The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP027783	Tetragenococcus osmophilus strain JCM 31126 chromosome, complete genome	2329167	8890	45913	2329167	transposase,holin	Streptococcus_phage(35.71%)	37	NA	NA
AYW46897.1|8890_10012_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	52.1	1.6e-84
AYW46898.1|9969_10917_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	58.1	8.2e-103
AYW46899.1|11114_11948_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AYW46900.1|11963_12899_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
AYW46901.1|13299_13623_+	hypothetical protein	NA	NA	NA	NA	NA
AYW46902.1|13644_14217_+	hypothetical protein	NA	NA	NA	NA	NA
AYW46903.1|14850_16587_+|transposase	transposase	transposase	NA	NA	NA	NA
AYW46904.1|16651_17719_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	7.7e-49
AYW46905.1|17997_18693_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	39.9	3.8e-41
AYW46906.1|18698_20417_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	32.5	9.2e-28
AYW46907.1|20484_21372_-	phosphate ABC transporter substrate-binding protein	NA	E3SM63	Prochlorococcus_phage	27.0	3.5e-07
AYW46908.1|21627_21987_-|holin	phage holin family protein	holin	NA	NA	NA	NA
AYW46909.1|21986_22271_-	PspC family transcriptional regulator	NA	NA	NA	NA	NA
AYW46910.1|22317_23856_-	hypothetical protein	NA	NA	NA	NA	NA
AYW46911.1|24052_24748_-	phosphate transport system regulatory protein PhoU	NA	NA	NA	NA	NA
AYW46912.1|24784_25543_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	5.3e-20
AYW46913.1|25564_26368_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.8	5.5e-15
AYW46914.1|26414_27299_-	phosphate ABC transporter permease PtsA	NA	NA	NA	NA	NA
AYW46915.1|27295_28219_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
AYW46916.1|28326_29181_-	phosphate ABC transporter substrate-binding protein	NA	M1U9L0	Synechococcus_phage	26.3	1.3e-09
AYW46917.1|29416_30823_-	MFS transporter	NA	NA	NA	NA	NA
AYW46918.1|30956_31841_-	ABC transporter permease	NA	NA	NA	NA	NA
AYW46919.1|31833_32520_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	34.2	1.1e-27
AYW46920.1|32622_33736_-	peptide chain release factor 2	NA	NA	NA	NA	NA
AYW46921.1|33814_36328_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
AYW46922.1|36616_37171_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AYW46923.1|37297_37975_-	amidophosphoribosyltransferase	NA	NA	NA	NA	NA
AYW46924.1|37971_39279_-	DNA/RNA helicase	NA	A0A1X9I5S6	Streptococcus_phage	39.8	7.6e-75
AYW46925.1|39352_39673_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
AYW46926.1|39756_40050_-	hypothetical protein	NA	NA	NA	NA	NA
AYW46927.1|40179_40812_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	48.3	7.3e-47
AYW46928.1|40854_41562_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYW48880.1|42155_42389_-	DUF2969 domain-containing protein	NA	NA	NA	NA	NA
AYW46929.1|42498_42762_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	59.0	2.4e-20
AYW46930.1|42862_43042_-	DNA-directed RNA polymerase subunit beta	NA	NA	NA	NA	NA
AYW46931.1|43057_44347_-	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AYW46932.1|44590_45913_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	42.6	3.9e-95
>prophage 2
CP027783	Tetragenococcus osmophilus strain JCM 31126 chromosome, complete genome	2329167	221071	230013	2329167		Bacillus_phage(66.67%)	9	NA	NA
AYW47099.1|221071_221809_-	glycerophosphodiester phosphodiesterase	NA	A0A0D3MUY6	Staphylococcus_phage	27.7	2.1e-13
AYW47100.1|221900_222419_-	hypothetical protein	NA	NA	NA	NA	NA
AYW47101.1|222585_223191_+	ATP-dependent Clp endopeptidase, proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.4	4.5e-54
AYW47102.1|223529_224216_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	40.9	9.0e-43
AYW47103.1|224216_225302_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	28.5	4.2e-26
AYW48887.1|225375_225822_-	hypothetical protein	NA	NA	NA	NA	NA
AYW47104.1|225809_226223_-	hypothetical protein	NA	NA	NA	NA	NA
