The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033685	Pseudomonas aeruginosa strain H26023 chromosome, complete genome	6729216	651658	732069	6729216	holin,tail,plate,tRNA	Pseudomonas_phage(35.9%)	85	NA	NA
AYW64194.1|651658_652684_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	6.3e-109
AYW64195.1|652762_653332_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
AYW64196.1|653415_653769_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
AYW64197.1|653759_654302_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AYW64198.1|654274_655507_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.3	2.0e-77
AYW64199.1|655550_656057_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
AYW64200.1|656151_657705_-	SpoVR family protein	NA	NA	NA	NA	NA
AYW64201.1|657701_658973_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
AYW64202.1|659073_660996_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
AYW64203.1|661274_661607_-	thiosulfate sulfurtransferase	NA	NA	NA	NA	NA
AYW64204.1|661650_662502_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	33.3	1.1e-08
AYW64205.1|662501_662882_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
AYW64206.1|662918_663725_-	ribosomal RNA small subunit methyltransferase A	NA	NA	NA	NA	NA
AYW64207.1|663840_664827_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
AYW64208.1|664823_666116_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
AYW64209.1|666096_668871_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
AYW64210.1|668997_670014_+	aminoglycoside phosphotransferase	NA	NA	NA	NA	NA
AYW64211.1|670010_670685_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
AYW64212.1|670686_671445_+	molecular chaperone DjlA	NA	NA	NA	NA	NA
AYW64213.1|671445_672507_-	DUF3530 family protein	NA	NA	NA	NA	NA
AYW64214.1|672658_675052_+	PAS domain S-box protein	NA	NA	NA	NA	NA
AYW64215.1|675097_675730_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AYW64216.1|675858_676893_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
AYW64217.1|677126_678236_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
AYW64218.1|678291_679338_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYW64219.1|679452_680700_+	ABC transporter permease	NA	NA	NA	NA	NA
AYW64220.1|680805_681636_+	ABC transporter permease	NA	NA	NA	NA	NA
AYW64221.1|681759_682434_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
AYW64222.1|682433_683252_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
AYW64223.1|683324_684803_+	anthranilate synthase component I	NA	NA	NA	NA	NA
AYW64224.1|684989_685304_-	transcription regulatory protein PrtN	NA	NA	NA	NA	NA
AYW64225.1|685403_686174_-	transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.1	1.0e-71
AYW64226.1|686631_686832_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
AYW64227.1|686879_687239_+	hypothetical protein	NA	NA	NA	NA	NA
AYW64228.1|687602_688052_+|holin	holin	holin	B5TK61	Pseudomonas_phage	53.3	5.0e-26
AYW64229.1|688073_688589_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	43.4	1.8e-32
AYW64230.1|688585_689143_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	71.1	4.6e-45
AYW64231.1|689295_689622_+|plate	phage baseplate protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	3.2e-30
AYW64232.1|689618_690506_+	bacteriophage protein	NA	S4TNY7	Salmonella_phage	59.8	5.3e-88
AYW64233.1|690498_691032_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.6	5.2e-62
AYW64234.1|691033_693109_+|tail	phage tail protein	tail	Q9ZXK6	Pseudomonas_virus	50.3	3.9e-198
AYW64235.1|693105_693564_+|tail	phage tail protein	tail	NA	NA	NA	NA
AYW64236.1|693606_694767_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.4	2.7e-188
AYW64237.1|694779_695283_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	8.0e-65
AYW64238.1|695297_695642_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
AYW64239.1|695811_698049_+|tail	phage tail tape measure protein	tail	NA	NA	NA	NA
AYW64240.1|698058_698931_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	51.4	1.1e-74
AYW64241.1|698905_699112_+|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
AYW64242.1|699169_700159_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.8	2.8e-106
