The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033756	Klebsiella pneumoniae strain FDAARGOS_566 chromosome 1, complete sequence	5305851	933620	940525	5305851		Bacillus_phage(33.33%)	6	NA	NA
AYY20672.1|933620_935099_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
AYY20673.1|935095_935818_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
AYY20674.1|936136_937498_+	U32 family peptidase	NA	Q6DW11	Phage_TP	94.8	1.8e-207
AYY24627.1|937743_938637_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	3.6e-15
AYY20675.1|938877_939651_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
AYY24628.1|939661_940525_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 2
CP033756	Klebsiella pneumoniae strain FDAARGOS_566 chromosome 1, complete sequence	5305851	3949410	3998283	5305851	integrase,head,coat,tRNA	Cronobacter_phage(25.49%)	70	3952293:3952339	3998895:3998941
AYY23378.1|3949410_3950796_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
AYY23379.1|3950841_3951054_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
AYY23380.1|3951055_3951922_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
3952293:3952339	attL	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCATT	NA	NA	NA	NA
AYY24742.1|3952352_3953396_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	85.6	8.5e-178
AYY23381.1|3953392_3953728_-	DNA-binding protein	NA	NA	NA	NA	NA
AYY23382.1|3953729_3953948_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.2	3.4e-12
AYY23383.1|3953944_3954136_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	62.7	6.0e-13
AYY23384.1|3954132_3954618_-	hypothetical protein	NA	A0A076G835	Escherichia_phage	62.9	2.5e-31
AYY23385.1|3954614_3954839_-	hypothetical protein	NA	G8C7U9	Escherichia_phage	73.2	7.0e-21
AYY24743.1|3955054_3955582_-	phage N-6-adenine-methyltransferase	NA	G8EYI1	Enterobacteria_phage	62.8	1.3e-57
AYY23386.1|3955610_3956234_-	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	60.2	5.3e-58
AYY23387.1|3956230_3956977_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	67.7	3.1e-65
AYY23388.1|3956993_3957278_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	4.3e-39
AYY23389.1|3957366_3957561_-	hypothetical protein	NA	NA	NA	NA	NA
AYY23390.1|3957988_3958192_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	70.1	2.3e-18
AYY23391.1|3958228_3959110_-	hypothetical protein	NA	NA	NA	NA	NA
AYY23392.1|3959096_3959861_-	hypothetical protein	NA	NA	NA	NA	NA
AYY24744.1|3959985_3960105_-	hypothetical protein	NA	NA	NA	NA	NA
AYY23393.1|3960127_3960817_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	70.6	1.0e-86
AYY23394.1|3960921_3961155_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	70.4	3.0e-22
AYY23395.1|3961194_3961416_+	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AYY24745.1|3961549_3962278_+	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.0	7.8e-37
AYY23396.1|3962274_3963051_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	65.0	1.1e-94
AYY23397.1|3963050_3963353_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYY23398.1|3963349_3963757_+	hypothetical protein	NA	NA	NA	NA	NA
AYY23399.1|3963753_3964014_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	75.6	2.8e-29
AYY23400.1|3964120_3964804_+	ead/Ea22-like family protein	NA	A0A075B8K3	Enterobacteria_phage	45.6	2.1e-31
AYY24746.1|3965372_3966098_+	DUF551 domain-containing protein	NA	K7PH64	Enterobacterial_phage	47.0	9.9e-16
AYY23401.1|3966097_3966286_+	hypothetical protein	NA	R9TNE4	Aeromonas_phage	75.0	5.5e-19
AYY23402.1|3966451_3966772_+	hypothetical protein	NA	NA	NA	NA	NA
AYY23403.1|3967032_3967629_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	53.8	1.4e-55
AYY24747.1|3967634_3967805_+	NinE family protein	NA	G8C7V4	Escherichia_phage	71.4	2.8e-14
AYY23404.1|3967797_3968433_+	NinG family protein	NA	M9NYX8	Enterobacteria_phage	78.4	2.0e-81
AYY23405.1|3968429_3968570_+	YlcG family protein	NA	NA	NA	NA	NA
