The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033717	Yersinia pseudotuberculosis strain FDAARGOS_579 chromosome, complete genome	4614836	59200	100397	4614836	protease,coat,transposase	Moraxella_phage(16.67%)	34	NA	NA
AYW98507.1|59200_60190_-|coat	spore coat protein U	coat	NA	NA	NA	NA
AYW98508.1|60395_62843_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AYW98509.1|62945_63698_-	molecular chaperone	NA	NA	NA	NA	NA
AYW98510.1|63728_64286_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
AYW98511.1|64306_64837_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
AYW98512.1|64842_65397_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
AYW98513.1|65877_68508_-	PqiB family protein	NA	NA	NA	NA	NA
AYW98514.1|68476_69829_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
AYW98515.1|69955_70453_+	GAF domain-containing protein	NA	NA	NA	NA	NA
AYW98516.1|70548_71262_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
AYW98517.1|71281_73360_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.8	4.0e-86
AYW98518.1|73815_74697_+|protease	protease HtpX	protease	NA	NA	NA	NA
AYW98519.1|74632_74821_-	hypothetical protein	NA	NA	NA	NA	NA
AYW98520.1|75355_75898_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AYW98521.1|76033_76813_+	molecular chaperone	NA	NA	NA	NA	NA
AYW98522.1|76894_79507_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AYW98523.1|79503_80667_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AYW98524.1|80663_81467_+	molecular chaperone	NA	NA	NA	NA	NA
AYW98525.1|81520_82888_-	MFS transporter	NA	NA	NA	NA	NA
AYW98526.1|83254_84421_+	oligogalacturonate lyase	NA	NA	NA	NA	NA
AYW98527.1|84607_85399_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
AYW98528.1|85765_86617_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	28.8	1.7e-11
AYW98529.1|86830_88228_-	L-cystine transporter	NA	NA	NA	NA	NA
AYW98530.1|88425_88974_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	32.9	4.0e-09
AYW98531.1|89471_90182_-	porin	NA	NA	NA	NA	NA
AYW98532.1|90479_91772_-	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYW98533.1|91787_92915_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.5	1.6e-12
AYW98534.1|92928_93849_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
AYW98535.1|93841_94732_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AYW98536.1|94772_96440_-	pectate lyase	NA	NA	NA	NA	NA
AYW98537.1|96784_97546_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	3.1e-20
AYW98538.1|97637_98474_-	5-keto-4-deoxyuronate isomerase	NA	NA	NA	NA	NA
AYW98539.1|98809_99142_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AYW98540.1|99188_100397_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
>prophage 2
CP033717	Yersinia pseudotuberculosis strain FDAARGOS_579 chromosome, complete genome	4614836	567840	675616	4614836	transposase,integrase,holin,lysis,plate,capsid,head,tail,portal	Salmonella_phage(38.0%)	112	641641:641700	675769:675891
AYW98929.1|567840_568299_+|transposase	IS200/IS605 family transposase IS1541B	transposase	A0A1S5RHE3	Helicobacter_phage	33.0	1.5e-09
AYW98930.1|568468_569257_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	73.8	2.5e-89
AYW98931.1|569316_569595_-	hypothetical protein	NA	NA	NA	NA	NA
AYW98932.1|570033_570933_-	N-acetyltransferase	NA	NA	NA	NA	NA
AYW98933.1|571228_571696_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
AYW98934.1|571692_573027_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
AYW98935.1|573016_575038_-	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
AYW98936.1|575050_577525_-	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
AYW98937.1|578193_579411_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
AYW98938.1|579551_580439_-	SAM-dependent methyltransferase TehB	NA	NA	NA	NA	NA
AYX02293.1|580611_580923_-	cytochrome c	NA	NA	NA	NA	NA
AYW98939.1|580922_581420_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
AYW98940.1|581409_582123_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.2	1.6e-18
AYW98941.1|582126_583308_-	ABC transporter permease	NA	NA	NA	NA	NA
AYW98942.1|583297_584590_-	ABC transporter permease	NA	NA	NA	NA	NA
AYW98943.1|584592_586002_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
AYW98944.1|586286_586814_-	iron transporter	NA	NA	NA	NA	NA
AYW98945.1|587017_588937_-	FTR1 family iron permease	NA	NA	NA	NA	NA
AYW98946.1|589536_591177_-	MFS transporter	NA	NA	NA	NA	NA
AYW98947.1|591287_592295_-	glutaminase	NA	NA	NA	NA	NA
AYW98948.1|592746_592953_-	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
AYW98949.1|593505_594276_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	64.7	3.1e-84
AYX02294.1|595043_596570_+	L-asparagine permease	NA	NA	NA	NA	NA
AYW98950.1|598305_598905_+	NADH:ubiquinone reductase (Na(+)-transporting) subunit E	NA	NA	NA	NA	NA