AYW64243.1|700191_700821_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.0	7.1e-87
AYW64244.1|700817_701180_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	47.9	4.2e-15
AYW64245.1|701176_701434_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	6.4e-18
AYW64246.1|701448_701736_+	hypothetical protein	NA	NA	NA	NA	NA
AYW64247.1|701749_702244_+|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	56.5	1.4e-45
AYW64248.1|702255_702603_+	hypothetical protein	NA	NA	NA	NA	NA
AYW64249.1|702632_702887_+	hypothetical protein	NA	A0A2H4PI34	Pseudomonas_phage	38.4	6.3e-10
AYW64250.1|702933_704769_+|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	35.8	3.4e-28
AYW64251.1|704761_705103_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	40.0	1.4e-17
AYW64252.1|705110_705806_+|tail	phage minor tail protein L	tail	A0A1B0VNE0	Pseudomonas_phage	50.2	1.5e-69
AYW64253.1|705808_706579_+|tail	phage tail protein	tail	A0A2D1GNP8	Pseudomonas_phage	55.6	4.2e-81
AYW64254.1|706633_707236_+|tail	tail assembly protein	tail	A0A1V0E8A0	Vibrio_phage	57.3	4.9e-53
AYW64255.1|707294_710954_+	DUF1983 domain-containing protein	NA	A0A0S2SYC5	Pseudomonas_phage	56.3	0.0e+00
AYW64256.1|711983_713036_+|tail	phage tail protein	tail	A0A0H5AXZ9	Pseudomonas_phage	50.9	2.9e-64
AYW64257.1|713035_713338_+	hypothetical protein	NA	A0A0H5B141	Pseudomonas_phage	71.0	4.4e-34
AYW64258.1|713334_713565_+	hypothetical protein	NA	C8ZKF3	Pseudomonas_phage	71.6	1.4e-24
AYW64259.1|713983_714589_+	glutamine amidotransferase	NA	A0A0P0IKJ1	Acinetobacter_phage	66.3	2.1e-75
AYW64260.1|714590_715640_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
AYW64261.1|715636_716473_+	indole-3-glycerol-phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	56.9	2.8e-70
AYW64262.1|716534_717179_-	cyclic AMP receptor-like protein	NA	NA	NA	NA	NA
AYW64263.1|717450_717873_+	OsmC family protein	NA	NA	NA	NA	NA
AYW64264.1|718192_718987_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
AYW64265.1|719041_719689_-	2-nonaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase	NA	NA	NA	NA	NA
AYW64266.1|719788_720127_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
AYW64267.1|720205_721687_+	AAA family ATPase	NA	U5XJW0	Phormidium_phage	33.8	3.9e-67
AYW64268.1|721726_722527_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AYW64269.1|722587_723670_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
AYW64270.1|723791_724760_-	nitronate monooxygenase	NA	NA	NA	NA	NA
AYW64271.1|724776_725199_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
AYW64272.1|725489_726524_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
AYW64273.1|726523_727243_+	hypothetical protein	NA	NA	NA	NA	NA
AYW64274.1|727243_727666_+	polymer-forming cytoskeletal family protein	NA	NA	NA	NA	NA
AYW64275.1|727743_728094_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	3.0e-26
AYW64276.1|728147_729239_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
AYW69642.1|729241_730585_-	peptidase M23	NA	O03937	Lactobacillus_phage	44.1	3.0e-18
AYW64277.1|730869_732069_+|tRNA	Tyrosine--tRNA ligase 2	tRNA	NA	NA	NA	NA
>prophage 2
CP033685	Pseudomonas aeruginosa strain H26023 chromosome, complete genome	6729216	1489978	1499006	6729216		Bacillus_phage(33.33%)	9	NA	NA
AYW69670.1|1489978_1490614_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
AYW64949.1|1490659_1491553_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
AYW64950.1|1491657_1492662_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
AYW64951.1|1493087_1493411_-	Ferredoxin 1	NA	NA	NA	NA	NA
AYW64952.1|1493477_1496045_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	2.4e-24
AYW64953.1|1496024_1496189_+	TolB-like translocation protein	NA	NA	NA	NA	NA
AYW64954.1|1496170_1497178_-	TolB-like translocation protein	NA	NA	NA	NA	NA
AYW64955.1|1497325_1497832_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	8.1e-57
AYW64956.1|1497965_1499006_+	DNA recombination/repair protein RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
>prophage 3
CP033685	Pseudomonas aeruginosa strain H26023 chromosome, complete genome	6729216	2697696	2704590	6729216	tRNA	uncultured_Caudovirales_phage(83.33%)	9	NA	NA
