The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033696	Yersinia pestis strain FDAARGOS_602 chromosome, complete genome	4607325	122341	131978	4607325	transposase,tRNA,protease	Brazilian_cedratvirus(16.67%)	9	NA	NA
AYW81786.1|122341_124066_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.8	3.3e-17
AYW81787.1|124284_124995_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AYW81788.1|125160_125379_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AYW81789.1|125750_126209_-|transposase	IS200/IS605 family transposase IS1541A	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
AYW81790.1|126501_128778_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.7	7.4e-166
AYW81791.1|128803_129124_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	42.7	8.2e-15
AYW81792.1|129092_129299_-	hypothetical protein	NA	NA	NA	NA	NA
AYW81793.1|129484_129748_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.7	3.6e-16
AYW81794.1|130028_131978_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	37.7	8.8e-35
>prophage 2
CP033696	Yersinia pestis strain FDAARGOS_602 chromosome, complete genome	4607325	301900	363132	4607325	transposase,tRNA,plate	Escherichia_phage(23.53%)	55	NA	NA
AYW81941.1|301900_303283_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
AYW81942.1|303519_303837_+	cytochrome c	NA	NA	NA	NA	NA
AYW81943.1|304101_304362_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
AYW81944.1|304348_304549_-	YaeP family protein	NA	NA	NA	NA	NA
AYW81945.1|304790_305339_+	YaeQ family protein	NA	NA	NA	NA	NA
AYW81946.1|305341_305758_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AYW85531.1|305836_306526_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
AYW81947.1|306659_308378_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AYW81948.1|308481_309189_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
AYW81949.1|309185_309593_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
AYW81950.1|309710_310526_-	MetQ/NlpA family lipoprotein	NA	NA	NA	NA	NA
AYW81951.1|310589_311243_-	D-methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
AYW81952.1|311235_312267_-	D-methionine ABC transporter, ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.4	1.7e-32
AYW81953.1|312453_313020_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
AYW81954.1|313270_313456_-	hypothetical protein	NA	NA	NA	NA	NA
AYW81955.1|319220_320024_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SKP9	Klosneuvirus	29.2	3.6e-27
AYW81956.1|320471_320669_+	hypothetical protein	NA	NA	NA	NA	NA
AYW81957.1|320883_321666_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
AYW81958.1|321708_323097_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.8	4.5e-09
AYW81959.1|323168_323924_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AYW81960.1|323968_324688_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYW81961.1|324742_325207_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	53.9	9.1e-47
AYW81962.1|325276_326041_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.8	1.9e-41
AYW81963.1|326286_327771_-	NCS1 family nucleobase:cation symporter-1	NA	NA	NA	NA	NA
AYW81964.1|328109_328343_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
AYW81965.1|328393_329176_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
AYW81966.1|329172_330195_-|transposase	IS21 family transposase IS100	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
AYW81967.1|331248_332253_-	proline/glycine betaine ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
AYW81968.1|332300_333467_-	proline/glycine betaine ABC transporter permease ProW	NA	NA	NA	NA	NA
AYW81969.1|333459_334659_-	proline/glycine betaine ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.0	7.1e-27
AYW81970.1|335334_336306_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0N7CCA3	Skermania_phage	74.3	3.1e-137
AYW81971.1|336430_338581_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.8	1.1e-211
AYW85532.1|338562_338967_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	32.8	3.5e-10
AYW81972.1|338980_339217_-	redoxin NrdH	NA	V5UN81	Mycobacterium_phage	53.3	5.9e-18
AYW81973.1|339737_340103_+	acid-shock protein	NA	NA	NA	NA	NA
AYW81974.1|340580_340916_+	DUF2002 family protein	NA	NA	NA	NA	NA
AYW81975.1|341150_342359_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
AYW85534.1|342383_343574_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AYW85533.1|343612_344167_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AYW81976.1|344271_344796_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AYW81977.1|344819_346322_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AYW81978.1|346647_347133_+	Hcp1 family type VI secretion system effector	NA	NA	NA	NA	NA
AYW81979.1|347406_347946_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AYW81980.1|347949_349299_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AYW85535.1|349331_349964_+	type IV secretion protein DotU	NA	NA	NA	NA	NA
AYW81981.1|349977_351000_+|transposase	IS21 family transposase IS100	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
AYW81982.1|350996_351779_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
AYW81983.1|351794_352631_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
AYW81984.1|352639_356467_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
AYW81985.1|356760_359112_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	23.1	3.0e-29
AYW81986.1|359210_359471_+	hypothetical protein	NA	NA	NA	NA	NA
AYW81987.1|359470_360298_+	TagK domain-containing protein	NA	NA	NA	NA	NA
AYW81988.1|360337_361144_+	ImpE family T6SS protein Cts1E	NA	NA	NA	NA	NA
AYW81989.1|361256_361736_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AYW81990.1|361923_363132_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 3
CP033696	Yersinia pestis strain FDAARGOS_602 chromosome, complete genome	4607325	1020137	1031539	4607325	integrase,transposase	Escherichia_phage(18.18%)	14	1022597:1022627	1031565:1031595
AYW82545.1|1020137_1021337_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.6	2.4e-38
AYW82546.1|1021340_1022513_+	MFS transporter	NA	NA	NA	NA	NA
1022597:1022627	attL	GTTATTTAGCCCAACTCGGCTTATTCAATAT	NA	NA	NA	NA
AYW82547.1|1022817_1024026_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
AYW82548.1|1023988_1024204_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
AYW82549.1|1024627_1025191_-	hypothetical protein	NA	B6SD63	Bacteriophage	58.0	9.4e-30
AYW82550.1|1025239_1025458_-	hypothetical protein	NA	NA	NA	NA	NA
AYW82551.1|1025461_1025851_-	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	68.8	1.4e-45
AYW82552.1|1025851_1026457_-	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	56.9	2.8e-56
