The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033777	Klebsiella pneumoniae strain FDAARGOS_531 chromosome, complete genome	5423408	2107355	2172305	5423408	portal,protease,tRNA,integrase,transposase,terminase,tail,holin	Klebsiella_phage(25.58%)	77	2103070:2103094	2149551:2149575
2103070:2103094	attL	TTATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
AYY32877.1|2107355_2107580_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	53.8	1.3e-14
AYY32878.1|2107576_2107705_-|integrase	integrase	integrase	NA	NA	NA	NA
AYY32879.1|2107894_2108755_-	DNA-binding protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	52.7	6.8e-72
AYY32880.1|2108836_2109649_-	DUF2303 family protein	NA	NA	NA	NA	NA
AYY32881.1|2109692_2110052_-	hypothetical protein	NA	NA	NA	NA	NA
AYY32882.1|2110524_2111007_+	superinfection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	63.1	1.5e-52
AYY32883.1|2111157_2112277_+|transposase	IS3-like element ISKpn34 family transposase	transposase	S5WIU1	Leptospira_phage	43.3	1.1e-50
AYY32884.1|2112887_2113094_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	54.1	3.9e-10
AYY32885.1|2113123_2113540_-	hypothetical protein	NA	A0A0P0ZDD3	Stx2-converting_phage	42.5	1.4e-22
AYY32886.1|2114144_2114429_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	70.2	1.8e-34
AYY35912.1|2114534_2115239_-	helix-turn-helix domain-containing protein	NA	G8C7U1	Escherichia_phage	60.1	7.5e-69
AYY32887.1|2115344_2115605_+	hypothetical protein	NA	A0A1B5FPK9	Escherichia_phage	40.6	1.2e-08
AYY32888.1|2115633_2116164_+	DNA-binding protein	NA	A0A1C9II13	Salmonella_phage	62.4	6.1e-55
AYY32889.1|2116206_2116485_+	hypothetical protein	NA	NA	NA	NA	NA
AYY32890.1|2116646_2116922_+	hypothetical protein	NA	NA	NA	NA	NA
AYY32891.1|2116914_2118444_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	66.9	8.6e-203
AYY32892.1|2118440_2119412_+	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	60.7	3.0e-108
AYY35913.1|2119381_2120026_+	NinG family protein	NA	A0A1W6JNX3	Morganella_phage	53.6	2.5e-39
AYY32893.1|2120117_2120696_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.1	1.9e-49
AYY32894.1|2120791_2121067_-	hypothetical protein	NA	NA	NA	NA	NA
AYY32895.1|2121065_2121263_+	hypothetical protein	NA	NA	NA	NA	NA
AYY32896.1|2121573_2121849_-	hypothetical protein	NA	A9YWZ2	Burkholderia_phage	34.8	2.2e-08
AYY35914.1|2122108_2122408_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	83.8	4.5e-39
AYY32897.1|2122404_2122944_+	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	7.4e-101
AYY32898.1|2122940_2123288_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.9	1.0e-39
AYY32899.1|2123284_2123554_+	hypothetical protein	NA	NA	NA	NA	NA
AYY32900.1|2123510_2123708_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	82.1	2.6e-19
AYY32901.1|2123694_2123937_+	hypothetical protein	NA	NA	NA	NA	NA
AYY32902.1|2124056_2124422_+	hypothetical protein	NA	NA	NA	NA	NA
AYY32903.1|2124541_2124727_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	63.0	4.9e-12
AYY32904.1|2125048_2125540_+	DUF1441 family protein	NA	K7PJY2	Enterobacterial_phage	83.4	3.2e-66
AYY32905.1|2125539_2127648_+|terminase	phage terminase large subunit family protein	terminase	K7PH52	Enterobacterial_phage	83.4	0.0e+00
AYY32906.1|2127644_2127860_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	77.1	7.7e-25
AYY32907.1|2127856_2129356_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	83.6	1.1e-247
AYY32908.1|2129300_2131301_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	86.1	0.0e+00
AYY32909.1|2131382_2131709_+	DUF2190 family protein	NA	K7PJY3	Enterobacterial_phage	67.3	2.1e-34
AYY32910.1|2131701_2131995_+	ATP-binding protein	NA	NA	NA	NA	NA
AYY32911.1|2131984_2132536_+|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	67.3	1.2e-53
AYY32912.1|2132532_2132931_+|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	59.4	2.4e-40
AYY32913.1|2132938_2133421_+|tail	phage tail protein	tail	O64327	Escherichia_phage	71.3	2.0e-60
AYY32914.1|2133463_2133859_+|tail	phage tail protein	tail	M9NZD7	Enterobacteria_phage	28.2	1.1e-08