AYW66058.1|2697696_2698977_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	8.2e-98
AYW66059.1|2698978_2700376_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
AYW66060.1|2700380_2701355_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
AYW66061.1|2701442_2702426_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.3	9.3e-142
AYW66062.1|2702422_2702758_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	3.3e-38
AYW66063.1|2702754_2703060_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
AYW66064.1|2703059_2703419_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
AYW66065.1|2703415_2703811_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	72.1	2.7e-47
AYW66066.1|2703921_2704590_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
>prophage 4
CP033685	Pseudomonas aeruginosa strain H26023 chromosome, complete genome	6729216	2999750	3045349	6729216	transposase,lysis,tail,integrase	Pseudomonas_phage(90.74%)	55	3011338:3011369	3046676:3046707
AYW66302.1|2999750_3000779_-	CRISPR-associated protein Csy3	NA	A0A2D0YYX4	Vibrio_phage	40.2	9.3e-52
AYW66303.1|3000789_3001773_-	type I-F CRISPR-associated protein Csy2	NA	A0A2I7RCX5	Vibrio_phage	26.7	1.7e-05
AYW66304.1|3001759_3003064_-	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
AYW66305.1|3003121_3006352_-	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	29.3	4.3e-87
AYW66306.1|3006348_3007233_-	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	37.3	2.6e-42
AYW66307.1|3007287_3007572_-	hypothetical protein	NA	L7P826	Pseudomonas_phage	91.5	1.7e-43
AYW66308.1|3007568_3008720_-	hypothetical protein	NA	A7Y8R8	Pseudomonas_virus	99.0	1.2e-228
AYW66309.1|3008716_3010927_-	hypothetical protein	NA	A0A0S4L2V2	Pseudomonas_phage	97.6	0.0e+00
AYW66310.1|3010913_3011144_-	hypothetical protein	NA	J9RWP7	Pseudomonas_phage	97.4	1.4e-37
AYW66311.1|3011140_3011371_-	hypothetical protein	NA	A0A0S4L0K8	Pseudomonas_phage	100.0	2.7e-36
3011338:3011369	attL	ACGACGCGACCAGAATCGCGATTTGCACCCAC	NA	NA	NA	NA
AYW66312.1|3011380_3012199_-	DUF2163 domain-containing protein	NA	J9SP65	Pseudomonas_phage	99.6	1.0e-165
AYW66313.1|3012185_3013892_-	hypothetical protein	NA	J9STL4	Pseudomonas_phage	97.0	0.0e+00
AYW66314.1|3013894_3014818_-	hypothetical protein	NA	A0A0S4L5N6	Pseudomonas_phage	97.4	3.1e-179
AYW66315.1|3014820_3015780_-	hypothetical protein	NA	J9RWP3	Pseudomonas_phage	98.4	6.9e-190
AYW66316.1|3015779_3019412_-|tail	tail length tape measure protein	tail	J9SH65	Pseudomonas_phage	96.2	0.0e+00
AYW66317.1|3019665_3020148_-	hypothetical protein	NA	J9STT8	Pseudomonas_phage	100.0	1.3e-83
AYW66318.1|3020150_3020891_-	hypothetical protein	NA	J9SVZ4	Pseudomonas_phage	100.0	1.2e-136
AYW66319.1|3020897_3021101_-	hypothetical protein	NA	J9RWG5	Pseudomonas_phage	100.0	1.7e-29
AYW66320.1|3021097_3021550_-	hypothetical protein	NA	J9SH57	Pseudomonas_phage	100.0	5.5e-81
AYW66321.1|3021546_3022062_-	DUF1320 domain-containing protein	NA	J9SNI4	Pseudomonas_phage	100.0	3.5e-92
AYW69724.1|3022064_3022280_-	hypothetical protein	NA	J9STT1	Pseudomonas_phage	100.0	1.5e-33
AYW66322.1|3022511_3023408_-	hypothetical protein	NA	J9SVY7	Pseudomonas_phage	100.0	1.3e-171
AYW66323.1|3023422_3023827_-	hypothetical protein	NA	J9RWG0	Pseudomonas_phage	100.0	1.8e-67
AYW66324.1|3023832_3024942_-	hypothetical protein	NA	J9SH47	Pseudomonas_phage	99.7	5.3e-202
AYW66325.1|3025152_3025728_-	phage virion morphogenesis protein	NA	J9SNH3	Pseudomonas_phage	100.0	1.2e-104
AYW66326.1|3025729_3026968_-	hypothetical protein	NA	J9STS2	Pseudomonas_phage	100.0	3.1e-243
AYW69725.1|3026957_3028523_-	DUF935 domain-containing protein	NA	J9SVY0	Pseudomonas_phage	96.0	4.9e-286
AYW66327.1|3028525_3030199_-	hypothetical protein	NA	J9RWF2	Pseudomonas_phage	99.3	0.0e+00
AYW66328.1|3030200_3030749_-	DUF3486 family protein	NA	J9SH37	Pseudomonas_phage	98.9	6.4e-76
AYW66329.1|3030751_3031054_-	ArsR family transcriptional regulator	NA	J9SNG3	Pseudomonas_phage	100.0	1.1e-48
AYW66330.1|3031050_3031371_-	DUF2730 family protein	NA	J9STR5	Pseudomonas_phage	100.0	5.1e-49
AYW66331.1|3031370_3031994_-|lysis	lysis protein	lysis	J9SVX5	Pseudomonas_phage	90.3	3.6e-99