AYW82553.1|1026530_1026977_-	recombination protein NinB	NA	A0A2H4J8D9	uncultured_Caudovirales_phage	62.5	3.9e-47
AYW82554.1|1026952_1027702_+	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	48.5	1.5e-54
AYW82555.1|1028001_1028262_+	DNA-binding protein	NA	Q859D3	Escherichia_coli_phage	42.9	1.7e-10
AYW82556.1|1028429_1029212_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
AYW82557.1|1029208_1030231_-|transposase	IS21 family transposase IS100	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
AYW82558.1|1030300_1031539_+|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	53.3	2.3e-121
1031565:1031595	attR	GTTATTTAGCCCAACTCGGCTTATTCAATAT	NA	NA	NA	NA
>prophage 4
CP033696	Yersinia pestis strain FDAARGOS_602 chromosome, complete genome	4607325	1462704	1503988	4607325	transposase,coat,protease	uncultured_virus(16.67%)	33	NA	NA
AYW82919.1|1462704_1463913_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
AYW82920.1|1463960_1464311_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AYW82921.1|1464646_1465483_+	5-keto-4-deoxyuronate isomerase	NA	NA	NA	NA	NA
AYW82922.1|1465574_1466336_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	3.1e-20
AYW82923.1|1466671_1468339_+	pectate lyase	NA	NA	NA	NA	NA
AYW82924.1|1468379_1469270_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
AYW82925.1|1470196_1471324_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.5	1.6e-12
AYW82926.1|1471339_1472632_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYW82927.1|1472929_1473640_+	porin	NA	NA	NA	NA	NA
AYW82928.1|1474119_1474668_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	32.9	4.0e-09
AYW82929.1|1474865_1476263_+	L-cystine transporter	NA	NA	NA	NA	NA
AYW82930.1|1476477_1477329_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	28.8	1.3e-11
AYW82931.1|1477713_1478505_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
AYW82932.1|1478691_1479858_-	oligogalacturonate lyase	NA	NA	NA	NA	NA
AYW82933.1|1480184_1481552_+	MFS transporter	NA	NA	NA	NA	NA
AYW82934.1|1481605_1482409_-	molecular chaperone	NA	NA	NA	NA	NA
AYW82935.1|1482405_1483569_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AYW82936.1|1483565_1486178_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AYW82937.1|1486259_1487039_-	fimbrial chaperone	NA	NA	NA	NA	NA
AYW82938.1|1487191_1487734_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AYW82939.1|1488267_1488456_+	hypothetical protein	NA	NA	NA	NA	NA
AYW82940.1|1488391_1489273_-|protease	protease HtpX	protease	NA	NA	NA	NA
AYW82941.1|1489764_1491837_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.8	4.0e-86
AYW82942.1|1491856_1492570_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AYW82943.1|1492665_1493163_-	GAF domain-containing protein	NA	NA	NA	NA	NA
AYW82944.1|1493289_1494642_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AYW85599.1|1494610_1497262_+	PqiB family protein	NA	NA	NA	NA	NA
AYW82945.1|1497740_1498295_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
AYW82946.1|1498300_1498831_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
AYW82947.1|1498851_1499409_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
AYW82948.1|1499439_1500192_+	molecular chaperone	NA	NA	NA	NA	NA
AYW82949.1|1500345_1502793_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AYW82950.1|1502998_1503988_+|coat	spore coat protein U	coat	NA	NA	NA	NA
>prophage 5
CP033696	Yersinia pestis strain FDAARGOS_602 chromosome, complete genome	4607325	1693044	1773822	4607325	holin,transposase,plate,coat,tail,protease	Escherichia_phage(16.13%)	81	NA	NA
AYW83090.1|1693044_1694832_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.5	4.0e-10
AYW83091.1|1694931_1695114_-	hypothetical protein	NA	NA	NA	NA	NA
AYW83092.1|1695238_1696174_-	omptin family outer membrane beta-barrel protein PcoA	NA	NA	NA	NA	NA
AYW83093.1|1696345_1696588_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	65.0	6.9e-22
AYW83094.1|1696793_1697516_-	LexA family transcriptional regulator	NA	F1C599	Cronobacter_phage	51.9	2.2e-63
AYW83095.1|1697478_1697691_-	hypothetical protein	NA	NA	NA	NA	NA
AYW83096.1|1697789_1698269_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	61.0	2.3e-37
AYW83097.1|1698470_1699784_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	46.0	1.7e-90
AYW83098.1|1699780_1700410_+	aldolase	NA	A0A077SK32	Escherichia_phage	56.6	2.2e-48
AYW83099.1|1700489_1701305_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
AYW85606.1|1701322_1702075_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
AYW83100.1|1702688_1702979_+	hypothetical protein	NA	H6WRZ3	Salmonella_phage	46.3	7.7e-12
AYW83101.1|1703024_1703642_+	ATP-binding protein	NA	NA	NA	NA	NA
AYW83102.1|1703646_1703841_+	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	60.4	3.5e-08
AYW83103.1|1703837_1705346_+|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	44.2	2.4e-104
AYW83104.1|1705367_1705736_+|tail	phage tail protein	tail	NA	NA	NA	NA
AYW83105.1|1705737_1706037_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AYW83106.1|1706157_1707651_+|coat	coat protein	coat	NA	NA	NA	NA
AYW83107.1|1707917_1709324_+	hypothetical protein	NA	Q8SBG8	Shigella_phage	33.7	2.1e-17
AYW83108.1|1709320_1710376_+|tail	phage tail protein	tail	M1PVV2	Vibrio_phage	27.2	1.3e-37
AYW83109.1|1710391_1710988_+|plate	baseplate assembly protein	plate	NA	NA	NA	NA
AYW83110.1|1710984_1711440_+	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	43.8	4.3e-17
AYW83111.1|1711443_1712580_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.5	4.5e-31
AYW83112.1|1712576_1712837_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
AYW83113.1|1712833_1713181_+	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	41.3	6.4e-21
AYW83114.1|1713277_1714057_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	52.4	7.1e-52
AYW83115.1|1714354_1715095_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AYW83116.1|1715385_1716822_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AYW83117.1|1717006_1718215_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
AYW83118.1|1718388_1718703_-	hypothetical protein	NA	NA	NA	NA	NA
AYW83119.1|1718786_1719023_-	hypothetical protein	NA	NA	NA	NA	NA
AYW83120.1|1719163_1719490_-	hypothetical protein	NA	NA	NA	NA	NA
AYW83121.1|1719523_1719724_-	hypothetical protein	NA	NA	NA	NA	NA
AYW83122.1|1720937_1722293_-	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.6	4.1e-55
AYW83123.1|1722683_1723394_+	transcriptional regulator	NA	NA	NA	NA	NA
AYW83124.1|1723445_1724432_+	secretion protein HlyD	NA	NA	NA	NA	NA
AYW83125.1|1724445_1726188_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.6	6.3e-24
AYW83126.1|1726192_1727368_+	ABC transporter permease	NA	NA	NA	NA	NA
AYW83127.1|1727380_1728487_+	ABC transporter permease	NA	NA	NA	NA	NA