AYY23406.1|3968566_3969376_+	antitermination protein	NA	M9NZB0	Enterobacteria_phage	75.5	3.8e-117
AYY23407.1|3969693_3969888_-	hypothetical protein	NA	NA	NA	NA	NA
AYY23408.1|3969882_3970197_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	6.3e-44
AYY23409.1|3970199_3970694_+	lysozyme	NA	M9P0E5	Enterobacteria_phage	92.1	2.1e-86
AYY23410.1|3970690_3971041_+	hypothetical protein	NA	H2EQH5	Salmonella_phage	38.9	4.6e-11
AYY23411.1|3971787_3972423_+	hypothetical protein	NA	I6S676	Salmonella_phage	81.1	2.3e-101
AYY23412.1|3972453_3972933_+	DUF2280 domain-containing protein	NA	F1C5D6	Cronobacter_phage	74.8	2.5e-63
AYY23413.1|3972919_3974392_+	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	86.1	7.9e-254
AYY23414.1|3974403_3975852_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	51.5	1.5e-119
AYY23415.1|3975769_3976774_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	68.7	2.9e-114
AYY23416.1|3977186_3978572_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	64.0	5.8e-166
AYY23417.1|3978575_3979007_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	6.2e-42
AYY23418.1|3979018_3980116_+|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	73.6	3.2e-151
AYY23419.1|3980125_3980446_+	hypothetical protein	NA	NA	NA	NA	NA
AYY23420.1|3980448_3980829_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	56.1	1.4e-29
AYY23421.1|3980828_3981002_+	50S ribosomal protein L13	NA	I6R0P9	Salmonella_phage	56.1	1.9e-13
AYY23422.1|3981001_3981364_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	48.3	5.6e-20
AYY23423.1|3981366_3981792_+	HK97 gp10 family phage protein	NA	R9TPP7	Aeromonas_phage	48.6	1.3e-28
AYY23424.1|3981788_3982181_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	51.2	9.7e-34
AYY23425.1|3982249_3983002_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
AYY23426.1|3983054_3983732_+	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.5	1.8e-72
AYY23427.1|3983907_3984663_+	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	1.8e-60
AYY23428.1|3984665_3984920_+	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
AYY24748.1|3984994_3985333_+	hypothetical protein	NA	NA	NA	NA	NA
AYY24749.1|3985340_3985661_+	hypothetical protein	NA	NA	NA	NA	NA
AYY23429.1|3985712_3985901_-	hypothetical protein	NA	NA	NA	NA	NA
AYY24750.1|3986124_3986352_+	hypothetical protein	NA	NA	NA	NA	NA
AYY23430.1|3986454_3986958_+	hypothetical protein	NA	NA	NA	NA	NA
AYY23431.1|3987052_3990493_+	hypothetical protein	NA	Q5G8W8	Enterobacteria_phage	46.2	7.5e-154
AYY23432.1|3990492_3991026_+	hypothetical protein	NA	NA	NA	NA	NA
AYY24751.1|3991125_3991545_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	47.1	4.1e-30
AYY23433.1|3991544_3992015_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	9.6e-28
AYY23434.1|3992011_3992407_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	55.6	1.2e-36
AYY23435.1|3992393_3994871_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	3.9e-197
AYY23436.1|3996754_3997372_+	hypothetical protein	NA	NA	NA	NA	NA
AYY23437.1|3997380_3998283_+	hypothetical protein	NA	D4P7M2	Rhodococcus_phage	36.6	5.3e-35
3998895:3998941	attR	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCATT	NA	NA	NA	NA
>prophage 3
CP033756	Klebsiella pneumoniae strain FDAARGOS_566 chromosome 1, complete sequence	5305851	5175621	5228206	5305851	integrase,lysis,coat,tail,terminase	Salmonella_phage(20.45%)	61	5178661:5178676	5224769:5224784
AYY24452.1|5175621_5177085_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.3	7.8e-44
AYY24453.1|5177350_5177782_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	40.7	2.7e-21
AYY24454.1|5177832_5178519_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYY24455.1|5178610_5179360_-	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
5178661:5178676	attL	TCATCTCCAGGGTGTT	NA	NA	NA	NA
AYY24456.1|5179490_5181533_+	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	20.5	1.1e-16