AYY32915.1|2133879_2134197_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	51.5	1.4e-19
AYY32916.1|2134177_2136874_+|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	62.6	2.2e-201
AYY32917.1|2136873_2137347_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.8	6.6e-53
AYY32918.1|2137333_2137816_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	67.7	5.0e-56
AYY32919.1|2137823_2138210_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	50.8	4.7e-33
AYY32920.1|2138206_2141275_+	kinase	NA	A0A286S259	Klebsiella_phage	66.2	0.0e+00
AYY32921.1|2141349_2143503_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	85.3	2.2e-55
AYY32922.1|2143515_2144250_+	hypothetical protein	NA	NA	NA	NA	NA
AYY32923.1|2144261_2144591_-	hypothetical protein	NA	NA	NA	NA	NA
AYY32924.1|2144627_2144957_-	hypothetical protein	NA	NA	NA	NA	NA
AYY32925.1|2145410_2145662_+	hypothetical protein	NA	NA	NA	NA	NA
AYY32926.1|2145661_2147146_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AYY32927.1|2147219_2147459_+	DNA polymerase V	NA	I6PD82	Cronobacter_phage	55.7	1.2e-21
AYY32928.1|2147461_2147785_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.0	8.0e-26
AYY32929.1|2148838_2149303_+	hypothetical protein	NA	NA	NA	NA	NA
AYY32930.1|2149663_2150593_-	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	81.4	5.2e-134
2149551:2149575	attR	TTATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
AYY32931.1|2150882_2151644_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AYY32932.1|2151705_2153034_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
AYY32933.1|2153401_2153686_+	DUF406 family protein	NA	NA	NA	NA	NA
AYY32934.1|2153845_2155156_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AYY32935.1|2155155_2157300_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AYY32936.1|2157509_2157995_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
AYY32937.1|2158015_2158567_-	endonuclease SmrB	NA	NA	NA	NA	NA
AYY32938.1|2158734_2159667_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AYY32939.1|2159708_2160794_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	4.5e-89
AYY32940.1|2160796_2161621_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AYY32941.1|2161620_2162430_+	hypothetical protein	NA	NA	NA	NA	NA
AYY32942.1|2162429_2162978_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AYY32943.1|2163009_2163291_+	YfcL family protein	NA	NA	NA	NA	NA
AYY32944.1|2163352_2165341_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AYY32945.1|2165499_2166720_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
AYY32946.1|2166929_2168105_+	arabinose transporter	NA	NA	NA	NA	NA
AYY32947.1|2168191_2169169_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
AYY35915.1|2169303_2170416_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.0	3.5e-20
AYY32948.1|2170479_2171493_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AYY32949.1|2171492_2172305_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 2
CP033777	Klebsiella pneumoniae strain FDAARGOS_531 chromosome, complete genome	5423408	2376945	2383850	5423408		Planktothrix_phage(33.33%)	6	NA	NA
AYY35923.1|2376945_2377809_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
AYY33125.1|2377819_2378593_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
AYY35924.1|2378833_2379727_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	1.6e-15
AYY33126.1|2379972_2381334_-	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
AYY33127.1|2381652_2382375_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AYY33128.1|2382371_2383850_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 3
CP033777	Klebsiella pneumoniae strain FDAARGOS_531 chromosome, complete genome	5423408	3470468	3481355	5423408		Escherichia_phage(87.5%)	9	NA	NA
AYY34094.1|3470468_3473576_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AYY34095.1|3473630_3474896_+	MFS transporter	NA	NA	NA	NA	NA
AYY34096.1|3474926_3476015_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AYY34097.1|3476101_3476362_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