AYW66332.1|3031980_3032199_-	hypothetical protein	NA	J9RWE5	Pseudomonas_phage	94.4	5.6e-31
AYW66333.1|3032195_3032825_-	lytic transglycosylase domain-containing protein	NA	J9SH25	Pseudomonas_phage	98.6	1.9e-119
AYW69726.1|3032982_3033240_-	hypothetical protein	NA	A0A0S4L5C0	Pseudomonas_phage	100.0	7.2e-38
AYW66334.1|3033430_3033934_-	hypothetical protein	NA	J9RWD8	Pseudomonas_phage	92.8	4.0e-80
AYW66335.1|3033950_3034289_-	helix-turn-helix domain-containing protein	NA	J9SH16	Pseudomonas_phage	82.6	2.4e-12
AYW66336.1|3034395_3034626_+	DNA-binding protein	NA	J9RW65	Pseudomonas_phage	100.0	2.5e-37
AYW66337.1|3034639_3035131_+	hypothetical protein	NA	J9SGQ9	Pseudomonas_phage	98.8	1.0e-85
AYW66338.1|3035258_3035747_+	hypothetical protein	NA	J9SNL8	Pseudomonas_phage	99.4	2.8e-91
AYW66339.1|3035739_3036000_+	hypothetical protein	NA	J9RWD0	Pseudomonas_phage	95.3	1.5e-38
AYW66340.1|3035996_3036311_+	hypothetical protein	NA	J9SUN0	Pseudomonas_phage	98.1	2.9e-49
AYW66341.1|3036320_3037295_+	hypothetical protein	NA	J9RW58	Pseudomonas_phage	98.1	1.0e-153
AYW66342.1|3037298_3039083_+|integrase	integrase	integrase	J9SGQ3	Pseudomonas_phage	98.5	0.0e+00
AYW66343.1|3039082_3040249_+|transposase	transposase	transposase	J9SVV1	Pseudomonas_phage	100.0	1.0e-216
AYW66344.1|3040250_3040592_+	hypothetical protein	NA	J9RWC3	Pseudomonas_phage	98.2	1.0e-55
AYW66345.1|3040588_3040894_+	hypothetical protein	NA	A0A0S4L2V0	Pseudomonas_phage	97.0	9.2e-48
AYW66346.1|3040893_3041511_+	hypothetical protein	NA	A0A0S4L050	Pseudomonas_phage	96.0	1.7e-112
AYW66347.1|3041908_3042532_+	DUF3164 family protein	NA	Q5ZR10	Pseudomonas_phage	99.5	1.0e-109
AYW66348.1|3042533_3043223_+	DUF2786 domain-containing protein	NA	Q5ZR11	Pseudomonas_phage	100.0	1.3e-126
AYW66349.1|3043224_3043416_+	hypothetical protein	NA	J9RW45	Pseudomonas_phage	98.4	1.1e-27
AYW66350.1|3043415_3043883_+	hypothetical protein	NA	Q5ZR13	Pseudomonas_phage	96.1	2.5e-76
AYW66351.1|3043869_3044436_+	regulatory protein GemA	NA	J9SVT5	Pseudomonas_phage	100.0	5.4e-102
AYW66352.1|3044435_3044984_+	hypothetical protein	NA	J9RWB3	Pseudomonas_phage	100.0	2.1e-98
AYW66353.1|3044980_3045349_+	Mor transcription activator-like protein	NA	J9SGX4	Pseudomonas_phage	100.0	1.1e-63
3046676:3046707	attR	ACGACGCGACCAGAATCGCGATTTGCACCCAC	NA	NA	NA	NA
>prophage 5
CP033685	Pseudomonas aeruginosa strain H26023 chromosome, complete genome	6729216	3298238	3339390	6729216	transposase,integrase	Ralstonia_phage(30.77%)	43	3296790:3296803	3312756:3312769
3296790:3296803	attL	ACGGGCTGTCCCTC	NA	NA	NA	NA
AYW66546.1|3298238_3299063_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AYW66547.1|3299596_3299860_-	hypothetical protein	NA	NA	NA	NA	NA
AYW66548.1|3299856_3300858_-	DNA-binding protein	NA	NA	NA	NA	NA
AYW66549.1|3301038_3302010_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
AYW66550.1|3302039_3302783_+	phage Gp37/Gp68 family protein	NA	A0A2P1A0W3	Gordonia_phage	45.5	1.8e-60
AYW66551.1|3302804_3304121_+	three-Cys-motif partner protein TcmP	NA	NA	NA	NA	NA
AYW66552.1|3304532_3305942_+	homospermidine synthase	NA	B2ZXX8	Ralstonia_phage	39.1	1.2e-94
AYW66553.1|3305957_3306686_+	hypothetical protein	NA	NA	NA	NA	NA
AYW66554.1|3306682_3307588_+	EamA family transporter	NA	NA	NA	NA	NA
AYW66555.1|3307595_3308060_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYW66556.1|3308239_3308602_-|transposase	transposase	transposase	NA	NA	NA	NA
AYW66557.1|3308598_3311613_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	24.8	1.7e-72
AYW66558.1|3312974_3313340_-	XRE family transcriptional regulator	NA	U5TNA1	Satellite_phage	38.6	2.0e-09
3312756:3312769	attR	ACGGGCTGTCCCTC	NA	NA	NA	NA
AYW66559.1|3313468_3314755_+	replication initiation protein	NA	J7I3Z6	Enterobacteria_phage	37.8	3.5e-64
AYW66560.1|3314754_3314982_+	hypothetical protein	NA	NA	NA	NA	NA
AYW66561.1|3314974_3315232_+	hypothetical protein	NA	NA	NA	NA	NA
AYW66562.1|3315237_3315582_+	hypothetical protein	NA	NA	NA	NA	NA
AYW66563.1|3315854_3316085_+	hypothetical protein	NA	NA	NA	NA	NA
AYW66564.1|3317193_3317595_+	hypothetical protein	NA	NA	NA	NA	NA