AYW98951.1|599209_600154_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYW98952.1|600265_601135_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYW98953.1|602649_603210_+	hypothetical protein	NA	NA	NA	NA	NA
AYW98954.1|603234_603708_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
AYW98955.1|603782_604661_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYW98956.1|604755_605598_+	CoA ester lyase	NA	NA	NA	NA	NA
AYW98957.1|605647_606190_+	MaoC family dehydratase	NA	NA	NA	NA	NA
AYW98958.1|606212_607535_+	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
AYW98959.1|608361_608994_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	32.3	2.7e-09
AYW98960.1|608968_612970_+	response regulator	NA	A0A1V0SGX0	Hokovirus	29.6	1.4e-39
AYW98961.1|613351_613882_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AYW98962.1|613974_614706_+	molecular chaperone	NA	NA	NA	NA	NA
AYW98963.1|614754_617346_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AYW98964.1|617361_618711_+	hypothetical protein	NA	NA	NA	NA	NA
AYW98965.1|618707_619448_+	molecular chaperone	NA	NA	NA	NA	NA
AYW98966.1|620135_621278_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G3M9Y6	Bacillus_virus	30.4	1.1e-21
AYW98967.1|621302_622130_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
AYW98968.1|622122_622983_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
AYW98969.1|623049_624318_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYW98970.1|624347_625361_-	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AYW98971.1|625868_625988_+	transcriptional regulator	NA	NA	NA	NA	NA
AYW98972.1|626024_626822_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYW98973.1|627008_627113_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
AYW98974.1|627790_628225_+	hypothetical protein	NA	NA	NA	NA	NA
AYW98975.1|628236_628806_+	hypothetical protein	NA	NA	NA	NA	NA
AYW98976.1|630469_631546_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
AYW98977.1|631611_631902_-	antitoxin	NA	K4NZP3	Burkholderia_phage	39.4	1.8e-05
AYW98978.1|631903_632155_-	BrnT family toxin	NA	NA	NA	NA	NA
AYW98979.1|632185_632545_+|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	62.5	8.9e-18
AYW98980.1|632541_632841_+	lysozyme	NA	A0A218M4K8	Erwinia_phage	64.9	2.6e-23
AYW98981.1|632857_633145_+	hypothetical protein	NA	NA	NA	NA	NA
AYX02295.1|633656_634100_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
AYX02296.1|634104_634359_+	hypothetical protein	NA	NA	NA	NA	NA
AYW98982.1|634523_635693_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	79.2	5.6e-178
AYW98983.1|635704_636220_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	66.9	8.5e-62
AYW98984.1|636273_636621_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	51.6	8.6e-18
AYX02297.1|636635_636755_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AYW98985.1|636747_639663_+|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	52.3	7.5e-155
AYW98986.1|639674_640139_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	56.2	7.2e-44
AYW98987.1|640135_641230_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	65.2	2.1e-126
AYW98988.1|641304_641520_+	late control protein B	NA	S4TNZ3	Salmonella_phage	60.6	1.1e-18
641641:641700	attL	ACAAAAAAACCGCCTCTCGGCGGTTAACGACATACTCGTACTACTTTGTTTTACTTAGAA	NA	NA	NA	NA
AYW98989.1|641870_642878_-|integrase	integrase	integrase	P79671	Haemophilus_phage	59.3	3.4e-107
AYW98990.1|642885_643398_-	hypothetical protein	NA	NA	NA	NA	NA
AYW98991.1|643459_644098_-	hypothetical protein	NA	NA	NA	NA	NA
AYW98992.1|644115_644508_-	transcriptional regulator	NA	A4JWN8	Burkholderia_virus	47.2	3.2e-21
AYW98993.1|644586_644778_+	hypothetical protein	NA	NA	NA	NA	NA
AYW98994.1|644790_644994_+	DNA-binding protein	NA	U3PFJ1	Vibrio_phage	41.1	9.8e-06
AYW98995.1|645005_645212_+	hypothetical protein	NA	NA	NA	NA	NA
AYW98996.1|645208_645523_+	hypothetical protein	NA	NA	NA	NA	NA
AYW98997.1|645664_645925_+	hypothetical protein	NA	NA	NA	NA	NA
AYW98998.1|645955_646261_+	hypothetical protein	NA	NA	NA	NA	NA
AYW98999.1|646343_647105_+	hypothetical protein	NA	K7ZRM8	Xanthomonas_citri_phage	49.3	1.9e-09
AYW99000.1|647161_647815_+	3'-5' exonuclease	NA	A0A1D9C9N8	Salinivibrio_phage	61.2	1.5e-55
AYW99001.1|647811_648630_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L011	Salmonella_phage	55.9	1.1e-76
AYW99002.1|648626_649490_+	DNA cytosine methyltransferase	NA	W0LM09	Edwardsiella_phage	59.7	8.0e-105
AYW99003.1|649486_652042_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	37.4	3.8e-126
AYW99004.1|652022_652253_+	hypothetical protein	NA	NA	NA	NA	NA
AYW99005.1|652249_652594_+	hypothetical protein	NA	NA	NA	NA	NA
AYW99006.1|653276_654308_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	65.8	3.5e-131