AYY34098.1|3476659_3477520_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
AYY34099.1|3477540_3478302_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AYY34100.1|3478562_3479465_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AYY34101.1|3479476_3480742_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
AYY34102.1|3480734_3481355_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 4
CP033777	Klebsiella pneumoniae strain FDAARGOS_531 chromosome, complete genome	5423408	4155901	4245950	5423408	portal,protease,head,tRNA,capsid,lysis,integrase,plate,tail	Salmonella_phage(54.39%)	93	4211538:4211558	4246688:4246708
AYY34699.1|4155901_4157194_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
AYY34700.1|4157284_4158628_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	5.6e-81
AYY34701.1|4158636_4159248_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AYY34702.1|4159370_4163624_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
AYY34703.1|4163759_4164254_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AYY34704.1|4164759_4165755_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.3e-62
AYY34705.1|4165869_4167636_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
AYY34706.1|4167636_4169358_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.0	9.0e-15
AYY34707.1|4169402_4170104_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AYY34708.1|4170457_4170676_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AYY34709.1|4170794_4173074_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AYY34710.1|4173104_4173422_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AYY34711.1|4173747_4173969_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AYY34712.1|4174045_4175986_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AYY34713.1|4175982_4177098_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
AYY34714.1|4177244_4178903_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AYY34715.1|4179322_4180018_+	aquaporin Z	NA	NA	NA	NA	NA
AYY34716.1|4180133_4181033_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
AYY36017.1|4181176_4182829_+	hydroxylamine reductase	NA	NA	NA	NA	NA
AYY34717.1|4182839_4183808_+	NADH oxidoreductase	NA	NA	NA	NA	NA
AYY34718.1|4184019_4184454_-	DoxX family protein	NA	NA	NA	NA	NA
AYY36018.1|4184605_4186324_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
AYY34719.1|4186362_4187364_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
AYY34720.1|4187374_4188817_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AYY34721.1|4188904_4189918_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AYY34722.1|4189914_4190745_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
AYY34723.1|4190776_4191916_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
AYY34724.1|4191968_4192148_+	hypothetical protein	NA	NA	NA	NA	NA
AYY34725.1|4192793_4193309_+	lipoprotein	NA	NA	NA	NA	NA
AYY34726.1|4193535_4194264_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
AYY36019.1|4194284_4195016_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYY34727.1|4195022_4195739_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
AYY34728.1|4195738_4196407_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
AYY34729.1|4196590_4197322_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYY34730.1|4197408_4198881_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
AYY34731.1|4198877_4199594_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.9	1.2e-34
AYY34732.1|4199672_4200800_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
AYY34733.1|4200841_4201330_-	DUF2593 family protein	NA	NA	NA	NA	NA
AYY34734.1|4201387_4202233_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
AYY34735.1|4202229_4203183_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
AYY36020.1|4203193_4204327_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
AYY34736.1|4204490_4205603_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
AYY34737.1|4205951_4206431_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
AYY34738.1|4206519_4207422_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.9	7.7e-34