AYY24457.1|5181686_5182826_-|integrase	integrase	integrase	Q77Z04	Phage_21	48.2	3.5e-92
AYY24458.1|5182806_5183064_-	hypothetical protein	NA	NA	NA	NA	NA
AYY24459.1|5183123_5183363_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	70.5	2.5e-24
AYY24809.1|5183403_5184513_-	enterohemolysin	NA	H6WRX0	Salmonella_phage	86.4	1.7e-184
AYY24460.1|5184525_5187636_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	57.8	3.6e-296
AYY24461.1|5187773_5187929_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	71.2	2.0e-14
AYY24462.1|5187937_5188129_-	DUF1482 family protein	NA	NA	NA	NA	NA
AYY24810.1|5188235_5188334_-	hypothetical protein	NA	NA	NA	NA	NA
AYY24463.1|5188703_5189276_-	hypothetical protein	NA	NA	NA	NA	NA
AYY24464.1|5189499_5189679_-	hypothetical protein	NA	NA	NA	NA	NA
AYY24465.1|5189872_5190286_-	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	79.0	2.1e-47
AYY24466.1|5190358_5190586_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	63.5	1.9e-21
AYY24467.1|5190588_5191125_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	68.9	4.0e-62
AYY24468.1|5191253_5192048_+	ParB/RepB/Spo0J family partition protein	NA	C7BGF1	Burkholderia_phage	51.3	2.8e-64
AYY24811.1|5192113_5192953_+	hypothetical protein	NA	Q8HA96	Salmonella_phage	52.2	5.1e-24
AYY24469.1|5193712_5194081_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	8.3e-11
AYY24470.1|5194840_5196208_+	hypothetical protein	NA	Q2P9X8	Enterobacteria_phage	26.9	1.9e-20
AYY24471.1|5196209_5196938_+	hypothetical protein	NA	NA	NA	NA	NA
AYY24472.1|5197713_5198049_+	hypothetical protein	NA	NA	NA	NA	NA
AYY24473.1|5198680_5198953_+	colicin immunity protein	NA	NA	NA	NA	NA
AYY24474.1|5199645_5199879_+	hypothetical protein	NA	A0A0M4R5D9	Salmonella_phage	57.1	9.9e-18
AYY24475.1|5199914_5200511_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	78.6	1.2e-88
AYY24476.1|5200510_5200717_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	74.2	1.6e-24
AYY24477.1|5200719_5201016_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	74.0	1.2e-36
AYY24478.1|5201012_5201828_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	69.6	5.2e-106
AYY24479.1|5202080_5202707_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
AYY24480.1|5203339_5203564_+|lysis	lysis protein	lysis	M9NZI9	Enterobacteria_phage	91.9	4.0e-32
AYY24481.1|5203541_5204036_+	lysozyme	NA	M9P0E5	Enterobacteria_phage	92.1	6.2e-86
AYY24482.1|5204032_5204383_+	hypothetical protein	NA	H2EQH5	Salmonella_phage	38.9	7.9e-11
AYY24483.1|5204583_5204823_-	hypothetical protein	NA	NA	NA	NA	NA
AYY24484.1|5205962_5206145_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	75.0	4.1e-19
AYY24485.1|5206403_5206976_+	hypothetical protein	NA	A0A0U2RXY7	Escherichia_phage	54.3	3.8e-55
AYY24486.1|5206965_5208033_-	hypothetical protein	NA	NA	NA	NA	NA
AYY24487.1|5208947_5209193_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	100.0	8.4e-36
AYY24488.1|5209542_5210547_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	43.8	3.5e-35
AYY24489.1|5210524_5211829_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	60.3	2.8e-146
AYY24490.1|5211833_5213258_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	71.7	3.4e-193
AYY24491.1|5213241_5214354_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	53.6	4.5e-108
AYY24492.1|5214460_5215225_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	59.1	2.4e-76
AYY24493.1|5215312_5216449_+|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	75.7	2.0e-156
AYY24494.1|5216488_5216701_+	hypothetical protein	NA	G8C7P8	Escherichia_phage	53.7	1.2e-09
AYY24495.1|5216704_5217115_+	protein singed	NA	A0A0H5AUF0	Pseudomonas_phage	38.2	1.1e-08
AYY24496.1|5217116_5217413_+	hypothetical protein	NA	A0A1V0E8A3	Vibrio_phage	50.0	5.6e-10
AYY24497.1|5217384_5217768_+	glutamate 5-kinase	NA	A0A0S2SYG4	Pseudomonas_phage	44.4	3.5e-20