AYW99007.1|654304_655030_-	hypothetical protein	NA	F1BUR2	Erwinia_phage	31.8	2.1e-26
AYW99008.1|655029_656793_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	63.6	3.1e-228
AYW99009.1|656963_657779_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	71.1	9.6e-76
AYW99010.1|657815_658871_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	63.0	8.5e-125
AYW99011.1|658877_659531_+	hypothetical protein	NA	F1BUQ7	Erwinia_phage	46.8	1.7e-43
AYW99012.1|659764_660256_+|head	head completion/stabilization protein	head	A0A1S5NNA6	Burkholderia_phage	48.4	7.9e-33
AYW99013.1|660255_660459_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	70.1	1.8e-23
AYW99014.1|660488_660875_+|holin	holin	holin	NA	NA	NA	NA
AYW99015.1|660861_661257_+	M15 family peptidase	NA	A9DET4	Yersinia_phage	71.0	1.2e-47
AYW99016.1|661261_661684_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	48.6	4.9e-23
AYW99017.1|661571_661796_+	hypothetical protein	NA	NA	NA	NA	NA
AYW99018.1|661782_662250_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	57.2	1.8e-42
AYW99019.1|662246_662693_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	51.4	3.4e-35
AYW99020.1|662711_662963_-	hypothetical protein	NA	NA	NA	NA	NA
AYW99021.1|663024_663726_+	hypothetical protein	NA	NA	NA	NA	NA
AYW99022.1|663993_664692_+|plate	phage baseplate assembly protein V	plate	O80314	Escherichia_phage	62.0	5.0e-65
AYW99023.1|664688_665042_+|plate	baseplate assembly protein	plate	A0A218M4K8	Erwinia_phage	59.3	2.4e-31
AYW99024.1|665044_665953_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	73.2	1.3e-118
AYW99025.1|665945_666554_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	75.0	1.7e-85
AYW99026.1|666550_667990_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	77.8	3.8e-75
AYW99027.1|668000_668480_+|tail	phage tail protein	tail	F1BUP0	Erwinia_phage	41.9	2.0e-28
AYW99028.1|668613_669789_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	79.3	3.9e-179
AYW99029.1|669800_670316_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	67.4	2.9e-62
AYW99030.1|670369_670717_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	51.6	8.6e-18
AYX02298.1|670731_670851_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
AYW99031.1|670843_673759_+|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	52.3	1.5e-155
AYW99032.1|673770_674235_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	56.2	7.2e-44
AYW99033.1|674231_675326_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	66.0	1.2e-126
AYW99034.1|675400_675616_+	late control protein B	NA	S4TNZ3	Salmonella_phage	62.0	4.8e-19
675769:675891	attR	ACAAAAAAACCGCCTCTCGGCGGTTAACGACATACTCGTACTACTTTGTTTTACTTAGAATATTTTCCATGGTGCCCGGGGCGGGACTTGAACCCGCACAGCCATAAGCCGAGGGATTTTAAA	NA	NA	NA	NA
>prophage 3
CP033717	Yersinia pseudotuberculosis strain FDAARGOS_579 chromosome, complete genome	4614836	1185548	1193804	4614836	coat,plate,tail	Shigella_phage(33.33%)	9	NA	NA
AYW99459.1|1185548_1185968_-|tail	phage tail protein	tail	F1BUK2	Cronobacter_phage	33.9	1.4e-06
AYW99460.1|1185969_1186686_-|tail	phage tail protein	tail	NA	NA	NA	NA
AYW99461.1|1186782_1187385_-	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	38.6	2.0e-33
AYW99462.1|1187381_1188518_-|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	30.5	3.5e-31
AYW99463.1|1188521_1188977_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	43.8	4.3e-17
AYW99464.1|1188973_1189570_-|plate	baseplate assembly protein	plate	NA	NA	NA	NA
AYW99465.1|1189585_1190641_-|tail	phage tail protein	tail	M1PVV2	Vibrio_phage	27.2	1.3e-37
AYW99466.1|1190637_1192044_-	hypothetical protein	NA	Q8SBG8	Shigella_phage	33.7	2.1e-17
AYW99467.1|1192310_1193804_-|coat	coat protein	coat	NA	NA	NA	NA
>prophage 4
CP033717	Yersinia pseudotuberculosis strain FDAARGOS_579 chromosome, complete genome	4614836	1461147	1556912	4614836	transposase,integrase,tRNA,protease,plate,capsid,tail	Enterobacteria_phage(20.59%)	101	1483335:1483372	1533987:1534024
AYW99691.1|1461147_1462356_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	50.8	5.4e-51
AYW99692.1|1462503_1463376_-	23S rRNA pseudouridine(2604) synthase RluF	NA	NA	NA	NA	NA
AYW99693.1|1463775_1465983_+	DUF4401 domain-containing protein	NA	NA	NA	NA	NA
AYW99694.1|1465975_1466506_+	hypothetical protein	NA	NA	NA	NA	NA
AYW99695.1|1466661_1469043_+	glycosyl hydrolase	NA	NA	NA	NA	NA
AYW99696.1|1469121_1470750_-	hypothetical protein	NA	NA	NA	NA	NA
AYW99697.1|1471222_1472074_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.1	5.5e-50
AYW99698.1|1472099_1473089_+	aldo/keto reductase	NA	NA	NA	NA	NA
AYW99699.1|1473143_1474037_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYW99700.1|1474339_1474645_-	hypothetical protein	NA	NA	NA	NA	NA
AYX02326.1|1474741_1475113_-	hypothetical protein	NA	NA	NA	NA	NA