AYY34739.1|4207536_4208259_-	nitroreductase NfsA	NA	NA	NA	NA	NA
AYY34740.1|4208242_4208530_-	DUF1418 family protein	NA	NA	NA	NA	NA
AYY34741.1|4208732_4208996_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
AYY34742.1|4209002_4209386_-	hypothetical protein	NA	NA	NA	NA	NA
AYY36021.1|4209652_4211338_+	transporter	NA	NA	NA	NA	NA
4211538:4211558	attL	TGGCGACAAAGTGGCGACAGC	NA	NA	NA	NA
AYY34743.1|4211559_4211778_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	66.2	8.3e-19
AYY34744.1|4211864_4212962_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	82.0	1.3e-168
AYY34745.1|4212958_4213444_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	77.6	5.0e-64
AYY34746.1|4213440_4216071_-|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	38.9	6.8e-115
AYY34747.1|4216063_4216183_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
AYY34748.1|4216197_4216497_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	77.0	1.4e-32
AYY34749.1|4216549_4217065_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
AYY34750.1|4217074_4218247_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.8	5.4e-205
AYY34751.1|4218385_4219546_-|tail	phage tail protein	tail	S4TP62	Salmonella_phage	50.0	1.2e-44
AYY34752.1|4219623_4219899_-	hypothetical protein	NA	NA	NA	NA	NA
AYY34753.1|4219912_4222138_-	endo-N-neuraminidase	NA	K4I5E8	Salmonella_phage	41.3	3.0e-10
AYY36022.1|4222143_4222740_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	56.0	1.8e-55
AYY34754.1|4222732_4223641_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	3.4e-106
AYY34755.1|4223627_4223990_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	9.9e-49
AYY34756.1|4223986_4224559_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	2.1e-77
AYY34757.1|4224662_4225325_+	hypothetical protein	NA	NA	NA	NA	NA
AYY34758.1|4225337_4225790_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.4	6.5e-50
AYY34759.1|4225782_4226214_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
AYY34760.1|4226176_4226380_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	78.5	5.2e-23
AYY34761.1|4226309_4226738_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	5.6e-51
AYY34762.1|4226742_4227252_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	9.5e-82
AYY34763.1|4227232_4227448_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	85.9	1.5e-28
AYY34764.1|4227451_4227655_-|tail	phage tail protein	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
AYY34765.1|4227654_4228119_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	84.4	6.7e-74
AYY34766.1|4228215_4228866_-	hypothetical protein	NA	E5G6M7	Salmonella_phage	86.6	9.6e-103
AYY34767.1|4228869_4229922_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	89.1	2.1e-171
AYY34768.1|4229938_4230772_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	74.4	2.2e-99
AYY34769.1|4230911_4232675_+	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	92.6	0.0e+00
AYY34770.1|4232674_4233703_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	90.3	6.2e-173
AYY34771.1|4233749_4235414_-	hypothetical protein	NA	X2KLG0	Campylobacter_phage	24.9	4.5e-11
AYY34772.1|4235404_4235635_-	hypothetical protein	NA	NA	NA	NA	NA
AYY34773.1|4235709_4235895_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	50.0	5.6e-08
AYY34774.1|4235970_4237455_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AYY34775.1|4237454_4237706_-	hypothetical protein	NA	NA	NA	NA	NA
AYY34776.1|4240321_4240549_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	80.0	7.8e-28
AYY34777.1|4240548_4240785_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	55.4	8.2e-12
AYY34778.1|4240852_4241194_-	hypothetical protein	NA	E5G6L5	Salmonella_phage	80.5	1.3e-45
AYY34779.1|4241157_4241358_-	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	80.3	1.2e-24
AYY34780.1|4241365_4241875_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	82.1	1.4e-72
AYY34781.1|4241907_4242129_-	regulator	NA	NA	NA	NA	NA
AYY34782.1|4242254_4242815_+	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	44.8	2.0e-40