AYW66565.1|3317594_3317906_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
AYW66566.1|3317923_3319204_+	zonular occludens toxin	NA	A0A097ZPH8	Ralstonia_phage	29.9	3.4e-19
AYW66567.1|3320399_3320765_-	XRE family transcriptional regulator	NA	U5TNA1	Satellite_phage	38.6	2.0e-09
AYW66568.1|3320893_3322180_+	replication initiation protein	NA	J7I3Z6	Enterobacteria_phage	37.8	3.5e-64
AYW66569.1|3322179_3322407_+	hypothetical protein	NA	NA	NA	NA	NA
AYW66570.1|3322399_3322657_+	hypothetical protein	NA	NA	NA	NA	NA
AYW66571.1|3322662_3323007_+	hypothetical protein	NA	NA	NA	NA	NA
AYW66572.1|3323279_3323510_+	hypothetical protein	NA	NA	NA	NA	NA
AYW66573.1|3324618_3325020_+	hypothetical protein	NA	NA	NA	NA	NA
AYW66574.1|3325019_3325331_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
AYW66575.1|3325348_3326629_+	zonular occludens toxin	NA	A0A097ZPH8	Ralstonia_phage	29.9	3.4e-19
AYW66576.1|3327824_3328190_-	XRE family transcriptional regulator	NA	U5TNA1	Satellite_phage	38.6	2.0e-09
AYW66577.1|3328318_3329605_+	replication initiation protein	NA	J7I3Z6	Enterobacteria_phage	37.8	3.5e-64
AYW66578.1|3329604_3329832_+	hypothetical protein	NA	NA	NA	NA	NA
AYW66579.1|3329824_3330082_+	hypothetical protein	NA	NA	NA	NA	NA
AYW66580.1|3330087_3330432_+	hypothetical protein	NA	NA	NA	NA	NA
AYW66581.1|3330704_3330935_+	hypothetical protein	NA	NA	NA	NA	NA
AYW66582.1|3332043_3332445_+	hypothetical protein	NA	NA	NA	NA	NA
AYW66583.1|3332444_3332756_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
AYW66584.1|3332773_3334054_+	zonular occludens toxin	NA	A0A097ZPH8	Ralstonia_phage	29.9	1.2e-19
AYW69733.1|3334494_3335199_-	hypothetical protein	NA	NA	NA	NA	NA
AYW66585.1|3335527_3335857_-	hypothetical protein	NA	NA	NA	NA	NA
AYW66586.1|3336010_3339028_+|transposase	Tn3-like element ISPa42 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	26.6	7.2e-76
AYW66587.1|3339027_3339390_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
CP033685	Pseudomonas aeruginosa strain H26023 chromosome, complete genome	6729216	4593453	4604070	6729216	integrase,capsid,tRNA	Pseudomonas_phage(92.86%)	18	4591672:4591688	4598294:4598310
4591672:4591688	attL	GCTGGCCTTCTTCGGCG	NA	NA	NA	NA
AYW67714.1|4593453_4594278_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	73.7	1.4e-106
AYW67715.1|4594383_4595400_-|integrase	integrase	integrase	Q56VN7	Pseudomonas_phage	100.0	1.3e-191
AYW67716.1|4595399_4596698_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	100.0	2.9e-260
AYW67717.1|4596926_4598210_-	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	99.8	1.1e-235
AYW67718.1|4598213_4598570_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	100.0	7.9e-59
4598294:4598310	attR	CGCCGAAGAAGGCCAGC	NA	NA	NA	NA
AYW67719.1|4598574_4598760_-	hypothetical protein	NA	Q56VP1	Pseudomonas_phage	100.0	2.1e-26
AYW67720.1|4598800_4599178_+	hypothetical protein	NA	NA	NA	NA	NA
AYW67721.1|4599364_4599631_+	hypothetical protein	NA	NA	NA	NA	NA
AYW67722.1|4600047_4600296_-|capsid	capsid protein	capsid	Q56VP2	Pseudomonas_phage	100.0	2.1e-34
AYW67723.1|4600308_4600560_-	hypothetical protein	NA	NA	NA	NA	NA
AYW67724.1|4600572_4600665_-	hypothetical protein	NA	Q56VP4	Pseudomonas_phage	100.0	7.3e-09
AYW67725.1|4600681_4601116_-	DNA-binding protein	NA	Q56VP5	Pseudomonas_phage	100.0	3.8e-63
AYW67726.1|4601250_4601628_-	hypothetical protein	NA	Q56VP6	Pseudomonas_phage	100.0	4.3e-63
AYW67727.1|4601631_4601922_-	hypothetical protein	NA	Q56VP7	Pseudomonas_phage	100.0	7.9e-57
AYW67728.1|4601925_4602138_-	hypothetical protein	NA	Q56VP8	Pseudomonas_phage	100.0	3.1e-34
AYW67729.1|4602140_4602356_-	DNA-binding protein	NA	Q56VP9	Pseudomonas_phage	100.0	1.9e-36
AYW67730.1|4602483_4602750_+	DNA-binding protein	NA	NA	NA	NA	NA
AYW67731.1|4603038_4604070_+	ParA family protein	NA	Q56VQ0	Pseudomonas_phage	99.7	1.3e-181
>prophage 7
CP033685	Pseudomonas aeruginosa strain H26023 chromosome, complete genome	6729216	5628939	5664263	6729216	coat,capsid,integrase,tRNA	Pseudomonas_phage(68.75%)	39	5655909:5655968	5669076:5669157
AYW68630.1|5628939_5629488_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
AYW68631.1|5629518_5630052_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
