1	3.5e-98
AYY43569.1|1249533_1250292_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	63.6	1.1e-94
AYY43570.1|1250288_1250627_-|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	62.5	6.6e-39
AYY43571.1|1250629_1253932_-|tail	phage tail tape measure protein	tail	K7P7L6	Enterobacteria_phage	84.7	0.0e+00
AYY43572.1|1253984_1254284_-	hypothetical protein	NA	NA	NA	NA	NA
AYY43573.1|1254336_1254615_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	88.0	4.9e-40
AYY43574.1|1254623_1255013_-|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	84.5	2.8e-57
AYY43575.1|1255040_1255745_-|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	73.9	9.7e-93
AYY43576.1|1255802_1256150_-	DUF3168 domain-containing protein	NA	A0A220NRP0	Escherichia_phage	74.8	2.4e-44
AYY43577.1|1256146_1256596_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	85.9	8.4e-66
AYY43578.1|1256592_1256931_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	69.6	1.9e-38
AYY43579.1|1256940_1257264_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	48.0	3.9e-20
AYY43580.1|1257583_1258792_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	82.9	4.7e-188
AYY43581.1|1258805_1259459_-|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	85.5	2.3e-104
AYY43582.1|1259445_1260675_-|portal	phage portal protein	portal	U5P411	Shigella_phage	82.7	9.7e-205
AYY43583.1|1260674_1260860_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	57.6	2.9e-12
AYY43584.1|1260870_1262628_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	89.4	0.0e+00
AYY43585.1|1262627_1263101_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	89.2	1.3e-77
AYY43586.1|1263257_1263608_-	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	78.4	2.3e-50
AYY43587.1|1264011_1264272_+	hypothetical protein	NA	NA	NA	NA	NA
AYY43588.1|1264318_1264525_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	67.7	4.3e-17
AYY43589.1|1264481_1264751_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	70.1	1.3e-21
AYY43590.1|1264758_1265385_-	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	73.4	2.1e-86
AYY43591.1|1265540_1265822_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	47.1	7.0e-18
AYY43592.1|1265808_1266195_-	hypothetical protein	NA	A0A192Y8P2	Salmonella_phage	91.4	5.2e-56
AYY43593.1|1266404_1266815_-	antitermination protein	NA	A0A088CD47	Shigella_phage	77.3	3.1e-51
AYY43594.1|1266804_1267449_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	69.6	8.4e-83
AYY43595.1|1267445_1268090_-	NinG family protein	NA	A0A1W6JNX3	Morganella_phage	60.7	4.1e-45
AYY43596.1|1268059_1269031_-	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	61.2	1.9e-107
AYY43597.1|1269027_1270557_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	67.3	6.4e-206
AYY43598.1|1270549_1270825_-	hypothetical protein	NA	A0A1P8VVT6	Streptococcus_phage	42.3	3.9e-05
AYY43599.1|1270985_1271264_-	hypothetical protein	NA	NA	NA	NA	NA
AYY43600.1|1271304_1271808_-	hypothetical protein	NA	A0A0P0ZE62	Stx2-converting_phage	50.3	2.9e-38
AYY43601.1|1271877_1272078_-	Cro/Cl family transcriptional regulator	NA	K7PLQ6	Enterobacteria_phage	75.8	2.6e-19
AYY43602.1|1272186_1272897_+	LexA family transcriptional regulator	NA	K7P8B2	Enterobacteria_phage	67.2	9.5e-88
AYY43603.1|1273540_1273984_-	hypothetical protein	NA	U5P096	Shigella_phage	33.9	2.8e-13
AYY43604.1|1274512_1274872_+	hypothetical protein	NA	I6NMK2	Burkholderia_virus	35.6	5.4e-07
AYY43605.1|1274915_1275728_+	DUF2303 family protein	NA	NA	NA	NA	NA
AYY43606.1|1275805_1276603_+	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	55.1	2.8e-72
AYY43607.1|1276589_1276811_+	hypothetical protein	NA	NA	NA	NA	NA
AYY43608.1|1277371_1277572_+	hypothetical protein	NA	NA	NA	NA	NA
AYY46912.1|1278125_1278698_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	66.7	1.2e-69
AYY43609.1|1278699_1278900_+	DNA-binding protein	NA	NA	NA	NA	NA
AYY43610.1|1278946_1279327_-	hypothetical protein	NA	NA	NA	NA	NA
AYY43611.1|1279428_1280826_-	recombinase	NA	NA	NA	NA	NA
AYY43612.1|1281040_1281301_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	55.8	1.0e-18