AYY34783.1|4242826_4243411_+	hypothetical protein	NA	NA	NA	NA	NA
AYY34784.1|4244473_4244845_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	52.4	6.2e-30
AYY34785.1|4244924_4245950_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	55.8	5.2e-103
4246688:4246708	attR	TGGCGACAAAGTGGCGACAGC	NA	NA	NA	NA
>prophage 5
CP033777	Klebsiella pneumoniae strain FDAARGOS_531 chromosome, complete genome	5423408	4695366	4743625	5423408	integrase,tRNA,terminase,head	Salmonella_phage(23.21%)	69	4722707:4722722	4744658:4744673
AYY35172.1|4695366_4697544_-	hypothetical protein	NA	B5TAB2	Burkholderia_phage	42.7	1.3e-82
AYY35173.1|4697616_4700091_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.7	1.9e-204
AYY35174.1|4700077_4700473_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	52.0	1.8e-35
AYY35175.1|4700469_4700940_-	DUF1833 domain-containing protein	NA	F1C5F1	Cronobacter_phage	36.4	3.2e-23
AYY36039.1|4700939_4701359_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.5	8.2e-31
AYY35176.1|4701458_4704827_-	hypothetical protein	NA	Q5G8W8	Enterobacteria_phage	71.4	6.1e-302
AYY35177.1|4704886_4705300_-	hypothetical protein	NA	NA	NA	NA	NA
AYY35178.1|4705351_4705693_-	hypothetical protein	NA	NA	NA	NA	NA
AYY35179.1|4705765_4705978_-	hypothetical protein	NA	H6WRV2	Salmonella_phage	60.3	2.7e-14
AYY35180.1|4706057_4706417_-	hypothetical protein	NA	A0A1V0E5N7	Salmonella_phage	54.2	6.8e-34
AYY35181.1|4706533_4707064_-	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	85.8	1.2e-82
AYY35182.1|4707244_4707949_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	55.1	9.5e-64
AYY35183.1|4708840_4709224_-	hypothetical protein	NA	NA	NA	NA	NA
AYY35184.1|4709220_4709442_-	hypothetical protein	NA	A0A1V0E8A3	Vibrio_phage	54.7	4.2e-10
AYY35185.1|4709435_4709804_-	HK97 gp10 family phage protein	NA	F1C5E3	Cronobacter_phage	83.6	7.7e-49
AYY35186.1|4709806_4710169_-	hypothetical protein	NA	A0A1B1W262	Salmonella_phage	45.0	8.1e-19
AYY35187.1|4710168_4710342_-	50S ribosomal protein L13	NA	I6R0P9	Salmonella_phage	54.4	4.1e-13
AYY35188.1|4710341_4710722_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	56.1	3.7e-30
AYY35189.1|4710724_4711012_-	hypothetical protein	NA	A0A0M3LR32	Mannheimia_phage	75.6	1.4e-13
AYY35190.1|4711052_4712084_-	DUF2184 domain-containing protein	NA	A0A0M3LQZ1	Mannheimia_phage	52.9	4.3e-97
AYY35191.1|4712095_4712533_-	hypothetical protein	NA	A0A0M3LPQ2	Mannheimia_phage	47.1	1.2e-24
AYY35192.1|4712532_4713912_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	52.4	3.7e-128
AYY35193.1|4713985_4714561_-	HNH endonuclease	NA	Q4TZV0	Escherichia_virus	39.9	1.3e-23
AYY36040.1|4714856_4715855_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	70.5	3.3e-118
AYY35194.1|4715790_4717242_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	53.3	3.2e-122
AYY35195.1|4717253_4718822_-|terminase	terminase	terminase	G8C7P3	Escherichia_phage	89.1	1.1e-293
AYY35196.1|4718818_4719469_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	88.9	1.1e-101
AYY35197.1|4719831_4720020_-	rz1 lytic protein	NA	U5P461	Shigella_phage	58.5	2.1e-10
AYY35198.1|4720000_4720378_-	DUF2570 domain-containing protein	NA	M9NYX9	Enterobacteria_phage	47.5	6.1e-09
AYY35199.1|4720478_4720982_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	79.0	5.9e-76
AYY35200.1|4720984_4721299_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	8.3e-44
AYY35201.1|4722053_4722554_-	antiterminator	NA	G8C7V7	Escherichia_phage	92.1	8.7e-88
AYY35202.1|4722550_4722691_-	YlcG family protein	NA	NA	NA	NA	NA
AYY35203.1|4722687_4722918_-	hypothetical protein	NA	NA	NA	NA	NA
4722707:4722722	attL	ATAGCCTTGGTCATCG	NA	NA	NA	NA
AYY35204.1|4722914_4723277_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	80.7	1.2e-51
AYY35205.1|4723273_4723564_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	87.5	5.9e-44
AYY35206.1|4723556_4723727_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	63.0	6.1e-09
AYY35207.1|4723707_4724175_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	47.9	2.0e-33
AYY35208.1|4724368_4724626_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	75.3	5.8e-27