AYY24498.1|5217769_5218321_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.3	1.7e-28
AYY24499.1|5218317_5218710_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
AYY24500.1|5218733_5219666_+	hypothetical protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.7e-23
AYY24501.1|5219703_5220186_+	hypothetical protein	NA	NA	NA	NA	NA
AYY24502.1|5220323_5220521_+	hypothetical protein	NA	NA	NA	NA	NA
AYY24503.1|5220587_5221271_+	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	42.4	4.9e-41
AYY24812.1|5221379_5221748_+	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	40.2	3.4e-12
AYY24504.1|5221820_5224934_+|tail	phage tail protein	tail	A0A2D1GPC9	Escherichia_phage	31.9	3.1e-90
5224769:5224784	attR	TCATCTCCAGGGTGTT	NA	NA	NA	NA
AYY24505.1|5225017_5225353_+	hypothetical protein	NA	NA	NA	NA	NA
AYY24506.1|5225666_5226140_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.9	2.5e-60
AYY24507.1|5226126_5226603_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	93.0	3.2e-79
AYY24508.1|5227825_5228206_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	88.9	3.0e-64
>prophage 4
CP033756	Klebsiella pneumoniae strain FDAARGOS_566 chromosome 1, complete sequence	5305851	5256569	5267456	5305851		Escherichia_phage(87.5%)	9	NA	NA
AYY24534.1|5256569_5257190_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
AYY24535.1|5257182_5258448_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	100.0	2.7e-234
AYY24536.1|5258459_5259362_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AYY24537.1|5259622_5260384_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AYY24538.1|5260404_5261265_-	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
AYY24539.1|5261562_5261823_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	100.0	1.9e-41
AYY24540.1|5261909_5262998_+	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AYY24541.1|5263028_5264294_-	MFS transporter	NA	NA	NA	NA	NA
AYY24542.1|5264348_5267456_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 1
CP033755	Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed1, complete sequence	103852	5899	12942	103852	integrase	Escherichia_phage(50.0%)	7	2746:2758	6799:6811
2746:2758	attL	AATTAATGTGATT	NA	NA	NA	NA
AYY19697.1|5899_6694_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
AYY19698.1|7173_7353_-	Par-like protein	NA	NA	NA	NA	NA
6799:6811	attR	AATCACATTAATT	NA	NA	NA	NA
AYY19806.1|7472_8099_-	cobyrinic acid ac-diamide synthase	NA	A0A222YXS3	Escherichia_phage	43.6	2.9e-40
AYY19699.1|8747_9623_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
AYY19700.1|10034_11306_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.0	5.2e-153
AYY19701.1|11305_11737_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
AYY19702.1|11970_12942_+	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
>prophage 1
CP033758	Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed2	232752	20652	142484	232752	transposase,protease	Caulobacter_phage(11.54%)	106	NA	NA
AYY24843.1|20652_21657_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AYY24844.1|22003_22282_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AYY24845.1|23332_23536_+	hypothetical protein	NA	NA	NA	NA	NA
AYY24846.1|23565_23880_+	hypothetical protein	NA	NA	NA	NA	NA
AYY24847.1|24209_25214_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AYY24848.1|25653_26406_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYY24849.1|26646_27516_+	DMT family transporter	NA	NA	NA	NA	NA
AYY24850.1|27649_28873_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AYY24851.1|29058_29832_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AYY24852.1|29897_30599_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
AYY24853.1|30664_31771_-	alkene reductase	NA	NA	NA	NA	NA
AYY25008.1|31984_32314_+	thioredoxin	NA	V9SJ74	Achromobacter_phage	34.7	1.3e-10