AYW47105.1|226528_228283_-	ABC transporter	NA	W8CYL7	Bacillus_phage	29.5	6.7e-50
AYW47106.1|228279_230013_-	multidrug ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.8	7.1e-44
>prophage 3
CP027783	Tetragenococcus osmophilus strain JCM 31126 chromosome, complete genome	2329167	507955	539798	2329167	transposase,integrase	Streptococcus_phage(50.0%)	27	513845:513860	536099:536114
AYW47336.1|507955_509314_-|transposase	transposase	transposase	NA	NA	NA	NA
AYW47337.1|510215_511424_-	NAD-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
AYW47338.1|511480_512950_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
AYW47339.1|513192_513753_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYW48895.1|513802_514666_+	glycine/betaine ABC transporter	NA	NA	NA	NA	NA
513845:513860	attL	GGTACAACAAATGAAG	NA	NA	NA	NA
AYW47340.1|514827_516156_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AYW47341.1|516900_517452_-	N-acetyltransferase	NA	NA	NA	NA	NA
AYW47342.1|517725_518061_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A1S5SEX8	Streptococcus_phage	43.5	3.5e-16
AYW47343.1|518053_518290_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
AYW47344.1|520527_521007_+	UTRA domain-containing protein	NA	NA	NA	NA	NA
AYW47345.1|522177_522870_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
AYW47346.1|522886_523438_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	36.8	3.6e-18
AYW47347.1|523778_523958_-	hypothetical protein	NA	NA	NA	NA	NA
AYW47348.1|524122_525442_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	34.5	1.2e-62
AYW47349.1|525787_526339_-|integrase	integrase	integrase	D2XR58	Bacillus_phage	41.7	8.3e-31
AYW47350.1|526631_528560_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.9	3.4e-95
AYW47351.1|529837_530449_-	cadmium resistance protein CadD	NA	NA	NA	NA	NA
AYW47352.1|530465_530801_-	transcriptional regulator	NA	NA	NA	NA	NA
AYW47353.1|530989_532312_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	42.8	4.4e-94
AYW47354.1|532695_533058_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AYW47355.1|533063_533339_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYW47356.1|533526_535194_-	dehydrogenase	NA	NA	NA	NA	NA
AYW47357.1|535263_535584_-	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AYW47358.1|535561_535903_-	ArsR family transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	45.8	7.7e-19
AYW47359.1|535955_537707_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
536099:536114	attR	CTTCATTTGTTGTACC	NA	NA	NA	NA
AYW47360.1|537721_538099_-	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AYW47361.1|538592_539798_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	42.7	8.0e-79
>prophage 4
CP027783	Tetragenococcus osmophilus strain JCM 31126 chromosome, complete genome	2329167	1025941	1104669	2329167	tRNA,protease,transposase	Streptococcus_phage(18.75%)	56	NA	NA
AYW47773.1|1025941_1026502_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AYW47774.1|1026536_1030070_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
AYW47775.1|1030088_1031690_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYW47776.1|1031676_1031934_+	hypothetical protein	NA	NA	NA	NA	NA
AYW47777.1|1032008_1032428_+	septum formation initiator	NA	NA	NA	NA	NA
AYW47778.1|1032647_1033094_+	RNA-binding protein S1	NA	NA	NA	NA	NA
AYW47779.1|1033193_1034624_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	25.9	5.7e-15
AYW47780.1|1034604_1035153_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	27.3	3.1e-09
AYW47781.1|1035221_1037330_+	cell division protein FtsH	NA	H8ZJI5	Ostreococcus_tauri_virus	50.0	1.0e-105
AYW47782.1|1037477_1038362_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
AYW47783.1|1038461_1039955_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	40.4	5.6e-90
AYW47784.1|1040225_1041470_-	hypothetical protein	NA	NA	NA	NA	NA
AYW47785.1|1049442_1050630_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	68.9	1.9e-149
AYW48916.1|1050733_1051510_+	tributyrin esterase	NA	NA	NA	NA	NA