AYY43613.1|1281330_1281711_-	holo-ACP synthase	NA	NA	NA	NA	NA
AYY43614.1|1281710_1282442_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
AYY46913.1|1282453_1283182_-	DNA repair protein RecO	NA	NA	NA	NA	NA
AYY43615.1|1283212_1284118_-	GTPase Era	NA	NA	NA	NA	NA
AYY43616.1|1284114_1284795_-	ribonuclease 3	NA	A0A2K9L5P0	Tupanvirus	31.8	1.6e-20
AYY43617.1|1285064_1286039_-	signal peptidase I	NA	NA	NA	NA	NA
AYY43618.1|1286054_1287854_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	3.8e-24
AYY43619.1|1288124_1288589_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
AYY43620.1|1288585_1289542_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
AYY43621.1|1289541_1290192_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
AYY43622.1|1290223_1290799_-	ECF RNA polymerase sigma-E factor	NA	NA	NA	NA	NA
AYY43623.1|1290795_1290960_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
AYY43624.1|1291223_1292846_+	L-aspartate oxidase	NA	NA	NA	NA	NA
AYY43625.1|1292830_1293568_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase	tRNA	NA	NA	NA	NA
AYY43626.1|1293698_1295027_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	29.1	2.5e-41
AYY43627.1|1296140_1296524_-	autonomous glycyl radical cofactor GrcA	NA	A0A1W5N098	Cronobacter_phage	70.9	3.6e-33
AYY43628.1|1296841_1297531_+	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	49.3	7.9e-55
AYY43629.1|1297564_1298644_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 6
CP033742	Citrobacter freundii strain FDAARGOS_550 chromosome, complete genome	4969137	1702730	1750025	4969137	tRNA,protease,plate	Staphylococcus_phage(25.0%)	42	NA	NA
AYY43959.1|1702730_1703489_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYY43960.1|1703685_1704606_-	agmatinase	NA	NA	NA	NA	NA
AYY43961.1|1704843_1706820_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYY43962.1|1706828_1706960_-	virulence promoting factor	NA	NA	NA	NA	NA
AYY43963.1|1707607_1708762_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	5.3e-128
AYY43964.1|1709161_1710556_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	25.5	1.4e-26
AYY43965.1|1710633_1711131_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
AYY43966.1|1711225_1711933_+	deoxyribonuclease I	NA	NA	NA	NA	NA
AYY43967.1|1712007_1712739_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYY43968.1|1712758_1713706_+	glutathione synthase	NA	NA	NA	NA	NA
AYY43969.1|1713809_1714445_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
AYY46931.1|1714444_1714861_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
AYY43970.1|1714857_1715838_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
AYY43971.1|1715855_1716560_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AYY43972.1|1716578_1717145_+	YggT family protein	NA	NA	NA	NA	NA
AYY43973.1|1717141_1717432_+	YggU family protein	NA	NA	NA	NA	NA
AYY43974.1|1717439_1718033_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
AYY43975.1|1718025_1719162_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
AYY43976.1|1719277_1720324_-	L-asparaginase 2	NA	NA	NA	NA	NA
AYY43977.1|1720512_1721232_-	DUF2884 family protein	NA	NA	NA	NA	NA
AYY43978.1|1721281_1721608_-	DUF469 domain-containing protein	NA	NA	NA	NA	NA
AYY43979.1|1721607_1722327_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AYY46932.1|1722487_1723540_+	adenine DNA glycosylase	NA	NA	NA	NA	NA
AYY43980.1|1723567_1723837_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYY43981.1|1723923_1725009_+	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	4.5e-12
AYY43982.1|1725219_1726476_+	nucleoside permease	NA	NA	NA	NA	NA
AYY43983.1|1726528_1728664_-	ornithine decarboxylase	NA	NA	NA	NA	NA
AYY43984.1|1729132_1729840_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
AYY43985.1|1731355_1732213_+	hypothetical protein	NA	NA	NA	NA	NA
AYY43986.1|1732413_1732893_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
AYY43987.1|1732895_1734263_-	hypothetical protein	NA	NA	NA	NA	NA