AYW99701.1|1475124_1476444_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AYW99702.1|1476436_1478200_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
AYW99703.1|1478196_1478829_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AYW99704.1|1478838_1479768_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AYW99705.1|1479760_1480363_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
AYX02327.1|1480395_1480533_-	type VI secretion protein	NA	NA	NA	NA	NA
AYW99706.1|1480762_1480969_-	hypothetical protein	NA	NA	NA	NA	NA
AYW99707.1|1481180_1481459_+	hypothetical protein	NA	A0A192Y6Q1	Salmonella_phage	73.8	8.4e-32
AYW99708.1|1481541_1481880_+	hypothetical protein	NA	NA	NA	NA	NA
AYW99709.1|1481864_1482512_+	hypothetical protein	NA	NA	NA	NA	NA
AYW99710.1|1482625_1482826_+	hypothetical protein	NA	NA	NA	NA	NA
AYW99711.1|1483084_1483267_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
1483335:1483372	attL	CCCTACAGGGCTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AYX02328.1|1483526_1483895_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	32.0	9.5e-07
AYW99712.1|1485374_1486373_-	hypothetical protein	NA	NA	NA	NA	NA
AYW99713.1|1488034_1488268_-	hypothetical protein	NA	I6PDJ9	Cronobacter_phage	40.0	5.6e-05
AYW99714.1|1488347_1488980_-	hypothetical protein	NA	NA	NA	NA	NA
AYW99715.1|1489240_1489951_-	peptidase P60	NA	K7P6F5	Enterobacteria_phage	77.3	8.8e-110
AYW99716.1|1489953_1490706_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	67.7	9.4e-102
AYW99717.1|1490722_1491064_-|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	50.4	3.1e-28
AYW99718.1|1491066_1491273_-	hypothetical protein	NA	K7PLQ6	Enterobacteria_phage	74.4	2.5e-09
AYW99719.1|1491377_1492100_+	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	55.5	2.3e-65
AYW99720.1|1492236_1492659_+	hypothetical protein	NA	NA	NA	NA	NA
AYW99721.1|1492771_1493470_+	hypothetical protein	NA	NA	NA	NA	NA
AYW99722.1|1493466_1494048_+	VapC toxin family PIN domain ribonuclease	NA	NA	NA	NA	NA
AYW99723.1|1494116_1494431_-	DUF2767 family protein	NA	NA	NA	NA	NA
AYW99724.1|1494745_1495366_+	hypothetical protein	NA	A0A248SL35	Klebsiella_phage	34.5	6.9e-18
AYW99725.1|1495439_1495682_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	70.1	2.5e-24
AYW99726.1|1495695_1495941_+	DinI family protein	NA	K7PLW4	Enterobacteria_phage	45.0	1.5e-11
AYW99727.1|1496327_1496765_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	34.7	6.8e-12
AYW99728.1|1496774_1497866_-|tail	phage tail protein	tail	Q76YB0	Aeromonas_virus	38.6	4.8e-06
AYW99729.1|1497916_1498513_-	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	38.3	1.1e-33
AYW99730.1|1498509_1499646_-|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	31.7	3.7e-33
AYW99731.1|1499649_1500087_-	hypothetical protein	NA	A0A0C4UR04	Shigella_phage	46.2	2.3e-20
AYW99732.1|1500083_1500677_-|plate	baseplate assembly protein	plate	NA	NA	NA	NA
AYW99733.1|1500676_1501747_-|tail	phage tail protein	tail	M1PVV2	Vibrio_phage	30.9	3.1e-42
AYW99734.1|1501743_1503150_-	hypothetical protein	NA	A0A192Y5U9	Salmonella_phage	27.7	2.3e-24
AYW99735.1|1503226_1503757_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	59.8	4.2e-24
AYW99736.1|1503860_1505807_-	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	24.0	2.3e-14
AYW99737.1|1505929_1506229_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AYW99738.1|1506230_1506605_-|tail	phage tail protein	tail	NA	NA	NA	NA
AYW99739.1|1506617_1508051_-	hypothetical protein	NA	B5TK67	Pseudomonas_phage	47.4	4.3e-71
AYW99740.1|1508047_1508392_-	hypothetical protein	NA	NA	NA	NA	NA
AYW99741.1|1508391_1508784_-	hypothetical protein	NA	NA	NA	NA	NA
AYW99742.1|1508785_1509832_-|capsid	major capsid protein	capsid	A0A059WRQ2	Vibrio_phage	31.4	2.6e-41
AYX02329.1|1509941_1510352_-	hypothetical protein	NA	K7PH49	Enterobacterial_phage	47.0	2.4e-11
AYW99743.1|1510606_1510852_+	hypothetical protein	NA	NA	NA	NA	NA
AYW99744.1|1511022_1512177_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	70.7	3.6e-161
AYW99745.1|1512380_1513229_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AYW99746.1|1513895_1514279_-	toxin CbtA	NA	NA	NA	NA	NA
AYW99747.1|1514342_1514672_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AYW99748.1|1514684_1515155_-	DNA repair protein RadC	NA	NA	NA	NA	NA
AYW99749.1|1515225_1516047_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.4	4.0e-45
AYW99750.1|1516135_1516474_-	hypothetical protein	NA	NA	NA	NA	NA
AYW99751.1|1516494_1516959_-	hypothetical protein	NA	NA	NA	NA	NA
AYW99752.1|1516971_1517070_-	hypothetical protein	NA	NA	NA	NA	NA
AYW99753.1|1517459_1518347_-	GTP-binding protein HSR1	NA	NA	NA	NA	NA
AYW99754.1|1518438_1519812_-	hypothetical protein	NA	NA	NA	NA	NA