AYW83128.1|1728525_1728852_-	EthD family reductase	NA	NA	NA	NA	NA
AYW83129.1|1728862_1729090_-	5,10-methylene tetrahydromethanopterin reductase	NA	NA	NA	NA	NA
AYW83130.1|1729644_1730556_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYW83131.1|1730556_1731666_-	alkene reductase	NA	NA	NA	NA	NA
AYW83132.1|1732013_1733378_-	response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	29.1	1.3e-05
AYW83133.1|1733364_1735179_-	PAS domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	28.4	1.0e-16
AYW83134.1|1735536_1736010_+	zinc resistance sensor/chaperone ZraP	NA	NA	NA	NA	NA
AYW83135.1|1736815_1737274_-|transposase	IS200/IS605 family transposase IS1541A	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
AYW83136.1|1737263_1738064_-	MFS transporter	NA	NA	NA	NA	NA
AYW83137.1|1738202_1739066_-	xanthosine phosphorylase	NA	Q5YBA4	Grouper_iridovirus	40.7	2.3e-51
AYW83138.1|1739378_1740260_+	DMT family transporter	NA	NA	NA	NA	NA
AYW83139.1|1740297_1741191_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYW83140.1|1741422_1743471_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	28.5	1.4e-19
AYW83141.1|1743835_1744432_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
AYW83142.1|1744489_1745962_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AYW83143.1|1745984_1747688_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.5	9.4e-57
AYW83144.1|1747916_1748375_-|transposase	IS200/IS605 family transposase IS1541B	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
AYW83145.1|1748609_1749320_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
AYW83146.1|1749462_1749918_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
AYW83147.1|1749917_1750163_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
AYW83148.1|1750159_1750639_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
AYW83149.1|1750739_1751720_-	cyclic pyranopterin monophosphate synthase	NA	NA	NA	NA	NA
AYW83150.1|1752499_1753282_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
AYW83151.1|1753278_1754301_-|transposase	IS21 family transposase IS100	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
AYW83152.1|1754314_1754404_-	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYW83153.1|1755264_1755510_-	DNA-binding protein VF530	NA	NA	NA	NA	NA
AYW83154.1|1755801_1757817_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
AYW83155.1|1758907_1759618_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	25.3	3.5e-13
AYW83156.1|1759769_1760492_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
AYW83157.1|1760484_1761288_-	malonyl-[acyl-carrier protein] O-methyltransferase BioC	NA	NA	NA	NA	NA
AYW83158.1|1761271_1762423_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
AYW83159.1|1762422_1763460_-	biotin synthase	NA	NA	NA	NA	NA
AYW83160.1|1763558_1764839_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	32.1	2.4e-17
AYW83161.1|1765023_1766028_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
AYW83162.1|1766318_1767140_+	pyridoxal phosphatase	NA	NA	NA	NA	NA
AYW83163.1|1767195_1768275_-	molybdenum import ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.1	1.4e-21
AYW83164.1|1768268_1768964_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
AYW83165.1|1768963_1769743_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYW83166.1|1769977_1770130_-	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
AYW83167.1|1770395_1771187_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
AYW83168.1|1771296_1772787_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	26.8	2.8e-12
AYW83169.1|1773003_1773822_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 6
CP033696	Yersinia pestis strain FDAARGOS_602 chromosome, complete genome	4607325	1820892	1829617	4607325	integrase,transposase	Escherichia_phage(28.57%)	11	NA	NA
AYW83219.1|1820892_1821093_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	51.7	1.6e-08
AYW83220.1|1821092_1821635_+	hypothetical protein	NA	NA	NA	NA	NA
AYW83221.1|1821627_1822587_+	toprim domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	41.0	1.6e-50
AYW83222.1|1822583_1823672_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	60.4	1.4e-114
AYW83223.1|1823718_1823913_-	hypothetical protein	NA	NA	NA	NA	NA
AYW83224.1|1824020_1824341_-	putative addiction module antidote protein	NA	NA	NA	NA	NA
AYW83225.1|1824340_1824658_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	48.1	2.0e-13
AYW83226.1|1825072_1825249_+|integrase	integrase	integrase	NA	NA	NA	NA
AYW83227.1|1825262_1826285_+|transposase	IS21 family transposase IS100	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
AYW83228.1|1826281_1827064_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
AYW83229.1|1827535_1829617_+	GGDEF and EAL domain-containing protein	NA	G3MA91	Bacillus_virus	30.7	4.1e-14
>prophage 7
CP033696	Yersinia pestis strain FDAARGOS_602 chromosome, complete genome	4607325	1921166	1965684	4607325	transposase,lysis,tRNA,plate	Indivirus(12.5%)	37	NA	NA
AYW83309.1|1921166_1923194_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.1	8.0e-55
AYW83310.1|1923357_1923816_-|transposase	IS200/IS605 family transposase IS1541B	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
AYW83311.1|1923805_1923994_-	hypothetical protein	NA	NA	NA	NA	NA
AYW83312.1|1924033_1924696_-	hypothetical protein	NA	NA	NA	NA	NA
AYW83313.1|1925378_1926470_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYW83314.1|1926487_1927741_+	hypothetical protein	NA	NA	NA	NA	NA
AYW83315.1|1928073_1929255_+	MFS transporter	NA	NA	NA	NA	NA
AYW83316.1|1929496_1929904_+	hypothetical protein	NA	NA	NA	NA	NA
AYW83317.1|1929900_1930596_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
AYW83318.1|1930921_1931806_+	cytidine deaminase	NA	NA	NA	NA	NA
AYW83319.1|1932161_1933859_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
AYW83320.1|1934139_1934877_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
AYW83321.1|1935321_1936332_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
AYW83322.1|1936352_1937873_-	galactose/methyl galactoside import ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.9	2.6e-10
AYW83323.1|1938102_1939095_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
AYW83324.1|1939842_1941009_-	DUF418 family protein	NA	NA	NA	NA	NA
AYW83325.1|1941063_1941726_-	GTP cyclohydrolase I FolE	NA	R9TJA5	Vibrio_phage	53.5	5.8e-55
AYW83326.1|1941909_1943061_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
AYW83327.1|1943196_1944066_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYW85611.1|1944345_1945479_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	4.6e-36
AYW83328.1|1945499_1946342_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AYW83329.1|1946598_1946811_+	hypothetical protein	NA	NA	NA	NA	NA