AYY35209.1|4724712_4725039_-	hypothetical protein	NA	NA	NA	NA	NA
AYY35210.1|4725201_4725516_-	hypothetical protein	NA	A0A220NQY7	Salmonella_phage	35.6	2.6e-05
AYY35211.1|4725508_4725697_-	hypothetical protein	NA	R9TNE4	Aeromonas_phage	76.3	5.0e-20
AYY35212.1|4725696_4725957_-	eaa protein	NA	A0A077SLR0	Escherichia_phage	70.9	9.0e-28
AYY35213.1|4725949_4726858_-	DUF551 domain-containing protein	NA	R9TQX3	Aeromonas_phage	79.8	1.4e-64
AYY35214.1|4726990_4727551_-	ead/Ea22-like family protein	NA	A0A2H4N7C3	Pectobacterium_phage	66.1	3.3e-35
AYY35215.1|4727543_4727807_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	75.6	2.2e-29
AYY35216.1|4728216_4728510_-	protein ren	NA	O48423	Enterobacteria_phage	64.5	9.5e-26
AYY35217.1|4728509_4729940_-	helicase DnaB	NA	Q9MCT4	Escherichia_phage	66.7	2.6e-185
AYY35218.1|4729929_4730829_-	DNA replication protein	NA	A0A0N7C1Z7	Escherichia_phage	55.0	8.4e-81
AYY35219.1|4731002_4731287_-	hypothetical protein	NA	K7PHN8	Enterobacterial_phage	57.4	8.1e-22
AYY35220.1|4731326_4731560_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	70.4	3.0e-22
AYY35221.1|4731664_4732354_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	70.6	1.0e-86
AYY36041.1|4732376_4732496_+	hypothetical protein	NA	NA	NA	NA	NA
AYY36042.1|4732694_4733522_+	hypothetical protein	NA	NA	NA	NA	NA
AYY35222.1|4733518_4734328_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
AYY35223.1|4734373_4734577_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	73.1	1.2e-19
AYY35224.1|4735004_4735199_+	hypothetical protein	NA	NA	NA	NA	NA
AYY35225.1|4735287_4735572_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	63.8	8.0e-30
AYY35226.1|4735587_4736433_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
AYY35227.1|4736429_4737110_+	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	93.4	4.6e-124
AYY35228.1|4737106_4737535_+	regulator	NA	M9NYX4	Enterobacteria_phage	81.0	2.6e-64
AYY35229.1|4738183_4738402_+	hypothetical protein	NA	NA	NA	NA	NA
AYY35230.1|4738398_4739091_+	hypothetical protein	NA	M1F3E2	Salmonella_phage	58.0	4.5e-66
AYY35231.1|4739087_4739306_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	49.3	2.9e-11
AYY36043.1|4739307_4739643_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYY36044.1|4739639_4740683_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	85.9	2.2e-178
AYY35232.1|4741113_4741980_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
AYY35233.1|4741981_4742194_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
AYY35234.1|4742239_4743625_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
4744658:4744673	attR	CGATGACCAAGGCTAT	NA	NA	NA	NA
>prophage 1
CP033774	Klebsiella pneumoniae strain FDAARGOS_531 plasmid unnamed1, complete sequence	184336	76764	141737	184336	integrase,transposase,protease	uncultured_Caudovirales_phage(26.32%)	58	68593:68607	88535:88549
68593:68607	attL	AAAGCTGCACGTTAT	NA	NA	NA	NA
AYY30715.1|76764_77505_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
AYY30716.1|78648_79596_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
AYY30717.1|79622_79934_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AYY30718.1|79998_80922_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
AYY30719.1|81594_81852_-	hypothetical protein	NA	NA	NA	NA	NA
AYY30720.1|82454_83909_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AYY30721.1|84891_86169_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
AYY30804.1|86231_88229_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
AYY30805.1|89268_90476_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
88535:88549	attR	ATAACGTGCAGCTTT	NA	NA	NA	NA
AYY30722.1|91904_92336_-	silver-binding protein SilE	NA	NA	NA	NA	NA
AYY30723.1|92586_94062_-	Cu(+)/Ag(+) sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
AYY30724.1|94054_94735_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
AYY30725.1|94924_96310_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