AYY24854.1|32343_32682_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AYY24855.1|32686_33268_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYY24856.1|33409_33967_-	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AYY24857.1|34921_35926_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AYY24858.1|36399_36852_-	hypothetical protein	NA	NA	NA	NA	NA
AYY24859.1|38662_39001_-	hypothetical protein	NA	NA	NA	NA	NA
AYY25009.1|39006_39663_-	hypothetical protein	NA	NA	NA	NA	NA
AYY24860.1|40498_41398_-	RepB family plasmid replication initiator protein	NA	A0A1B0VDL5	Salmonella_phage	49.0	6.9e-67
AYY24861.1|41718_42780_-	hypothetical protein	NA	NA	NA	NA	NA
AYY24862.1|42865_43120_-	hypothetical protein	NA	NA	NA	NA	NA
AYY24863.1|43296_44433_+	recombinase	NA	NA	NA	NA	NA
AYY24864.1|44498_44816_-	hypothetical protein	NA	NA	NA	NA	NA
AYY24865.1|44967_45291_-	hypothetical protein	NA	NA	NA	NA	NA
AYY24866.1|45287_46046_-	hypothetical protein	NA	NA	NA	NA	NA
AYY24867.1|46042_47002_-	DNA replication protein	NA	NA	NA	NA	NA
AYY24868.1|47044_47452_-	hypothetical protein	NA	NA	NA	NA	NA
AYY24869.1|47461_47926_-	hypothetical protein	NA	NA	NA	NA	NA
AYY24870.1|47973_48216_-	hypothetical protein	NA	NA	NA	NA	NA
AYY24871.1|48629_48980_+|transposase	transposase	transposase	Q716C1	Shigella_phage	93.2	4.9e-37
AYY24872.1|48899_50051_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
AYY24873.1|50992_52069_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AYY24874.1|53871_54393_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AYY24875.1|54389_55343_+	fec operon regulator FecR	NA	NA	NA	NA	NA
AYY24876.1|55429_57754_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AYY24877.1|57798_58701_+	Fe(3+)-dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
AYY24878.1|58697_59696_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
AYY24879.1|59692_60649_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
AYY24880.1|60649_61417_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
AYY24881.1|61515_61809_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	95.9	8.0e-49
AYY25010.1|62139_62418_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AYY24882.1|62679_63684_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
AYY24883.1|64044_64464_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
AYY24884.1|64546_66610_+	TonB-dependent copper receptor	NA	NA	NA	NA	NA
AYY24885.1|66666_66927_+	DUF2534 family protein	NA	NA	NA	NA	NA
AYY24886.1|67023_67362_-	copper resistance protein CopC	NA	NA	NA	NA	NA
AYY24887.1|68167_68995_+|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
AYY25011.1|69008_71069_+|transposase	transposase	transposase	NA	NA	NA	NA
AYY24888.1|71061_72672_+	ATP-binding protein	NA	NA	NA	NA	NA
AYY24889.1|74168_75791_+|transposase	transposase	transposase	NA	NA	NA	NA
AYY24890.1|76347_76611_+	hypothetical protein	NA	NA	NA	NA	NA
AYY24891.1|77026_77599_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AYY24892.1|77696_80558_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.3	1.2e-128
AYY24893.1|80574_82005_+	cardiolipin synthase	NA	NA	NA	NA	NA
AYY24894.1|83432_83891_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AYY24895.1|83913_84828_+	hypothetical protein	NA	NA	NA	NA	NA
AYY24896.1|84930_85818_+	hypothetical protein	NA	NA	NA	NA	NA
AYY24897.1|85914_86526_+	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
AYY24898.1|87363_88275_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
AYY24899.1|88271_88463_+	hypothetical protein	NA	NA	NA	NA	NA
AYY24900.1|88455_89148_+	hypothetical protein	NA	NA	NA	NA	NA
AYY24901.1|89104_89710_+	hypothetical protein	NA	NA	NA	NA	NA
AYY24902.1|89699_90140_+	thioredoxin TrxC	NA	A0A023NHA9	Dinoroseobacter_phage	35.6	6.9e-12
AYY24903.1|90143_91850_+	sodium:proton exchanger	NA	NA	NA	NA	NA
AYY24904.1|92626_92869_+	diguanylate cyclase	NA	NA	NA	NA	NA
AYY24905.1|92880_93369_+	diguanylate cyclase	NA	NA	NA	NA	NA