AYW68632.1|5630051_5630594_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
AYW68633.1|5630612_5631401_+	molecular chaperone	NA	NA	NA	NA	NA
AYW68634.1|5631417_5633790_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
AYW68635.1|5633786_5634734_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
AYW68636.1|5634735_5636109_-	MFS transporter	NA	NA	NA	NA	NA
AYW68637.1|5636388_5637411_-	ferrochelatase	NA	NA	NA	NA	NA
AYW68638.1|5637407_5638325_-	TIGR01777 family protein	NA	NA	NA	NA	NA
AYW68639.1|5638738_5639722_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AYW68640.1|5639874_5640834_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
AYW68641.1|5640843_5641743_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	39.1	8.5e-17
AYW68642.1|5641739_5643185_+	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	28.0	1.4e-45
AYW68643.1|5643310_5643832_-	lipid A deacylase PagL	NA	A0A2H4J0I5	uncultured_Caudovirales_phage	69.8	1.4e-59
AYW68644.1|5643965_5644763_-	glutamate racemase	NA	NA	NA	NA	NA
AYW69808.1|5644752_5645511_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
AYW68645.1|5645504_5646335_-	protein-(glutamine-N5) methyltransferase, release factor-specific	NA	NA	NA	NA	NA
AYW68646.1|5646336_5647419_-	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	48.3	5.6e-07
AYW68647.1|5647436_5648705_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
AYW68648.1|5648848_5650621_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AYW68649.1|5650625_5651243_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
AYW68650.1|5651244_5652093_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
AYW68651.1|5652259_5653201_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	4.1e-46
AYW68652.1|5653317_5653932_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
AYW68653.1|5653973_5654558_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AYW68654.1|5654598_5655699_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
5655909:5655968	attL	ATTCATAATGCTGATGTCCCAGGTTCAAGTCCCGGTGTAGCCACCATATTTTTCAAGGGG	NA	NA	NA	NA
AYW68655.1|5656017_5656455_-	hypothetical protein	NA	NA	NA	NA	NA
AYW68656.1|5656501_5657509_-|integrase	integrase	integrase	F1BUS9	Erwinia_phage	47.1	1.3e-77
AYW68657.1|5657505_5658798_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	92.5	1.0e-241
AYW68658.1|5659027_5660311_-	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	96.7	6.3e-231
AYW68659.1|5660314_5660671_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	100.0	7.9e-59
AYW68660.1|5660675_5662013_-	attachment protein	NA	Q56VP1	Pseudomonas_phage	95.7	3.1e-156
AYW68661.1|5662166_5662415_-|capsid	capsid protein	capsid	Q56VP2	Pseudomonas_phage	100.0	2.1e-34
AYW68662.1|5662427_5662679_-	hypothetical protein	NA	NA	NA	NA	NA
AYW68663.1|5662691_5662784_-	hypothetical protein	NA	Q56VP4	Pseudomonas_phage	100.0	7.3e-09
AYW68664.1|5662800_5663235_-	DNA-binding protein	NA	Q56VP5	Pseudomonas_phage	100.0	3.8e-63
AYW68665.1|5663369_5663747_-	hypothetical protein	NA	Q56VP6	Pseudomonas_phage	97.6	4.4e-60
AYW68666.1|5663750_5664044_-	hypothetical protein	NA	Q56VP7	Pseudomonas_phage	86.6	1.2e-47
AYW68667.1|5664047_5664263_-	hypothetical protein	NA	Q56VP8	Pseudomonas_phage	94.2	5.0e-32
5669076:5669157	attR	ATTCATAATGCTGATGTCCCAGGTTCAAGTCCCGGTGTAGCCACCATATTTTTCAAGGGGTTAGCGCAAGCTAACCCCTTTT	NA	NA	NA	NA
>prophage 8
CP033685	Pseudomonas aeruginosa strain H26023 chromosome, complete genome	6729216	6192013	6276922	6729216	holin,terminase,tRNA,portal,plate,protease,lysis,tail,capsid,head,integrase	Pseudomonas_virus(73.91%)	99	6237237:6237281	6273256:6273300
AYW69122.1|6192013_6193468_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
AYW69823.1|6193702_6193825_-	glutamine synthetase	NA	NA	NA	NA	NA
AYW69123.1|6193804_6195214_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
AYW69124.1|6195361_6195766_+	hypothetical protein	NA	NA	NA	NA	NA
AYW69125.1|6195762_6197970_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
AYW69126.1|6198257_6198779_+	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
AYW69127.1|6198775_6199348_+	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