AYY30726.1|96338_96692_+	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYY30727.1|96805_98098_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYY30728.1|98108_101255_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
AYY30729.1|101341_101782_+	hypothetical protein	NA	NA	NA	NA	NA
AYY30730.1|101908_104356_+	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
AYY30731.1|104396_104594_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AYY30732.1|104627_105365_-	peptidase M23	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
AYY30733.1|105653_106103_-	copper resistance protein	NA	NA	NA	NA	NA
AYY30734.1|106336_108154_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
AYY30735.1|108153_109050_+	copper resistance protein B	NA	NA	NA	NA	NA
AYY30736.1|109089_109470_+	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
AYY30737.1|109474_110404_+	copper resistance protein D	NA	NA	NA	NA	NA
AYY30738.1|110458_111139_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
AYY30739.1|111135_112536_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
AYY30740.1|112752_113187_+	copper-binding protein	NA	NA	NA	NA	NA
AYY30741.1|113418_113598_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AYY30742.1|115340_115850_+	porin	NA	NA	NA	NA	NA
AYY30806.1|115899_116397_-	N-acetyltransferase	NA	NA	NA	NA	NA
AYY30743.1|116728_117055_+	transcriptional regulator	NA	NA	NA	NA	NA
AYY30807.1|117054_117765_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
AYY30744.1|117773_118319_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AYY30745.1|118394_118757_+	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AYY30746.1|120653_121190_+	N-acetyltransferase	NA	NA	NA	NA	NA
AYY30747.1|121222_121648_-	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
AYY30748.1|121660_122950_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
AYY30749.1|122997_124749_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AYY30750.1|124766_125129_-	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AYY30751.1|125178_125529_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
AYY30752.1|125886_126156_+	hypothetical protein	NA	NA	NA	NA	NA
AYY30753.1|126143_126719_+	hypothetical protein	NA	NA	NA	NA	NA
AYY30754.1|126749_127244_+	DNA-binding protein	NA	NA	NA	NA	NA
AYY30755.1|127287_127656_+	hypothetical protein	NA	NA	NA	NA	NA
AYY30756.1|127689_127893_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
AYY30757.1|127941_128199_+	hypothetical protein	NA	NA	NA	NA	NA
AYY30758.1|128274_128529_+	hypothetical protein	NA	NA	NA	NA	NA
AYY30759.1|128704_128971_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AYY30760.1|128958_129441_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYY30808.1|129652_130999_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AYY30761.1|132841_133804_-|protease	Zn-dependent protease	protease	NA	NA	NA	NA
AYY30762.1|133790_134540_-	diguanylate cyclase	NA	NA	NA	NA	NA
AYY30763.1|134777_134975_-	hypothetical protein	NA	NA	NA	NA	NA
AYY30764.1|134974_137770_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
AYY30765.1|137884_138454_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AYY30809.1|138488_138770_-	DNA-binding protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
AYY30766.1|140756_141737_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 1
CP033775	Klebsiella pneumoniae strain FDAARGOS_531 plasmid unnamed2, complete sequence	74543	0	4641	74543	integrase,transposase	Virus_Rctr41k(33.33%)	3	NA	NA
AYY30813.1|252_1266_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYY30814.1|1757_2462_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYY30815.1|2946_4641_-	response regulator	NA	A0A1V0SGX0	Hokovirus	27.9	2.1e-24
>prophage 2
CP033775	Klebsiella pneumoniae strain FDAARGOS_531 plasmid unnamed2, complete sequence	74543	33645	34179	74543		Wolbachia_phage(100.0%)	1	NA	NA
AYY30838.1|33645_34179_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	34.6	7.0e-19
>prophage 3
CP033775	Klebsiella pneumoniae strain FDAARGOS_531 plasmid unnamed2, complete sequence	74543	37233	39662	74543		Morganella_phage(25.0%)	4	NA	NA
AYY30840.1|37233_37659_+	peptidase	NA	A0A1W6JNS2	Morganella_phage	49.3	3.7e-31