AYW83330.1|1946894_1949255_+	ABC transporter permease	NA	NA	NA	NA	NA
AYW83331.1|1949256_1950519_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYW83332.1|1950520_1951189_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	1.4e-35
AYW83333.1|1951198_1952509_+	radical SAM protein	NA	NA	NA	NA	NA
AYW83334.1|1953043_1954318_+	molybdopterin molybdotransferase	NA	NA	NA	NA	NA
AYW85612.1|1954322_1955090_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
AYW83335.1|1955256_1956465_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
AYW83336.1|1956486_1957131_-	hypothetical protein	NA	NA	NA	NA	NA
AYW83337.1|1957358_1958954_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	6.1e-58
AYW83338.1|1959636_1960260_+	hypothetical protein	NA	NA	NA	NA	NA
AYW83339.1|1960471_1961839_-	hypothetical protein	NA	NA	NA	NA	NA
AYW83340.1|1961863_1962316_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AYW83341.1|1962315_1962897_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AYW83342.1|1962871_1963957_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AYW83343.1|1963920_1965684_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 8
CP033696	Yersinia pestis strain FDAARGOS_602 chromosome, complete genome	4607325	2339847	2347645	4607325	transposase	Escherichia_phage(33.33%)	7	NA	NA
AYW83635.1|2339847_2340393_-	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	28.3	5.9e-13
AYW83636.1|2340394_2340778_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
AYW83637.1|2341028_2342213_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.9	2.0e-13
AYW83638.1|2343269_2344052_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
AYW83639.1|2344048_2345071_-|transposase	IS21 family transposase IS100	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
AYW83640.1|2345181_2345640_+|transposase	IS200/IS605 family transposase IS1541A	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
AYW83641.1|2346091_2347645_-	sulfatase	NA	A0A1V0SA98	Catovirus	26.1	5.4e-19
>prophage 9
CP033696	Yersinia pestis strain FDAARGOS_602 chromosome, complete genome	4607325	2519717	2635871	4607325	integrase,transposase,protease,plate	Bacillus_phage(30.0%)	58	2572241:2572273	2609304:2609336
AYW83778.1|2519717_2521070_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AYW83779.1|2521081_2522626_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AYW83780.1|2522668_2523169_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AYW83781.1|2524568_2524940_-	hypothetical protein	NA	NA	NA	NA	NA
AYW83782.1|2525444_2525840_-	lipoprotein	NA	NA	NA	NA	NA
AYW83783.1|2526290_2526941_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYW83784.1|2528110_2528761_+	acyl-homoserine-lactone synthase	NA	NA	NA	NA	NA
AYW83785.1|2528741_2529485_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AYW83786.1|2530052_2531429_+	peptidase	NA	NA	NA	NA	NA
AYW83787.1|2531805_2532639_+	dioxygenase	NA	NA	NA	NA	NA
AYW83788.1|2532786_2532981_-	hypothetical protein	NA	NA	NA	NA	NA
AYW83789.1|2532928_2534152_-	MFS transporter	NA	NA	NA	NA	NA
AYW83790.1|2536046_2536997_+	N-acetyltransferase	NA	NA	NA	NA	NA
AYW83791.1|2536993_2538742_+	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
AYW83792.1|2538738_2540067_+	lysine 6-monooxygenase	NA	NA	NA	NA	NA
AYW83793.1|2540138_2542319_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
AYW83794.1|2542577_2544011_-	MFS transporter	NA	NA	NA	NA	NA
AYW83795.1|2544163_2545237_-	1,4-beta-xylanase	NA	NA	NA	NA	NA
AYW85646.1|2545554_2546550_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AYW83796.1|2546848_2548228_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
AYW83797.1|2548407_2548821_-	hypothetical protein	NA	NA	NA	NA	NA
AYW83798.1|2549364_2549751_-	hypothetical protein	NA	NA	NA	NA	NA
AYW83799.1|2549779_2549971_-	hypothetical protein	NA	NA	NA	NA	NA
AYW83800.1|2549889_2554206_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	49.6	1.8e-27
AYW83801.1|2554219_2555539_-	hypothetical protein	NA	NA	NA	NA	NA
AYW83802.1|2555564_2557790_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.0	1.2e-27
AYW85647.1|2558375_2562068_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
AYW83803.1|2567565_2568909_-	gluconate transporter GntP	NA	NA	NA	NA	NA
AYW83804.1|2569180_2569381_+	hypothetical protein	NA	NA	NA	NA	NA
AYW83805.1|2570448_2570847_+	hypothetical protein	NA	NA	NA	NA	NA
AYW83806.1|2571282_2572158_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
2572241:2572273	attL	GGGTAGGCAGAAGAGTAAAGCGTCCGCGCCAGG	NA	NA	NA	NA
AYW83807.1|2572480_2574238_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.0	6.7e-34
AYW83808.1|2574230_2576003_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.6	7.8e-30
AYW83809.1|2576002_2577307_-	MFS transporter	NA	NA	NA	NA	NA
AYW83810.1|2577296_2578061_-	thioesterase	NA	NA	NA	NA	NA
AYW83811.1|2578053_2579181_-	thiazolinyl imide reductase	NA	NA	NA	NA	NA
AYW83812.1|2579177_2580248_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
AYW83813.1|2580244_2586091_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	31.3	1.3e-41
AYW85648.1|2586103_2587756_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	25.0	3.0e-36
AYW83814.1|2597885_2599958_-	TonB-dependent receptor	NA	NA	NA	NA	NA
AYW85649.1|2600996_2601104_+|integrase	integrase	integrase	NA	NA	NA	NA
AYW83815.1|2601117_2602140_+|transposase	IS21 family transposase IS100	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
AYW83816.1|2602136_2602919_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
AYW83817.1|2603928_2605485_-	AbgT family transporter	NA	NA	NA	NA	NA
AYW83818.1|2605429_2605633_-	hypothetical protein	NA	NA	NA	NA	NA
AYW83819.1|2605999_2606185_+	hypothetical protein	NA	NA	NA	NA	NA
AYW83820.1|2606203_2608021_+	hypothetical protein	NA	NA	NA	NA	NA
AYW83821.1|2608229_2609105_+	hypothetical protein	NA	NA	NA	NA	NA
AYW83822.1|2609185_2609272_+	hypothetical protein	NA	NA	NA	NA	NA
AYW83823.1|2609667_2611548_+	hypothetical protein	NA	NA	NA	NA	NA
2609304:2609336	attR	GGGTAGGCAGAAGAGTAAAGCGTCCGCGCCAGG	NA	NA	NA	NA
AYW83824.1|2611650_2622768_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	37.8	1.6e-133
AYW83825.1|2623621_2624209_-	hypothetical protein	NA	NA	NA	NA	NA
AYW83826.1|2624486_2625977_+	ShET2/EspL2 family type III secretion system effector toxin	NA	NA	NA	NA	NA
AYW83827.1|2626111_2629231_-	hydrophobe/amphiphile efflux-1 family RND transporter	NA	NA	NA	NA	NA
AYW83828.1|2629243_2630521_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYW85650.1|2631160_2633527_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AYW83829.1|2633722_2635077_-|transposase	IS3-like element IS1661 family transposase	transposase	A0A1B1P773	Bacillus_phage	44.7	1.1e-55
AYW83830.1|2635127_2635871_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 10