AYY43988.1|1734273_1737798_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AYY43989.1|1737821_1739243_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
AYY43990.1|1739247_1740003_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
AYY43991.1|1739999_1742735_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	31.7	8.2e-87
AYY43992.1|1742743_1743553_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
AYY43993.1|1743557_1744901_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AYY43994.1|1744903_1745437_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AYY46933.1|1745433_1746732_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AYY43995.1|1746748_1747795_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AYY43996.1|1747761_1749597_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AYY43997.1|1749599_1750025_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 7
CP033742	Citrobacter freundii strain FDAARGOS_550 chromosome, complete genome	4969137	4562933	4616887	4969137	tail,tRNA,portal,protease,lysis,plate,holin,terminase,integrase	Salmonella_phage(14.89%)	67	4559877:4559894	4584296:4584313
4559877:4559894	attL	AGGCATTCACTGAGTGCC	NA	NA	NA	NA
AYY46473.1|4562933_4564040_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AYY46474.1|4564093_4564555_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AYY46475.1|4564564_4565497_-	hypothetical protein	NA	NA	NA	NA	NA
AYY46476.1|4565531_4566149_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AYY46477.1|4566351_4567602_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	9.4e-22
AYY46478.1|4567781_4568597_+	hypothetical protein	NA	NA	NA	NA	NA
AYY46479.1|4568599_4569028_+	hypothetical protein	NA	NA	NA	NA	NA
AYY46480.1|4569035_4570166_-|integrase	integrase	integrase	Q77Z04	Phage_21	60.2	7.2e-122
AYY46481.1|4570146_4570392_-	excisionase	NA	NA	NA	NA	NA
AYY46482.1|4570771_4571011_+	hypothetical protein	NA	NA	NA	NA	NA
AYY46483.1|4570981_4571230_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	62.2	3.7e-07
AYY46484.1|4571418_4572045_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	49.3	3.2e-47
AYY46485.1|4572147_4572375_+	cell division protein	NA	NA	NA	NA	NA
AYY46486.1|4572385_4572937_+	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	68.4	1.0e-65
AYY46487.1|4573109_4573289_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	1.0e-14
AYY46488.1|4573278_4574136_+	GntR family transcriptional regulator	NA	A0A1C9IHW0	Salmonella_phage	95.7	3.9e-59
AYY46489.1|4574132_4575014_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	94.5	1.0e-163
AYY46490.1|4575024_4576959_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	53.6	1.0e-200
AYY46491.1|4576955_4577342_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	89.1	4.1e-61
AYY46492.1|4577355_4578042_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	53.8	9.9e-58
AYY46493.1|4578038_4579034_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	69.6	2.2e-143
AYY46494.1|4579055_4579745_+	antitermination protein	NA	NA	NA	NA	NA
AYY46495.1|4579895_4580558_+	hypothetical protein	NA	NA	NA	NA	NA
AYY46496.1|4580731_4581784_+	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	80.4	1.0e-170
AYY47030.1|4581928_4582207_+|holin	holin	holin	K7PGZ9	Enterobacteria_phage	95.7	4.3e-44
AYY46497.1|4582178_4582727_+	lysozyme	NA	K7PM52	Enterobacteria_phage	91.8	6.6e-97
AYY46498.1|4582723_4583185_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	56.6	7.2e-36
AYY46499.1|4583460_4583979_+	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	92.4	6.9e-88
AYY46500.1|4584366_4584651_+	hypothetical protein	NA	NA	NA	NA	NA
4584296:4584313	attR	AGGCATTCACTGAGTGCC	NA	NA	NA	NA
AYY47031.1|4584879_4585386_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	64.3	1.4e-48
AYY46501.1|4585389_4587507_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	70.6	5.2e-307
AYY46502.1|4587503_4587719_+	hypothetical protein	NA	NA	NA	NA	NA
AYY46503.1|4587727_4589239_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	54.6	4.9e-150
AYY46504.1|4589195_4591298_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	52.1	8.8e-198