AYW69128.1|6199618_6200695_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.8	2.4e-05
AYW69129.1|6200697_6202128_+	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
AYW69130.1|6202180_6202414_+	hypothetical protein	NA	NA	NA	NA	NA
AYW69131.1|6202850_6203318_-	hypothetical protein	NA	NA	NA	NA	NA
AYW69132.1|6203316_6203778_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
AYW69133.1|6203836_6204328_-	protein-export protein SecB	NA	NA	NA	NA	NA
AYW69134.1|6204364_6204619_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	43.4	1.6e-13
AYW69135.1|6204620_6205040_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AYW69136.1|6205364_6206912_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
AYW69137.1|6207225_6208044_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYW69138.1|6208193_6209480_+	peptidase M23	NA	G9BW84	Planktothrix_phage	39.8	2.9e-10
AYW69139.1|6209508_6210819_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	29.0	3.9e-26
AYW69140.1|6210818_6211592_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AYW69141.1|6211660_6213142_+	hypothetical protein	NA	NA	NA	NA	NA
AYW69142.1|6213182_6213938_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYW69143.1|6214087_6214840_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYW69144.1|6214930_6215677_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYW69145.1|6215848_6216619_-	imidazole glycerol phosphate synthase cyclase subunit	NA	NA	NA	NA	NA
AYW69146.1|6216629_6217367_-	1-(5-phosphoribosyl)-5-((5- phosphoribosylamino)methylideneamino)imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
AYW69147.1|6217415_6217676_-	DUF2164 domain-containing protein	NA	NA	NA	NA	NA
AYW69148.1|6217679_6218318_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
AYW69149.1|6218317_6218911_-	imidazoleglycerol-phosphate dehydratase	NA	NA	NA	NA	NA
AYW69150.1|6219071_6219470_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYW69151.1|6219506_6219743_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
AYW69152.1|6219739_6220846_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AYW69153.1|6220939_6223192_+	AsmA family protein	NA	NA	NA	NA	NA
AYW69154.1|6223188_6224256_+	adenine DNA glycosylase	NA	NA	NA	NA	NA
AYW69155.1|6224299_6224572_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYW69156.1|6224599_6225682_+	oxidoreductase	NA	NA	NA	NA	NA
AYW69157.1|6225927_6226665_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
AYW69158.1|6226823_6227513_+	DUF502 domain-containing protein	NA	NA	NA	NA	NA
AYW69159.1|6227761_6228535_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	31.1	9.3e-20
AYW69160.1|6228549_6229302_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYW69161.1|6229363_6230059_+	ABC transporter permease	NA	NA	NA	NA	NA
AYW69162.1|6230055_6230748_+	ABC transporter permease	NA	NA	NA	NA	NA
AYW69163.1|6230816_6232037_+	methyltransferase	NA	NA	NA	NA	NA
AYW69164.1|6232440_6232911_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYW69165.1|6232914_6234393_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
AYW69166.1|6234407_6235592_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYW69167.1|6235602_6237132_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
6237237:6237281	attL	CTTGTAATCAGTAGGTCCCGGGTTCGACTCCTGGTGCCGGCACCA	NA	NA	NA	NA
AYW69168.1|6238116_6238878_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	72.4	2.1e-109
AYW69169.1|6239033_6240089_-|portal	phage portal protein	portal	Q9ZXM6	Pseudomonas_virus	97.7	6.8e-199
AYW69824.1|6240085_6241849_-|terminase	terminase	terminase	Q9ZXM5	Pseudomonas_virus	100.0	0.0e+00
AYW69170.1|6242004_6242826_+|capsid	GPO family capsid scaffolding protein	capsid	Q9ZXM4	Pseudomonas_virus	100.0	8.9e-130
AYW69171.1|6242861_6243878_+|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	100.0	9.2e-193
AYW69172.1|6243883_6244585_+|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	99.1	2.8e-124
AYW69173.1|6244688_6245150_+|head	head completion/stabilization protein	head	Q9ZXM1	Pseudomonas_virus	100.0	9.5e-81
AYW69174.1|6245149_6245347_+	hypothetical protein	NA	Q9ZXM0	Pseudomonas_virus	100.0	2.4e-33