CP033696	Yersinia pestis strain FDAARGOS_602 chromosome, complete genome	4607325	2731047	2793750	4607325	transposase,tail,protease	Escherichia_phage(16.67%)	55	NA	NA
AYW83908.1|2731047_2732493_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AYW83909.1|2732553_2732760_-	hypothetical protein	NA	NA	NA	NA	NA
AYW83910.1|2732695_2735554_-	RHS repeat protein	NA	NA	NA	NA	NA
AYW83911.1|2735614_2738650_-	RHS repeat protein	NA	NA	NA	NA	NA
AYW83912.1|2738646_2739006_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AYW83913.1|2739002_2739404_-	M15 family peptidase	NA	A0A249XWK9	Proteus_phage	61.0	3.6e-36
AYW83914.1|2739416_2739719_-	hypothetical protein	NA	NA	NA	NA	NA
AYW83915.1|2739852_2744343_-	toxin	NA	NA	NA	NA	NA
AYW83916.1|2744399_2747993_-|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
AYW83917.1|2748033_2750541_-	toxin	NA	NA	NA	NA	NA
AYW83918.1|2750776_2751643_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYW83919.1|2751903_2752815_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
AYW83920.1|2753117_2753321_+	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
AYW83921.1|2753328_2754264_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
AYW83922.1|2754265_2756221_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
AYW85654.1|2758165_2758624_+	ribonuclease	NA	NA	NA	NA	NA
AYW83923.1|2758628_2758910_+	ribonuclease inhibitor	NA	NA	NA	NA	NA
AYW83924.1|2759021_2759570_-	ribosome-associated protein	NA	NA	NA	NA	NA
AYW83925.1|2759750_2761091_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
AYW83926.1|2761345_2761984_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	49.0	5.8e-52
AYW83927.1|2762191_2762578_+	soluble cytochrome b562 2	NA	NA	NA	NA	NA
AYW85655.1|2762793_2763204_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
AYW83928.1|2763556_2765224_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
AYW83929.1|2765318_2766734_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
AYW83930.1|2767144_2768098_-	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
AYW83931.1|2768331_2768808_-	hypothetical protein	NA	NA	NA	NA	NA
AYW83932.1|2769106_2769493_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
AYW83933.1|2769630_2770095_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AYW83934.1|2770106_2771042_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	38.5	1.5e-48
AYW85656.1|2771232_2771484_+	hypothetical protein	NA	NA	NA	NA	NA
AYW83935.1|2771379_2771652_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
AYW83936.1|2771648_2772503_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.0	3.2e-05
AYW83937.1|2772527_2772782_+	hypothetical protein	NA	NA	NA	NA	NA
AYW85657.1|2772808_2773291_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AYW83938.1|2773719_2775153_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
AYW83939.1|2775214_2775940_-	lipopolysaccharide ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.4e-22
AYW83940.1|2775946_2776492_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AYW83941.1|2776475_2777039_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AYW83942.1|2777035_2777599_-	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	83.0	9.6e-59
AYW85658.1|2777847_2778834_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	30.8	6.0e-40
AYW83943.1|2778944_2779919_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
AYW83944.1|2780183_2781002_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	2.2e-19
AYW83945.1|2781219_2782002_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
AYW83946.1|2782006_2782564_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
AYW83947.1|2782576_2783200_+	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
AYW83948.1|2783235_2783538_+	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
AYW83949.1|2783684_2783939_+	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
AYW83950.1|2784092_2785355_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AYW85659.1|2785535_2786624_-|protease	serine endoprotease DegS	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	31.8	2.1e-09
AYW83951.1|2786849_2787308_+|transposase	IS200/IS605 family transposase IS1541A	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
AYW83952.1|2787454_2789017_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
AYW83953.1|2789019_2790111_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
AYW83954.1|2790112_2791543_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
AYW83955.1|2791948_2792731_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
AYW83956.1|2792727_2793750_-|transposase	IS21 family transposase IS100	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
>prophage 11
CP033696	Yersinia pestis strain FDAARGOS_602 chromosome, complete genome	4607325	2953516	3004827	4607325	transposase,protease,plate	Escherichia_phage(20.0%)	53	NA	NA
AYW84080.1|2953516_2953855_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AYW85670.1|2954198_2955434_-	hypothetical protein	NA	NA	NA	NA	NA
AYW84081.1|2955543_2956266_-	histidine kinase	NA	NA	NA	NA	NA
AYW84082.1|2956315_2957647_-	site-specific DNA-methyltransferase	NA	NA	NA	NA	NA
AYW84083.1|2958373_2958604_-	hypothetical protein	NA	NA	NA	NA	NA
AYW84084.1|2958670_2959987_-	restriction endonuclease	NA	NA	NA	NA	NA
AYW84085.1|2959983_2962047_-	McrB family protein	NA	K4I1H4	Acidithiobacillus_phage	33.2	5.3e-30
AYW84086.1|2962077_2962167_+	coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYW84087.1|2962180_2963203_+|transposase	IS21 family transposase IS100	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
AYW84088.1|2963199_2963982_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
AYW84089.1|2964096_2964285_-	hypothetical protein	NA	NA	NA	NA	NA
AYW84090.1|2964321_2964708_-	8-oxo-dGTP diphosphatase MutT	NA	A0A0B5CYJ3	Rhizoctonia_fumigata_mycovirus	30.4	8.4e-06
AYW84091.1|2964885_2965116_+	hypothetical protein	NA	NA	NA	NA	NA
AYW84092.1|2965002_2967717_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
AYW84093.1|2967794_2968328_-	secA regulator SecM	NA	NA	NA	NA	NA
AYW84094.1|2968350_2968881_+	DUF721 domain-containing protein	NA	NA	NA	NA	NA
AYW85671.1|2969047_2969968_-	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
AYW84095.1|2970067_2971219_-	cell division protein FtsZ	NA	NA	NA	NA	NA
AYW84096.1|2971291_2972548_-	cell division protein FtsA	NA	NA	NA	NA	NA
AYW84097.1|2972574_2973402_-	cell division protein FtsQ	NA	NA	NA	NA	NA
AYW84098.1|2973403_2974324_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
AYW85672.1|2974316_2975792_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
AYW84099.1|2975929_2977000_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
AYW84100.1|2976996_2978199_-	cell division protein FtsW	NA	NA	NA	NA	NA