AYW99755.1|1520375_1520963_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AYW99756.1|1521060_1521267_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AYW99757.1|1521837_1522533_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
AYW99758.1|1522855_1523602_+	HNH endonuclease	NA	NA	NA	NA	NA
AYW99759.1|1523684_1525733_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AYW99760.1|1525743_1527666_+	hypothetical protein	NA	NA	NA	NA	NA
AYW99761.1|1527930_1528260_+	hypothetical protein	NA	NA	NA	NA	NA
AYW99762.1|1528259_1531532_+	hypothetical protein	NA	NA	NA	NA	NA
AYW99763.1|1532348_1532534_-	recombinase	NA	Q7M297	Enterobacteria_phage	57.1	2.8e-07
AYW99764.1|1532575_1533784_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	57.5	6.1e-135
AYW99765.1|1534271_1535138_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.1	2.2e-30
1533987:1534024	attR	CCCTACAGGGCTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AYW99766.1|1535152_1535365_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
AYW99767.1|1535586_1536972_-|tRNA	cysteine--tRNA ligase	tRNA	A0A0G2Y344	Acanthamoeba_polyphaga_mimivirus	28.9	2.6e-41
AYW99768.1|1537182_1537677_+	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
AYW99769.1|1537687_1538410_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
AYW99770.1|1538496_1538706_-	hypothetical protein	NA	NA	NA	NA	NA
AYW99771.1|1538725_1539250_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
AYW99772.1|1539246_1540311_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
AYW99773.1|1540354_1542784_-	ABC transporter permease	NA	NA	NA	NA	NA
AYW99774.1|1542780_1543467_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	2.1e-31
AYX02330.1|1543434_1544073_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
AYW99775.1|1544459_1545236_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AYW99776.1|1545312_1546182_+	co-chaperone YbbN	NA	NA	NA	NA	NA
AYW99777.1|1546376_1547291_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
AYW99778.1|1547293_1547743_+	NfeD family protein	NA	NA	NA	NA	NA
AYW99779.1|1547922_1548342_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AYW99780.1|1548548_1551434_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	36.8	7.8e-112
AYW99781.1|1551706_1552516_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
AYW99782.1|1552779_1553259_+|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
AYW99783.1|1553550_1553835_+	hypothetical protein	NA	NA	NA	NA	NA
AYW99784.1|1553938_1554562_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
AYW99785.1|1554555_1555593_-	hypothetical protein	NA	NA	NA	NA	NA
AYW99786.1|1556453_1556912_+|transposase	IS200/IS605 family transposase IS1541B	transposase	A0A1S5RHE3	Helicobacter_phage	33.0	1.5e-09
>prophage 5
CP033717	Yersinia pseudotuberculosis strain FDAARGOS_579 chromosome, complete genome	4614836	1562529	1569993	4614836		Bacillus_phage(16.67%)	6	NA	NA
AYW99790.1|1562529_1563903_-	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	29.1	2.8e-35
AYW99791.1|1564206_1565166_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2D2W2D2	Stenotrophomonas_phage	29.3	4.7e-05
AYW99792.1|1565513_1566263_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	36.0	1.8e-07
AYW99793.1|1566297_1567692_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.7	2.6e-52
AYW99794.1|1567900_1568866_-	GDP-L-fucose synthase	NA	M1HWW2	Paramecium_bursaria_Chlorella_virus	47.9	2.1e-82
AYW99795.1|1568871_1569993_-	GDP-mannose 4,6-dehydratase	NA	M1HVG7	Acanthocystis_turfacea_Chlorella_virus	64.4	5.8e-132
>prophage 6
CP033717	Yersinia pseudotuberculosis strain FDAARGOS_579 chromosome, complete genome	4614836	2981211	3033327	4614836	transposase,protease,plate,tail	Pseudomonas_phage(33.33%)	58	NA	NA
AYX00948.1|2981211_2981364_-|transposase	transposase	transposase	NA	NA	NA	NA
AYX00949.1|2981427_2982186_-	DeoR/GlpR family transcriptional regulator	NA	NA	NA	NA	NA
AYX00950.1|2982220_2983057_-|protease	rhomboid family intramembrane serine protease GlpG	protease	NA	NA	NA	NA
AYX00951.1|2983074_2983404_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
AYX00952.1|2983778_2986490_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AYX00953.1|2986807_2989213_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	39.1	4.0e-13
AYX00954.1|2989225_2991322_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
AYX00955.1|2991506_2992082_-	Fe-S biogenesis protein NfuA	NA	NA	NA	NA	NA
AYX00956.1|2992141_2992843_-	DNA utilization protein GntX	NA	NA	NA	NA	NA
AYX00957.1|2992929_2993706_+	pimeloyl-[acyl-carrier protein] methyl ester esterase	NA	NA	NA	NA	NA
AYX00958.1|2993875_2994145_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
AYX00959.1|2994282_2994540_-	ferrous iron transporter C	NA	NA	NA	NA	NA
AYX00960.1|2994575_2996891_-	Fe(2+) transporter permease subunit FeoB	NA	NA	NA	NA	NA