AYW69175.1|6245346_6245556_+|tail	phage tail protein	tail	Q9ZXL9	Pseudomonas_virus	100.0	1.4e-34
AYW69176.1|6245580_6245934_+	hypothetical protein	NA	Q9ZXL8	Pseudomonas_virus	99.1	1.7e-58
AYW69177.1|6245935_6246208_+|holin	phage holin family protein	holin	Q9ZXL7	Pseudomonas_virus	100.0	2.4e-39
AYW69178.1|6246204_6247011_+	DUF3380 domain-containing protein	NA	Q9ZXL6	Pseudomonas_virus	100.0	6.2e-152
AYW69179.1|6247007_6247469_+|lysis	LysB family phage lysis regulatory protein	lysis	Q9ZXL5	Pseudomonas_virus	98.0	8.1e-72
AYW69180.1|6247546_6248083_+|tail	phage tail protein	tail	Q9ZXL3	Pseudomonas_virus	97.2	7.4e-93
AYW69181.1|6248075_6248534_+	phage virion morphogenesis protein	NA	Q9ZXL2	Pseudomonas_virus	89.5	5.4e-68
AYW69182.1|6248603_6249176_+|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	91.1	2.7e-93
AYW69183.1|6249172_6249517_+|plate	baseplate assembly protein	plate	Q9ZXK9	Pseudomonas_virus	98.2	1.6e-56
AYW69184.1|6249513_6250428_+|plate	baseplate assembly protein	plate	Q9ZXK8	Pseudomonas_virus	99.3	1.6e-164
AYW69185.1|6250427_6250964_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	99.4	9.0e-99
AYW69186.1|6250965_6253308_+|tail	phage tail protein	tail	Q9ZXK6	Pseudomonas_virus	66.3	5.1e-271
AYW69187.1|6253304_6253769_+|tail	phage tail protein	tail	Q9ZXK5	Pseudomonas_virus	75.0	1.4e-44
AYW69188.1|6253859_6255035_+|tail	phage tail sheath protein	tail	Q9ZXK4	Pseudomonas_virus	98.7	2.3e-219
AYW69189.1|6255091_6255607_+|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	94.7	7.4e-90
AYW69190.1|6255660_6255999_+|tail	phage tail assembly protein	tail	Q9ZXK2	Pseudomonas_virus	84.3	2.3e-39
AYW69191.1|6256007_6256127_+|tail	GpE family phage tail protein	tail	Q9ZXK1	Pseudomonas_virus	100.0	1.8e-15
AYW69192.1|6256116_6258876_+|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	92.7	0.0e+00
AYW69193.1|6258881_6259322_+|tail	phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	100.0	6.1e-77
AYW69194.1|6259318_6260593_+	phage late control D family protein	NA	Q9ZXJ8	Pseudomonas_virus	97.9	1.3e-236
AYW69195.1|6260634_6261471_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
AYW69196.1|6261470_6262211_-	hypothetical protein	NA	NA	NA	NA	NA
AYW69197.1|6262265_6262910_-	NAD-dependent DNA ligase	NA	A0A0U4J8W4	Pseudomonas_phage	58.2	4.3e-71
AYW69198.1|6263121_6263592_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYW69199.1|6263618_6263849_+	hypothetical protein	NA	NA	NA	NA	NA
AYW69825.1|6263878_6264352_+	hypothetical protein	NA	Q9ZXJ2	Pseudomonas_virus	69.5	3.3e-52
AYW69200.1|6264359_6264578_-	hypothetical protein	NA	NA	NA	NA	NA
AYW69201.1|6264576_6264768_+	hypothetical protein	NA	NA	NA	NA	NA
AYW69202.1|6264770_6265064_+	transcriptional regulator	NA	Q9ZXJ1	Pseudomonas_virus	97.9	3.2e-50
AYW69203.1|6265060_6265411_+	hypothetical protein	NA	NA	NA	NA	NA
AYW69204.1|6265481_6265715_+	hypothetical protein	NA	Q9ZXI9	Pseudomonas_virus	98.7	1.0e-38
AYW69205.1|6265711_6268432_+	bifunctional DNA primase/helicase	NA	Q9ZXI8	Pseudomonas_virus	99.2	0.0e+00
AYW69206.1|6268476_6268749_+	hypothetical protein	NA	NA	NA	NA	NA
AYW69207.1|6268809_6269151_+	hypothetical protein	NA	NA	NA	NA	NA
AYW69208.1|6269204_6269558_+	hypothetical protein	NA	Q9ZXI7	Pseudomonas_virus	94.9	2.1e-59
AYW69209.1|6269569_6269776_+	TraR/DksA family transcriptional regulator	NA	Q9ZXI6	Pseudomonas_virus	98.5	7.3e-33
AYW69210.1|6270353_6271586_+	phosphoadenosine phosphosulfate reductase	NA	R9TRT5	Rhizobium_phage	71.3	5.2e-174
AYW69211.1|6271596_6271785_+	hypothetical protein	NA	Q38017	Pseudomonas_virus	70.6	5.9e-05
AYW69212.1|6271781_6271997_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AYW69213.1|6271993_6273136_+|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	40.4	4.8e-73
AYW69214.1|6273535_6274594_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.9	1.0e-85
6273256:6273300	attR	CTTGTAATCAGTAGGTCCCGGGTTCGACTCCTGGTGCCGGCACCA	NA	NA	NA	NA
AYW69215.1|6274590_6275499_+	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
AYW69216.1|6275495_6276377_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	60.6	2.1e-100
AYW69217.1|6276376_6276922_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.0	2.5e-51