AYW84101.1|2978198_2979515_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
AYW84102.1|2979517_2980600_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
AYW84103.1|2980593_2981970_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
AYW85673.1|2981966_2983439_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
AYW84104.1|2983440_2985204_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
AYW84105.1|2985269_2985587_-	cell division protein FtsL	NA	NA	NA	NA	NA
AYW84106.1|2985583_2986546_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase	NA	NA	NA	NA	NA
AYW84107.1|2986548_2987007_-	transcriptional regulator MraZ	NA	NA	NA	NA	NA
AYW84108.1|2987561_2987651_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
AYW84109.1|2988102_2988549_+	L-alanine exporter AlaE	NA	NA	NA	NA	NA
AYW84110.1|2988679_2989690_-	catabolite repressor/activator	NA	NA	NA	NA	NA
AYW84111.1|2989756_2989873_+	hypothetical protein	NA	NA	NA	NA	NA
AYW84112.1|2990194_2990653_-|transposase	IS200/IS605 family transposase IS1541B	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
AYW84113.1|2990851_2991346_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
AYW84114.1|2991348_2993076_-	acetolactate synthase 3 large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	29.4	7.8e-59
AYW84115.1|2993394_2993505_-	hypothetical protein	NA	NA	NA	NA	NA
AYW84116.1|2993535_2995341_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.2	3.5e-38
AYW84117.1|2995337_2995544_-	hypothetical protein	NA	NA	NA	NA	NA
AYW84118.1|2995889_2996846_-	transcriptional regulator LeuO	NA	NA	NA	NA	NA
AYW84119.1|2997523_2997739_+	hypothetical protein	NA	NA	NA	NA	NA
AYW84120.1|2998167_2998626_+|transposase	IS200/IS605 family transposase IS1541A	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
AYW84121.1|2998742_3000116_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.2	7.4e-20
AYW84122.1|3000386_3000791_-	DUF1043 family protein	NA	NA	NA	NA	NA
AYW84123.1|3001014_3002142_+	cell division protein ZapE	NA	NA	NA	NA	NA
AYW84124.1|3002455_3002884_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AYW84125.1|3002898_3003291_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
AYW84126.1|3003287_3003485_-	hypothetical protein	NA	NA	NA	NA	NA
AYW84127.1|3003664_3004306_+	stringent starvation protein A	NA	NA	NA	NA	NA
AYW84128.1|3004311_3004827_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.6	3.6e-28
>prophage 12
CP033696	Yersinia pestis strain FDAARGOS_602 chromosome, complete genome	4607325	4162910	4217155	4607325	tRNA,transposase,plate	Escherichia_phage(27.27%)	57	NA	NA
AYW85111.1|4162910_4163933_-|transposase	IS21 family transposase IS100	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
AYW85112.1|4164043_4164502_+|transposase	IS200/IS605 family transposase IS1541B	transposase	I4AZI8	Saccharomonospora_phage	31.5	8.5e-13
AYW85113.1|4164833_4165196_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AYW85114.1|4165550_4166282_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AYW85115.1|4166417_4167395_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
AYW85116.1|4167396_4168128_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AYW85117.1|4168257_4170831_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.9	2.4e-128
AYW85118.1|4171156_4171342_-	hypothetical protein	NA	NA	NA	NA	NA
AYW85119.1|4176632_4176824_+	hypothetical protein	NA	NA	NA	NA	NA
AYW85120.1|4176932_4177274_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
AYW85121.1|4177335_4178694_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AYW85122.1|4178866_4181509_-	bifunctional acyl-CoA synthetase/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYW85123.1|4181551_4182301_-	DTW domain-containing protein	NA	NA	NA	NA	NA
AYW85124.1|4182470_4182908_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	36.6	2.6e-11
AYW85125.1|4183159_4184326_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AYW85126.1|4184448_4185984_-	multidrug efflux MFS transporter subunit EmrB	NA	NA	NA	NA	NA
AYW85127.1|4186022_4187195_-	EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYW85128.1|4187578_4188091_-	transcriptional repressor MprA	NA	NA	NA	NA	NA
AYW85129.1|4188262_4188604_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
AYW85130.1|4188600_4189374_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
AYW85131.1|4189533_4190733_-	MFS transporter	NA	NA	NA	NA	NA
AYW85132.1|4190960_4191347_-	oxalurate catabolism protein HpxZ	NA	NA	NA	NA	NA
AYW85133.1|4191456_4192854_-	AtzE family amidohydrolase	NA	NA	NA	NA	NA
AYW85134.1|4192850_4193054_-	oxalurate catabolism protein HpxX	NA	NA	NA	NA	NA
AYW85135.1|4193351_4194197_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AYW85136.1|4194198_4194414_+	hypothetical protein	NA	NA	NA	NA	NA
AYW85137.1|4194524_4195313_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYW85138.1|4195325_4195994_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AYW85139.1|4195990_4196644_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AYW85140.1|4196624_4197371_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.1	3.4e-35
AYW85731.1|4197426_4198326_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
AYW85141.1|4198376_4199159_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
AYW85142.1|4199155_4200178_-|transposase	IS21 family transposase IS100	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
AYW85143.1|4200191_4200329_-	chemotaxis protein	NA	NA	NA	NA	NA
AYW85144.1|4200655_4200841_+	hypothetical protein	NA	NA	NA	NA	NA
AYW85145.1|4200856_4201081_+	hypothetical protein	NA	NA	NA	NA	NA
AYW85146.1|4201090_4201432_-	TOBE domain-containing protein	NA	NA	NA	NA	NA
AYW85147.1|4201317_4202208_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.1	6.7e-22
AYW85148.1|4202232_4203060_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
AYW85149.1|4203052_4203913_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AYW85150.1|4203979_4205248_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYW85151.1|4205277_4206291_-	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AYW85152.1|4206798_4206918_+	transcriptional regulator	NA	NA	NA	NA	NA
AYW85153.1|4206958_4207756_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYW85154.1|4207942_4208047_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AYW85155.1|4208724_4209159_+	hypothetical protein	NA	NA	NA	NA	NA
AYW85156.1|4209170_4209740_+	hypothetical protein	NA	NA	NA	NA	NA
AYW85157.1|4211403_4212480_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
AYW85158.1|4212545_4212836_-	antitoxin	NA	K4NZP3	Burkholderia_phage	39.4	1.8e-05
AYW85159.1|4212816_4213089_-	BrnT family toxin	NA	NA	NA	NA	NA
AYW85160.1|4213119_4213479_+|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	62.5	8.9e-18