AYX00961.1|2996982_2997210_-	ferrous iron transporter A	NA	NA	NA	NA	NA
AYX00962.1|2997733_3000109_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
AYX00963.1|3000642_3001158_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
AYX00964.1|3001293_3002013_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	2.7e-29
AYX00965.1|3002009_3003362_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	24.1	1.6e-11
AYX00966.1|3003700_3005320_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.0	1.6e-138
AYX00967.1|3005516_3006398_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
AYX00968.1|3006560_3006968_-	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
AYX00969.1|3006996_3007677_-	GMP/IMP nucleotidase	NA	NA	NA	NA	NA
AYX00970.1|3007820_3009968_-	intracellular growth attenuator family protein	NA	NA	NA	NA	NA
AYX00971.1|3010554_3011100_+	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
AYX00972.1|3011220_3011976_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	65.1	9.1e-97
AYX00973.1|3012107_3012545_-|tail	tail assembly chaperone	tail	B6SCW7	Bacteriophage	35.4	4.0e-12
AYX02397.1|3013783_3014335_-	DUF2313 domain-containing protein	NA	A0A0M3LQE1	Mannheimia_phage	34.8	4.0e-25
AYX00974.1|3014349_3015411_-|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	46.0	1.6e-75
AYX00975.1|3015410_3015761_-	hypothetical protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	62.6	1.7e-29
AYX00976.1|3015815_3016466_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	48.2	2.5e-50
AYX00977.1|3016455_3017679_-|tail	phage tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	36.0	2.8e-71
AYX02398.1|3017662_3018964_-	multidrug DMT transporter permease	NA	A0A2H4JGT4	uncultured_Caudovirales_phage	30.9	1.4e-41
AYX00978.1|3018983_3021191_-|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	41.8	3.5e-96
AYX00979.1|3021628_3021826_-	hypothetical protein	NA	NA	NA	NA	NA
AYX00980.1|3021818_3022319_-	DUF1804 family protein	NA	A0A0A1IX73	Pseudomonas_phage	59.0	1.3e-51
AYX00981.1|3022321_3022609_-	hypothetical protein	NA	NA	NA	NA	NA
AYX00982.1|3022605_3022848_-	hypothetical protein	NA	NA	NA	NA	NA
AYX02399.1|3022844_3023384_-	hypothetical protein	NA	A0A2D1GNR2	Pseudomonas_phage	44.3	1.5e-24
AYX00983.1|3023409_3023664_-	hypothetical protein	NA	A0A2D1GNW8	Pseudomonas_phage	47.6	1.8e-12
AYX02400.1|3023654_3024287_-	glycoside hydrolase family 19 protein	NA	F1C5D2	Cronobacter_phage	61.1	4.1e-66
AYX00984.1|3024384_3024654_-	hypothetical protein	NA	NA	NA	NA	NA
AYX00985.1|3024665_3025100_-	hypothetical protein	NA	A0A2D1GNW5	Pseudomonas_phage	50.7	3.8e-31
AYX00986.1|3025099_3025501_-	regulatory protein GemA	NA	A0A0A7DJY7	Pseudomonas_phage	42.7	2.3e-22
AYX02401.1|3025485_3025950_-	hypothetical protein	NA	NA	NA	NA	NA
AYX00987.1|3025951_3026344_-	hypothetical protein	NA	NA	NA	NA	NA
AYX00988.1|3026336_3026546_-	hypothetical protein	NA	NA	NA	NA	NA
AYX00989.1|3026545_3027088_-	hypothetical protein	NA	J9Q748	Salmonella_phage	52.9	5.6e-48
AYX00990.1|3027077_3027320_-	hypothetical protein	NA	NA	NA	NA	NA
AYX00991.1|3027316_3027538_-	hypothetical protein	NA	A0A2D1GNI2	Pseudomonas_phage	54.5	9.1e-13
AYX00992.1|3027534_3028035_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
AYX00993.1|3028034_3028733_-	DUF2786 domain-containing protein	NA	A0A2H4JCP9	uncultured_Caudovirales_phage	33.5	1.7e-17
AYX00994.1|3028815_3029007_-	hypothetical protein	NA	NA	NA	NA	NA
AYX00995.1|3029008_3029647_-	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	56.5	1.6e-62
AYX00996.1|3029636_3029837_-	hypothetical protein	NA	NA	NA	NA	NA
AYX00997.1|3029843_3030077_-	hypothetical protein	NA	A0A2D1GNI5	Pseudomonas_phage	55.3	1.5e-18
AYX00998.1|3030095_3030986_-	ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	52.1	5.9e-79
AYX02402.1|3031028_3033071_-|transposase	transposase	transposase	A0A2D1GNK9	Pseudomonas_phage	51.7	3.6e-188
AYX02403.1|3033084_3033327_-	transcriptional regulator	NA	M1PVU4	Vibrio_phage	59.4	1.1e-16
>prophage 7
CP033717	Yersinia pseudotuberculosis strain FDAARGOS_579 chromosome, complete genome	4614836	3294739	3353755	4614836	protease,tail	uncultured_Mediterranean_phage(18.18%)	57	NA	NA
AYX01220.1|3294739_3296185_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
AYX01221.1|3296386_3299245_-	RHS repeat protein	NA	NA	NA	NA	NA
AYX01222.1|3299458_3299818_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
AYX01223.1|3299814_3300216_-	M15 family peptidase	NA	A0A249XWK9	Proteus_phage	61.0	3.6e-36
AYX01224.1|3300228_3300531_-	hypothetical protein	NA	NA	NA	NA	NA
AYX01225.1|3300664_3305134_-	toxin	NA	NA	NA	NA	NA
AYX01226.1|3305190_3308784_-|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
AYX01227.1|3308824_3311326_-	toxin	NA	NA	NA	NA	NA