AYY46505.1|4591370_4591706_+	DUF2190 family protein	NA	A0A2K9V343	Faecalibacterium_phage	31.1	2.8e-05
AYY46506.1|4591705_4592062_+	hypothetical protein	NA	NA	NA	NA	NA
AYY46507.1|4592063_4592720_+	hypothetical protein	NA	D5LGZ7	Escherichia_phage	35.3	9.0e-16
AYY46508.1|4592731_4593286_+	hypothetical protein	NA	NA	NA	NA	NA
AYY46509.1|4593278_4593896_+|plate	phage baseplate assembly protein V	plate	Q9JML8	Wolbachia_phage	36.2	3.0e-13
AYY46510.1|4593934_4595404_+|tail	phage tail protein	tail	R9TMQ0	Vibrio_phage	37.1	1.9e-74
AYY46511.1|4595400_4595907_+|tail	phage tail protein	tail	NA	NA	NA	NA
AYY46512.1|4595965_4596265_+|tail	phage tail assembly protein	tail	Q75QK8	Wolbachia_phage	31.6	4.2e-05
AYY46513.1|4596367_4598293_+	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	30.7	8.2e-25
AYY46514.1|4598289_4598760_+|tail	phage tail protein	tail	R9TMP6	Vibrio_phage	45.0	3.8e-24
AYY46515.1|4598734_4598950_+|tail	phage tail protein	tail	R9TR63	Vibrio_phage	51.4	9.7e-12
AYY46516.1|4598951_4600070_+	late control protein D	NA	R9TNM7	Vibrio_phage	33.1	9.6e-34
AYY46517.1|4600109_4600463_+|plate	baseplate assembly protein	plate	R9TRM1	Vibrio_phage	54.1	6.5e-21
AYY46518.1|4600446_4601367_+|plate	baseplate assembly protein	plate	A0A193GYM8	Enterobacter_phage	48.3	1.4e-62
AYY46519.1|4601356_4601920_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	40.3	1.8e-25
AYY46520.1|4601912_4603529_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	40.0	4.5e-69
AYY46521.1|4603528_4604110_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	58.1	2.4e-57
AYY46522.1|4604425_4604776_+	hypothetical protein	NA	NA	NA	NA	NA
AYY46523.1|4605629_4606673_-	hypothetical protein	NA	NA	NA	NA	NA
AYY46524.1|4606910_4607153_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	75.3	2.2e-28
AYY47032.1|4607230_4607650_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	56.5	4.7e-34
AYY46525.1|4607651_4608920_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	81.3	1.0e-204
AYY46526.1|4608912_4609584_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	58.6	8.4e-78
AYY46527.1|4609903_4610485_-	hypothetical protein	NA	NA	NA	NA	NA
AYY46528.1|4610961_4611114_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.0	8.1e-21
AYY46529.1|4611249_4611759_-	DedA family protein	NA	NA	NA	NA	NA
AYY46530.1|4611933_4612176_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	77.9	1.5e-29
AYY46531.1|4612563_4613262_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.1	3.8e-89
AYY47033.1|4613317_4613668_+	ArsR family transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.3	2.1e-19
AYY46532.1|4613712_4614990_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	69.5	5.2e-161
AYY46533.1|4615002_4615428_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	7.3e-51
AYY46534.1|4615671_4615884_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	4.6e-22
AYY46535.1|4616401_4616887_+	hypothetical protein	NA	A0A1B0VBR9	Salmonella_phage	34.9	3.0e-08
>prophage 8
CP033742	Citrobacter freundii strain FDAARGOS_550 chromosome, complete genome	4969137	4711429	4721467	4969137	tRNA	Tupanvirus(14.29%)	10	NA	NA
AYY46627.1|4711429_4712413_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
AYY46628.1|4712428_4714816_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
AYY46629.1|4714820_4715120_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AYY46630.1|4715273_4716254_+	vitamin B12 ABC transporter permease BtuC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.8	6.7e-15
AYY46631.1|4716314_4716866_+	glutathione peroxidase	NA	NA	NA	NA	NA
AYY46632.1|4716865_4717615_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	7.1e-09
AYY46633.1|4717692_4718157_+	endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.2	3.5e-14
AYY46634.1|4718473_4719187_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AYY46635.1|4719248_4720691_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.3	7.7e-52
AYY46636.1|4720687_4721467_-	heme ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	26.7	7.9e-11