AYY30841.1|37658_38924_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	55.0	6.2e-122
AYY30842.1|39070_39352_-	XRE family transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
AYY30843.1|39332_39662_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
>prophage 4
CP033775	Klebsiella pneumoniae strain FDAARGOS_531 plasmid unnamed2, complete sequence	74543	43079	45920	74543	integrase	Klebsiella_phage(33.33%)	4	39159:39174	46700:46715
39159:39174	attL	TCCAGGCGGGAAATAA	NA	NA	NA	NA
AYY30848.1|43079_43328_+	XRE family transcriptional regulator	NA	A0A248SLB9	Klebsiella_phage	51.5	1.6e-10
AYY30849.1|43412_43898_+	hypothetical protein	NA	NA	NA	NA	NA
AYY30892.1|44027_44705_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	51.6	1.1e-21
AYY30850.1|44945_45920_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	51.7	7.2e-86
46700:46715	attR	TCCAGGCGGGAAATAA	NA	NA	NA	NA
>prophage 5
CP033775	Klebsiella pneumoniae strain FDAARGOS_531 plasmid unnamed2, complete sequence	74543	49308	50169	74543		Marinomonas_phage(100.0%)	1	NA	NA
AYY30856.1|49308_50169_+	DUF4942 domain-containing protein	NA	I6RTT5	Marinomonas_phage	29.9	4.8e-17
>prophage 6
CP033775	Klebsiella pneumoniae strain FDAARGOS_531 plasmid unnamed2, complete sequence	74543	62757	65273	74543	transposase	Escherichia_phage(66.67%)	3	NA	NA
AYY30871.1|62757_63462_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYY30872.1|63617_64433_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
AYY30873.1|64568_65273_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
>prophage 7
CP033775	Klebsiella pneumoniae strain FDAARGOS_531 plasmid unnamed2, complete sequence	74543	68611	72450	74543	transposase	Escherichia_phage(50.0%)	7	NA	NA
AYY30878.1|68611_69376_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AYY30879.1|69404_69587_+	resolvase	NA	NA	NA	NA	NA
AYY30880.1|69602_69908_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AYY30881.1|69918_71124_-	chromate efflux transporter	NA	NA	NA	NA	NA
AYY30882.1|71279_71483_-	hypothetical protein	NA	NA	NA	NA	NA
AYY30883.1|71501_71681_+	hypothetical protein	NA	NA	NA	NA	NA
AYY30884.1|71610_72450_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
>prophage 1
CP033776	Klebsiella pneumoniae strain FDAARGOS_531 plasmid unnamed3, complete sequence	73896	41342	47291	73896	transposase	Stx2-converting_phage(50.0%)	6	NA	NA
AYY30912.1|41342_42040_-|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	93.5	1.9e-125
AYY30913.1|42188_43622_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	51.5	4.1e-106
AYY30914.1|43655_44864_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
AYY30915.1|44980_46519_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	90.8	2.8e-270
AYY30916.1|46569_46917_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	96.5	1.8e-60
AYY30917.1|46913_47291_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	90.5	3.2e-58
>prophage 2
CP033776	Klebsiella pneumoniae strain FDAARGOS_531 plasmid unnamed3, complete sequence	73896	56101	64735	73896	integrase,transposase	Escherichia_phage(37.5%)	10	52494:52507	65306:65319
52494:52507	attL	CCCAAGGCACTTTG	NA	NA	NA	NA
AYY30923.1|56101_56893_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	87.8	1.2e-51
AYY30924.1|57332_57512_-	Par-like protein	NA	NA	NA	NA	NA
AYY30925.1|57631_58258_-	cobyrinic acid ac-diamide synthase	NA	E5FFJ3	Burkholderia_phage	30.1	3.8e-16
AYY30926.1|58628_59333_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYY30927.1|59784_60905_-|transposase	IS3-like element ISKpn34 family transposase	transposase	S5WIU1	Leptospira_phage	43.3	1.1e-50
AYY30928.1|60973_61819_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.7	6.0e-81
AYY30929.1|62230_62899_-	DUF4113 domain-containing protein	NA	F1C5A5	Cronobacter_phage	65.5	1.1e-74
AYY30930.1|62908_63613_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYY30931.1|63603_63990_+	hypothetical protein	NA	NA	NA	NA	NA
AYY30932.1|64399_64735_-	thermonuclease family protein	NA	G8DH70	Emiliania_huxleyi_virus	35.7	2.8e-05
65306:65319	attR	CAAAGTGCCTTGGG	NA	NA	NA	NA