AYW85161.1|4213475_4213775_+	lysozyme	NA	A0A218M4K8	Erwinia_phage	64.9	2.6e-23
AYW85162.1|4213791_4214079_+	hypothetical protein	NA	NA	NA	NA	NA
AYW85163.1|4214513_4214729_+	hypothetical protein	NA	NA	NA	NA	NA
AYW85164.1|4214677_4215031_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
AYW85732.1|4215035_4215290_+	hypothetical protein	NA	NA	NA	NA	NA
AYW85165.1|4215642_4217155_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 1
CP033694	Yersinia pestis strain FDAARGOS_602 plasmid unnamed1, complete sequence	106990	639	106679	106990	tail,terminase,transposase,integrase,capsid	Salmonella_phage(79.55%)	121	30365:30382	43424:43441
AYW81499.1|639_1122_-	hypothetical protein	NA	J9Q805	Salmonella_phage	94.4	5.1e-85
AYW81500.1|1134_1368_-	hypothetical protein	NA	NA	NA	NA	NA
AYW81615.1|1327_1615_-	ABC transporter	NA	J9Q753	Salmonella_phage	93.5	6.2e-46
AYW81501.1|1808_2267_-|transposase	IS200/IS605 family transposase IS1541A	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.0e-13
AYW81502.1|2256_2466_-	hypothetical protein	NA	NA	NA	NA	NA
AYW81503.1|2505_3261_-	hypothetical protein	NA	J9Q742	Salmonella_phage	98.4	3.8e-135
AYW81504.1|3459_4602_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	100.0	1.7e-219
AYW81505.1|4709_7025_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	98.8	0.0e+00
AYW81506.1|7102_7672_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	100.0	5.8e-104
AYW81507.1|7684_8431_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	96.4	4.1e-134
AYW81508.1|8420_10337_-	exonuclease	NA	J9Q741	Salmonella_phage	98.6	0.0e+00
AYW81509.1|10345_10570_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	94.9	8.5e-27
AYW81510.1|10566_11652_-	exonuclease SbcCD subunit D	NA	J9Q7S9	Salmonella_phage	98.6	7.7e-206
AYW81511.1|11800_11989_+	hypothetical protein	NA	NA	NA	NA	NA
AYW81512.1|11898_12171_+	hypothetical protein	NA	NA	NA	NA	NA
AYW81513.1|12067_13090_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYW81514.1|13227_13374_-	hypothetical protein	NA	NA	NA	NA	NA
AYW81616.1|13449_13674_-	hypothetical protein	NA	J9Q739	Salmonella_phage	97.3	1.5e-34
AYW81515.1|14858_15923_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.6	2.4e-188
AYW81516.1|16358_16541_+	hypothetical protein	NA	NA	NA	NA	NA
AYW81517.1|16491_16704_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	95.7	6.8e-34
AYW81518.1|16703_17039_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	91.0	5.2e-52
AYW81519.1|17035_17215_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	86.4	5.8e-18
AYW81520.1|17255_17531_-	hypothetical protein	NA	J9Q738	Salmonella_phage	95.6	1.7e-45
AYW81521.1|17598_18009_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.8	4.1e-75
AYW81522.1|17992_18364_-	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	87.8	4.0e-61
AYW81523.1|18517_19348_-	SPFH/Band 7/PHB domain protein	NA	J9Q7Z4	Salmonella_phage	98.6	9.3e-127
AYW81524.1|19351_19552_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	97.0	1.1e-25
AYW81525.1|19642_20719_-	recombinase	NA	J9Q736	Salmonella_phage	99.4	1.2e-203
AYW81526.1|20721_20988_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
AYW81527.1|20987_21932_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.0	1.3e-180
AYW81528.1|21992_23021_-	regulator	NA	J9Q7Z3	Salmonella_phage	98.5	1.3e-165
AYW81529.1|23140_23614_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	98.6	2.9e-72
AYW81530.1|23792_24044_+	hypothetical protein	NA	NA	NA	NA	NA
AYW81531.1|24116_24680_+	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	64.6	2.2e-63
AYW81532.1|24709_25153_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	100.0	7.8e-72
AYW81533.1|25939_26050_+|integrase	integrase	integrase	NA	NA	NA	NA
AYW81534.1|26063_27086_+|transposase	IS21 family transposase IS100	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
AYW81535.1|27914_30632_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.4	0.0e+00
30365:30382	attL	CCAATGATTCCATACATC	NA	NA	NA	NA
AYW81536.1|30606_30810_-	hypothetical protein	NA	J9Q6I7	Salmonella_phage	98.5	8.0e-32
AYW81537.1|30812_32048_-	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	99.3	3.0e-238
AYW81538.1|32144_34511_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	94.4	0.0e+00
AYW81539.1|34620_34833_-	hypothetical protein	NA	NA	NA	NA	NA
AYW81540.1|35095_35482_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYW81617.1|35476_36580_-|integrase	integrase	integrase	A0A1P8DTG6	Proteus_phage	30.9	5.2e-24
AYW81541.1|37340_37853_-	F1 capsule antigen	NA	NA	NA	NA	NA
AYW81542.1|37933_40435_-	F1 capsule-anchoring protein	NA	NA	NA	NA	NA
AYW81543.1|40459_41236_-	chaperone protein caf1M	NA	NA	NA	NA	NA
AYW81544.1|41545_42469_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYW81545.1|42983_43289_-	C-type natriuretic protein	NA	J9Q7S1	Salmonella_phage	97.0	3.2e-48
AYW81546.1|43285_43438_-	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	96.0	2.0e-19
AYW81618.1|43434_43644_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.5	8.2e-32
43424:43441	attR	GATGTATGGAATCATTGG	NA	NA	NA	NA
AYW81547.1|43633_43810_-	hypothetical protein	NA	J9Q729	Salmonella_phage	94.8	7.7e-23
AYW81548.1|43809_45132_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	99.1	1.6e-258
AYW81549.1|45166_45424_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	95.3	3.4e-35
AYW81619.1|45334_45676_+	hypothetical protein	NA	NA	NA	NA	NA
AYW81550.1|45724_45967_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	98.4	2.0e-29
AYW81551.1|45982_46765_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
AYW81552.1|46761_47784_-|transposase	IS21 family transposase IS100	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
AYW81553.1|47907_49917_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.3	7.7e-26
AYW81554.1|49989_50220_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AYW81555.1|50250_50340_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AYW81556.1|50645_50879_+	hypothetical protein	NA	NA	NA	NA	NA
AYW81557.1|51008_51515_-	antirestriction protein ArdA	NA	A0A1I9S7Y0	Rhodococcus_phage	29.5	1.1e-08
AYW81558.1|51913_52693_-	hypothetical protein	NA	NA	NA	NA	NA
AYW81559.1|52746_53166_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AYW81560.1|53176_53398_-	hypothetical protein	NA	NA	NA	NA	NA
AYW81561.1|53397_54075_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.6e-28
AYW81562.1|54467_54776_+	hypothetical protein	NA	NA	NA	NA	NA
AYW81563.1|54937_56335_-	AAA family ATPase	NA	NA	NA	NA	NA
AYW81564.1|56573_56807_+	hypothetical protein	NA	NA	NA	NA	NA
AYW81565.1|56713_57685_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	67.3	1.5e-112
AYW81566.1|57681_58887_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	90.5	1.7e-206