AYX01228.1|3311561_3312428_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYX01229.1|3312688_3313600_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
AYX01230.1|3313902_3314106_+	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
AYX01231.1|3314113_3315049_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
AYX01232.1|3315050_3317006_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
AYX01233.1|3317272_3318742_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AYX02417.1|3318951_3319410_+	ribonuclease	NA	NA	NA	NA	NA
AYX01234.1|3319414_3319696_+	ribonuclease inhibitor	NA	NA	NA	NA	NA
AYX01235.1|3319791_3320340_-	ribosome-associated protein	NA	NA	NA	NA	NA
AYX01236.1|3320520_3321861_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
AYX01237.1|3321990_3322629_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	49.0	5.8e-52
AYX01238.1|3322836_3323223_+	soluble cytochrome b562 2	NA	NA	NA	NA	NA
AYX02418.1|3323454_3323865_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
AYX01239.1|3324217_3325879_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
AYX01240.1|3325973_3327389_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
AYX01241.1|3327799_3328753_-	HTH-type transcriptional regulator TreR	NA	NA	NA	NA	NA
AYX01242.1|3328986_3329463_-	hypothetical protein	NA	NA	NA	NA	NA
AYX01243.1|3329761_3330148_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
AYX01244.1|3330285_3330750_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
AYX01245.1|3330761_3331697_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	38.9	3.9e-49
AYX02419.1|3331887_3332139_+	hypothetical protein	NA	NA	NA	NA	NA
AYX01246.1|3332034_3332307_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
AYX01247.1|3332303_3333158_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.0	3.2e-05
AYX01248.1|3333182_3333437_+	hypothetical protein	NA	NA	NA	NA	NA
AYX02420.1|3333463_3333946_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
AYX01249.1|3334064_3334352_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
AYX01250.1|3334375_3335809_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
AYX01251.1|3335870_3336596_-	lipopolysaccharide ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.4e-22
AYX01252.1|3336602_3337148_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
AYX01253.1|3337131_3337695_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
AYX01254.1|3337691_3338255_-	3-deoxy-D-manno-octulosonate 8-phosphate phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	83.0	9.6e-59
AYX02421.1|3338804_3339791_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	30.8	6.0e-40
AYX01255.1|3339901_3340876_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
AYX01256.1|3341140_3341959_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	2.2e-19
AYX01257.1|3342176_3342959_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
AYX01258.1|3342963_3343521_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
AYX01259.1|3343533_3344157_+	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
AYX01260.1|3344192_3344495_+	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
AYX01261.1|3344641_3344896_+	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
AYX01262.1|3345049_3346312_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AYX01263.1|3346492_3347581_-|protease	serine endoprotease DegS	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	31.8	2.1e-09
AYX01264.1|3347670_3349044_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.2	7.4e-20
AYX01265.1|3349314_3349719_-	DUF1043 family protein	NA	NA	NA	NA	NA
AYX01266.1|3349942_3351070_+	cell division protein ZapE	NA	NA	NA	NA	NA
AYX01267.1|3351383_3351812_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
AYX01268.1|3351826_3352219_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
AYX01269.1|3352215_3352413_-	hypothetical protein	NA	NA	NA	NA	NA
AYX01270.1|3352592_3353234_+	stringent starvation protein A	NA	NA	NA	NA	NA
AYX01271.1|3353239_3353755_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.6	3.6e-28
>prophage 8
CP033717	Yersinia pseudotuberculosis strain FDAARGOS_579 chromosome, complete genome	4614836	3746338	3811646	4614836	transposase,tRNA,terminase,protease,capsid,head,tail	Cronobacter_phage(46.15%)	63	NA	NA
AYX01549.1|3746338_3746797_+|transposase	IS200/IS605-like element IS1541B family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.0	1.5e-09
AYX01550.1|3746869_3747061_+	hypothetical protein	NA	NA	NA	NA	NA
AYX01551.1|3747050_3747509_+|transposase	IS200/IS605 family transposase IS1541B	transposase	A0A1S5RHE3	Helicobacter_phage	33.0	1.5e-09
AYX01552.1|3747822_3748575_-|protease	metalloprotease	protease	NA	NA	NA	NA
AYX01553.1|3748834_3749062_+	hypothetical protein	NA	NA	NA	NA	NA
AYX01554.1|3749048_3751043_+	transketolase	NA	NA	NA	NA	NA