AYY24906.1|93355_94318_+|protease	Zn-dependent protease	protease	NA	NA	NA	NA
AYY25012.1|94337_95489_+	PDZ domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.2	1.7e-25
AYY24907.1|96202_97126_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	94.1	2.7e-167
AYY24908.1|97527_98514_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYY24909.1|98639_98945_+	hypothetical protein	NA	NA	NA	NA	NA
AYY24910.1|100812_103464_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	34.0	1.6e-151
AYY24911.1|106201_106486_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	54.8	6.4e-19
AYY24912.1|106475_106724_-	plasmid stabilization protein	NA	NA	NA	NA	NA
AYY24913.1|106968_107892_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	94.1	5.1e-166
AYY24914.1|108115_109714_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.4	4.0e-17
AYY24915.1|110172_111306_+	aldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.8	9.7e-10
AYY24916.1|112486_113638_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
AYY24917.1|114302_115802_-	kinase	NA	NA	NA	NA	NA
AYY24918.1|115829_117563_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
AYY25013.1|117562_118603_-	VWA domain-containing protein	NA	NA	NA	NA	NA
AYY24919.1|118695_119334_-	VWA domain-containing protein	NA	NA	NA	NA	NA
AYY24920.1|119334_119976_-	TerD family protein	NA	A0A2P1N0C0	Streptomyces_phage	25.1	2.4e-05
AYY24921.1|120000_120639_-	VWA domain-containing protein	NA	NA	NA	NA	NA
AYY24922.1|121118_121577_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
AYY24923.1|121579_122803_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
AYY24924.1|122813_123770_-	citrate lyase subunit beta	NA	NA	NA	NA	NA
AYY24925.1|123769_124849_-	hypothetical protein	NA	A0A172Q0S8	Acinetobacter_phage	34.1	1.7e-40
AYY24926.1|124850_125624_-	hypothetical protein	NA	NA	NA	NA	NA
AYY25014.1|125616_126759_-	adenine/guanine phosphoribosyltransferase	NA	A0A172Q0Y1	Acinetobacter_phage	27.9	1.8e-32
AYY24927.1|126770_127829_-	carbamoyl-phosphate synthase large chain	NA	NA	NA	NA	NA
AYY24928.1|128140_128725_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	29.9	4.1e-12
AYY24929.1|128721_129873_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
AYY24930.1|130364_131405_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	46.5	1.8e-71
AYY24931.1|131443_132022_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.8	1.9e-33
AYY24932.1|132108_132684_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	9.6e-30
AYY24933.1|132768_134010_+	tellurium resistance protein TerF	NA	A0A2D1GNA9	Pseudoalteromonas_phage	25.1	4.8e-10
AYY24934.1|134346_134994_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
AYY24935.1|135221_135968_-	hypothetical protein	NA	NA	NA	NA	NA
AYY24936.1|136033_136792_-	hypothetical protein	NA	NA	NA	NA	NA
AYY24937.1|137024_137756_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AYY24938.1|138015_138618_-	hypothetical protein	NA	NA	NA	NA	NA
AYY24939.1|139610_140882_-	DUF1173 family protein	NA	NA	NA	NA	NA
AYY24940.1|141064_141514_+	nuclease	NA	A0A0R6PHV6	Moraxella_phage	36.9	4.1e-12
AYY24941.1|141560_142484_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.0	4.1e-176
>prophage 2
CP033758	Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed2	232752	149276	212302	232752	transposase	Enterobacteria_phage(18.52%)	55	NA	NA
AYY24947.1|149276_150200_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.1	4.7e-172
AYY24948.1|150320_150674_+	hypothetical protein	NA	NA	NA	NA	NA
AYY24949.1|150793_151867_+	aromatic acid exporter family protein	NA	NA	NA	NA	NA
AYY24950.1|151947_152871_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.1	2.8e-172
AYY24951.1|152895_153249_+	hypothetical protein	NA	A0A2H4IBK3	Erwinia_phage	51.0	1.7e-24
AYY24952.1|153326_153896_+	hypothetical protein	NA	G8C7Q8	Escherichia_phage	42.4	6.8e-28
AYY24953.1|153904_154363_+	hypothetical protein	NA	G8C7Q9	Escherichia_phage	55.0	5.1e-42