AYW81567.1|59188_59416_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AYW81568.1|59415_59742_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AYW81569.1|59941_60562_+	serine recombinase	NA	A0A1V0E035	Clostridioides_phage	31.1	6.5e-08
AYW81570.1|60582_61569_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.8	1.1e-68
AYW81571.1|61591_61867_-	hypothetical protein	NA	NA	NA	NA	NA
AYW81572.1|62499_64263_+	phospholipase	NA	NA	NA	NA	NA
AYW81573.1|64507_64978_-	reverse transcriptase	NA	A0A0U4J920	Pseudomonas_phage	41.4	2.2e-16
AYW81574.1|65271_65643_+	hypothetical protein	NA	NA	NA	NA	NA
AYW81575.1|66338_67361_-|transposase	IS110 family transposase IS1618	transposase	NA	NA	NA	NA
AYW81576.1|67829_69038_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
AYW81577.1|69071_69794_-	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
AYW81578.1|70740_71763_+|transposase	IS21 family transposase IS100	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
AYW81579.1|71759_72542_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
AYW81580.1|72671_73280_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	62.2	4.8e-64
AYW81581.1|73372_73585_-	hypothetical protein	NA	NA	NA	NA	NA
AYW81582.1|73581_76518_-|tail	phage tail protein	tail	J9Q6E3	Salmonella_phage	33.1	4.6e-11
AYW81620.1|76550_77168_-	DUF4376 domain-containing protein	NA	Q9LA61	Enterobacterial_phage	38.8	3.0e-29
AYW81583.1|77185_81823_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	88.6	0.0e+00
AYW81584.1|81838_82426_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	92.8	5.1e-103
AYW81585.1|82413_83211_-|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	96.2	1.4e-156
AYW81586.1|83203_83935_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	99.6	6.7e-137
AYW81587.1|83991_84327_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	97.3	5.7e-59
AYW81588.1|84368_88946_-|tail	phage tail tape measure protein	tail	J9Q712	Salmonella_phage	90.5	0.0e+00
AYW81589.1|88953_89223_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	8.4e-37
AYW81590.1|89303_89621_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
AYW81591.1|89680_90427_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	98.8	5.2e-129
AYW81592.1|90501_90885_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	98.4	1.1e-66
AYW81593.1|90886_91360_-	hypothetical protein	NA	J9Q711	Salmonella_phage	99.4	8.9e-82
AYW81594.1|91350_91695_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
AYW81595.1|91792_92626_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	99.6	2.9e-152
AYW81596.1|92625_93060_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	99.3	3.1e-73
AYW81597.1|93103_93766_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	97.2	8.5e-107
AYW81598.1|93840_94716_-|capsid	phage major capsid protein	capsid	J9Q710	Salmonella_phage	99.7	8.5e-163
AYW81599.1|94742_95639_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	96.3	3.9e-147
AYW81600.1|95661_97251_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.2	4.2e-301
AYW81601.1|97269_98526_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	100.0	1.8e-251
AYW81602.1|98528_99170_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	98.1	1.2e-108
AYW81603.1|99365_99632_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
AYW81604.1|99641_100541_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.7	8.2e-169
AYW81605.1|100537_100792_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	97.6	2.0e-40
AYW81606.1|100784_101423_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.1	4.7e-110
AYW81607.1|101419_102088_-	chromosome partitioning protein ParB	NA	J9Q6L1	Salmonella_phage	98.2	9.5e-114
AYW81608.1|102087_102786_-	chromosome partitioning protein ParB	NA	J9Q756	Salmonella_phage	98.7	9.6e-125
AYW81609.1|102850_104410_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	99.0	1.1e-293
AYW81610.1|104412_104691_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	97.8	4.4e-41
AYW81611.1|104750_105173_+	hypothetical protein	NA	J9Q806	Salmonella_phage	85.0	4.1e-62
AYW81612.1|105177_105705_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	98.0	6.4e-81
AYW81613.1|106028_106679_+	hypothetical protein	NA	J9Q754	Salmonella_phage	99.5	4.1e-114
>prophage 1
CP033695	Yersinia pestis strain FDAARGOS_602 plasmid unnamed2, complete sequence	70174	3349	28280	70174	transposase,integrase,protease	Enterobacteria_phage(37.5%)	28	1714:1728	38645:38659
1714:1728	attL	AAAAAATATTTTTTA	NA	NA	NA	NA
AYW81624.1|3349_4318_-|protease	YopT-type cysteine protease domain-containing protein	protease	NA	NA	NA	NA
AYW81625.1|4817_5366_+	hypothetical protein	NA	NA	NA	NA	NA
AYW81626.1|5842_5956_+	conjugal transfer protein TraT	NA	NA	NA	NA	NA
AYW81627.1|5963_6593_+	complement resistance protein TraT	NA	NA	NA	NA	NA
AYW81628.1|7857_7983_-|integrase	integrase	integrase	NA	NA	NA	NA
AYW81629.1|8604_9771_+	plasmid-partitioning protein SopA	NA	Q7Y3Y6	Yersinia_phage	85.3	3.5e-196
AYW81693.1|9770_10733_+	ParB/RepB/Spo0J family plasmid partition protein	NA	Q7Y3Y7	Yersinia_phage	56.6	3.1e-89
AYW81694.1|10843_11113_-	hypothetical protein	NA	NA	NA	NA	NA
AYW81630.1|11994_12237_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
AYW81631.1|12229_12529_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AYW81632.1|12668_13328_-	hypothetical protein	NA	NA	NA	NA	NA
AYW81633.1|13521_13914_+	YopE regulator	NA	NA	NA	NA	NA
AYW81696.1|14657_14855_-	hypothetical protein	NA	NA	NA	NA	NA
AYW81695.1|14759_14894_+	chemotaxis protein	NA	NA	NA	NA	NA
AYW81634.1|14907_15930_+|transposase	IS21 family transposase IS100	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
AYW81635.1|15926_16709_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	5.9e-139
AYW81636.1|16724_17855_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	95.5	3.2e-202
AYW81637.1|18629_19055_+	CesT family type III secretion system chaperone	NA	NA	NA	NA	NA
AYW81638.1|18978_19167_-	hypothetical protein	NA	NA	NA	NA	NA
AYW81639.1|19202_20302_-|transposase	IS3-like element ISYpe1 family transposase	transposase	S5WIU1	Leptospira_phage	38.5	1.4e-45
AYW81640.1|20401_20731_-	hypothetical protein	NA	NA	NA	NA	NA
AYW81641.1|20869_21334_-	hypothetical protein	NA	NA	NA	NA	NA
AYW81642.1|21352_21904_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	80.3	5.9e-77
AYW81643.1|22067_24383_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	51.6	1.0e-279
AYW81644.1|26671_26971_-	hypothetical protein	NA	NA	NA	NA	NA
AYW81645.1|26994_27264_-	hypothetical protein	NA	NA	NA	NA	NA
AYW81646.1|27332_27791_+	conjugal transfer protein TraI	NA	NA	NA	NA	NA
AYW81647.1|27962_28280_+|transposase	transposase	transposase	NA	NA	NA	NA
38645:38659	attR	AAAAAATATTTTTTA	NA	NA	NA	NA