AYX01555.1|3751457_3752474_+	D-erythrose-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYX01556.1|3752576_3753740_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYX01557.1|3753859_3754939_+	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
AYX01558.1|3754842_3755052_-	hypothetical protein	NA	NA	NA	NA	NA
AYX01559.1|3755376_3756246_+	small-conductance mechanosensitive channel MscS	NA	NA	NA	NA	NA
AYX01560.1|3756491_3757109_+	arginine exporter ArgO	NA	NA	NA	NA	NA
AYX02448.1|3757298_3758078_+	oxidative stress defense protein	NA	NA	NA	NA	NA
AYX01561.1|3758088_3758997_-	LysR family transcriptional regulator ArgP	NA	NA	NA	NA	NA
AYX01562.1|3759338_3759995_+	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
AYX01563.1|3760301_3761543_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	46.5	2.1e-98
AYX01564.1|3761807_3762404_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
AYX01565.1|3762767_3763097_-	cell division protein ZapA	NA	NA	NA	NA	NA
AYX02449.1|3763175_3763295_+	AAA family ATPase	NA	NA	NA	NA	NA
AYX01566.1|3763433_3764012_+	YecA family protein	NA	NA	NA	NA	NA
AYX01567.1|3764099_3765413_+	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
AYX01568.1|3765549_3766728_+	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
AYX01569.1|3766900_3768121_+	FAD-dependent 2-octaprenylphenol hydroxylase	NA	NA	NA	NA	NA
AYX01570.1|3768086_3768326_+	hypothetical protein	NA	NA	NA	NA	NA
AYX01571.1|3768841_3769939_+	aminomethyltransferase	NA	NA	NA	NA	NA
AYX01572.1|3770007_3770394_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
AYX01573.1|3770605_3773485_+	glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.3	1.7e-268
AYX01574.1|3773862_3774300_+	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
AYX02450.1|3775512_3777510_+	hypothetical protein	NA	NA	NA	NA	NA
AYX01575.1|3777571_3778717_+	hypothetical protein	NA	NA	NA	NA	NA
AYX01576.1|3778918_3779620_+	hemolysin III family protein	NA	NA	NA	NA	NA
AYX01577.1|3779911_3780409_+	DUF2165 family protein	NA	NA	NA	NA	NA
AYX01578.1|3780481_3781474_-|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
AYX01579.1|3781790_3782057_+	FAD assembly factor SdhE	NA	NA	NA	NA	NA
AYX01580.1|3782037_3782463_+	hypothetical protein	NA	NA	NA	NA	NA
AYX01581.1|3782462_3783161_+	two-component system response regulator CreB	NA	NA	NA	NA	NA
AYX01582.1|3783185_3784619_+	two-component system sensor histidine kinase CreC	NA	NA	NA	NA	NA
AYX01583.1|3784682_3786161_+	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
AYX01584.1|3786245_3786764_-	flavodoxin FldB	NA	NA	NA	NA	NA
AYX01585.1|3786870_3787770_+	tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	29.7	8.5e-33
AYX01586.1|3787800_3788517_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
AYX01587.1|3788523_3790257_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.8	1.2e-64
AYX01588.1|3790435_3791533_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	5.4e-05
AYX01589.1|3791543_3793061_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.0	1.1e-85
AYX01590.1|3793493_3794708_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	58.8	3.7e-132
AYX01591.1|3795210_3795399_+	hypothetical protein	NA	NA	NA	NA	NA
AYX01592.1|3795530_3797228_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	48.9	2.4e-129
AYX02451.1|3797224_3797770_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	51.1	8.5e-36
AYX01593.1|3797771_3798482_-	hypothetical protein	NA	Q94MX8	Haemophilus_virus	28.1	4.2e-11
AYX01594.1|3798478_3798997_-|tail	tail assembly chaperone	tail	A9DEL3	Yersinia_phage	50.6	8.3e-41
AYX01595.1|3798996_3800592_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	40.2	1.8e-54
AYX01596.1|3800601_3801225_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	57.9	1.2e-57
AYX01597.1|3801217_3802402_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	59.0	3.0e-134
AYX01598.1|3802398_3802728_-	DUF2590 family protein	NA	Q94MY3	Haemophilus_virus	60.4	4.6e-29
AYX01599.1|3803172_3804339_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	52.6	1.1e-101
AYX01600.1|3804335_3805037_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	43.8	3.3e-40
AYX01601.1|3804996_3805503_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	38.9	2.7e-20
AYX01602.1|3805499_3805952_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	52.7	2.8e-37
AYX01603.1|3806071_3806815_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	53.6	1.4e-65
AYX01604.1|3806832_3808005_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	46.7	2.0e-82
AYX01605.1|3808087_3809023_-|capsid	phage capsid protein	capsid	A5X9H4	Aeromonas_virus	54.3	3.5e-37
AYX01606.1|3809200_3811294_+|terminase	terminase	terminase	Q94MZ6	Haemophilus_virus	49.7	2.0e-170
AYX01607.1|3811280_3811646_+	hypothetical protein	NA	F1BUM7	Cronobacter_phage	67.6	9.3e-39