AYY24954.1|154449_155418_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	1.9e-179
AYY24955.1|155486_155702_+	hypothetical protein	NA	NA	NA	NA	NA
AYY24956.1|157576_158113_+	plasmid transfer protein	NA	NA	NA	NA	NA
AYY24957.1|160419_161430_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	53.5	1.1e-86
AYY24958.1|161459_161741_+	hypothetical protein	NA	NA	NA	NA	NA
AYY24959.1|161955_162204_-	hypothetical protein	NA	NA	NA	NA	NA
AYY24960.1|162159_163326_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.2	7.5e-223
AYY24961.1|163325_164297_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.6	1.0e-148
AYY24962.1|167866_168310_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
AYY24963.1|168306_168777_+	RES domain-containing protein	NA	NA	NA	NA	NA
AYY24964.1|168908_169832_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	93.2	1.0e-166
AYY24965.1|169951_170212_-	hypothetical protein	NA	NA	NA	NA	NA
AYY24966.1|170912_172281_+|transposase	IS3-like element ISKpn8 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	95.5	7.2e-108
AYY24967.1|173225_174149_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.4	6.9e-171
AYY24968.1|174487_175699_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
AYY24969.1|175785_176739_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.0	1.7e-10
AYY24970.1|176895_177744_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYY24971.1|177767_178439_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AYY24972.1|178435_179098_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AYY24973.1|179102_179921_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	8.8e-29
AYY24974.1|179917_180883_+	DMT family transporter	NA	NA	NA	NA	NA
AYY24975.1|182836_183760_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	97.1	4.7e-172
AYY25015.1|184452_185361_+	HNH endonuclease	NA	NA	NA	NA	NA
AYY24976.1|185748_186099_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	54.3	1.9e-20
AYY24977.1|186242_186674_-	silver-binding protein SilE	NA	NA	NA	NA	NA
AYY24978.1|186924_188400_-	Cu(+)/Ag(+) sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
AYY24979.1|188392_189073_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.0	2.1e-31
AYY24980.1|189262_190648_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
AYY24981.1|190676_191030_+	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYY24982.1|191143_192436_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYY24983.1|192446_195593_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
AYY24984.1|195679_196120_+	hypothetical protein	NA	NA	NA	NA	NA
AYY24985.1|196246_198694_+	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.8	4.4e-84
AYY24986.1|198734_198932_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AYY24987.1|198965_199703_-	peptidase	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	31.9	1.3e-10
AYY24988.1|199991_200441_-	copper resistance protein	NA	NA	NA	NA	NA
AYY24989.1|200674_202492_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
AYY24990.1|202491_203388_+	copper resistance protein B	NA	NA	NA	NA	NA
AYY24991.1|203427_203808_+	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
AYY24992.1|203812_204742_+	copper resistance protein D	NA	NA	NA	NA	NA
AYY24993.1|204796_205477_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
AYY24994.1|205473_206874_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
AYY24995.1|207089_207524_+	copper-binding protein	NA	NA	NA	NA	NA
AYY24996.1|208029_208434_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	97.0	2.1e-68
AYY24997.1|208430_208778_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
AYY24998.1|208826_210365_+|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.1	2.0e-279
AYY24999.1|210416_211355_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYY25016.1|211387_212302_-	alpha/beta hydrolase	NA	A0A1D8EVD1	Mycobacterium_phage	28.0	9.0e-06