AYW47786.1|1051690_1052770_+	DUF871 domain-containing protein	NA	NA	NA	NA	NA
AYW47787.1|1052762_1053653_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
AYW47788.1|1053668_1055132_+	permease	NA	NA	NA	NA	NA
AYW47789.1|1055128_1055758_+	HAD family phosphatase	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	25.4	4.1e-10
AYW48917.1|1055837_1057718_+	penicillin binding protein PBP4B	NA	NA	NA	NA	NA
AYW47790.1|1057792_1058641_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AYW47791.1|1058815_1059772_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
AYW47792.1|1059940_1061263_+|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	42.1	2.0e-94
AYW47793.1|1061537_1062353_-	phosphoenolpyruvate synthase regulatory protein	NA	NA	NA	NA	NA
AYW47794.1|1062976_1064227_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	56.6	2.4e-110
AYW47795.1|1064743_1065202_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
AYW47796.1|1065228_1065423_+	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
AYW47797.1|1065444_1065969_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
AYW47798.1|1066033_1066612_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AYW47799.1|1066789_1067491_+	macrolide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	1.3e-33
AYW47800.1|1071367_1071916_-	hypothetical protein	NA	NA	NA	NA	NA
AYW47801.1|1072069_1072699_+	NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
AYW47802.1|1072712_1074032_+	AAA family ATPase	NA	G3MBE0	Bacillus_virus	43.2	3.3e-94
AYW47803.1|1074197_1075175_+	glutathione-dependent reductase	NA	NA	NA	NA	NA
AYW47804.1|1075724_1077023_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.4	2.8e-37
AYW47805.1|1077210_1078155_+	AAA family ATPase	NA	NA	NA	NA	NA
AYW47806.1|1078151_1079156_+	hypothetical protein	NA	NA	NA	NA	NA
AYW47807.1|1079160_1081317_+	hypothetical protein	NA	NA	NA	NA	NA
AYW47808.1|1081514_1082594_+|protease	serine protease	protease	U5Q1E2	Bacillus_phage	40.8	1.4e-18
AYW47809.1|1082690_1083239_+	N-acetyltransferase	NA	NA	NA	NA	NA
AYW47810.1|1083446_1084115_+	hypothetical protein	NA	NA	NA	NA	NA
AYW47811.1|1084138_1085383_+	hypothetical protein	NA	NA	NA	NA	NA
AYW47812.1|1086865_1087540_+	hypothetical protein	NA	NA	NA	NA	NA
AYW47813.1|1087819_1088641_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
AYW47814.1|1088996_1090100_+	sensor histidine kinase	NA	NA	NA	NA	NA
AYW47815.1|1090092_1090380_+	hypothetical protein	NA	NA	NA	NA	NA
AYW47816.1|1092256_1092898_+	uracil-DNA glycosylase	NA	NA	NA	NA	NA
AYW47817.1|1093127_1093619_+	hypothetical protein	NA	NA	NA	NA	NA
AYW47818.1|1093975_1094737_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AYW47819.1|1095191_1095875_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
AYW47820.1|1096011_1097211_+	hypothetical protein	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	41.3	4.8e-23
AYW47821.1|1097329_1098760_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
AYW47822.1|1098829_1100008_+	hypothetical protein	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	35.5	3.8e-65
AYW47823.1|1100085_1100874_-	glutathione-dependent disulfide-bond oxidoreductase	NA	NA	NA	NA	NA
AYW47824.1|1100950_1101481_-|protease	protease	protease	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	30.1	3.6e-15
AYW47825.1|1101777_1103280_+	amino acid ABC transporter amino acid-binding/permease	NA	NA	NA	NA	NA
AYW47826.1|1103418_1104669_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	56.6	1.8e-110
>prophage 5
CP027783	Tetragenococcus osmophilus strain JCM 31126 chromosome, complete genome	2329167	1330563	1338897	2329167		Bacillus_phage(50.0%)	7	NA	NA
AYW48037.1|1330563_1331337_+	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	23.6	1.2e-06
AYW48038.1|1331353_1332646_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
AYW48039.1|1332642_1333878_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	49.5	3.5e-114
AYW48040.1|1333864_1334305_+	SUF system NifU family Fe-S cluster assembly protein	NA	A0A218MKD1	uncultured_virus	27.7	1.8e-07
AYW48041.1|1334420_1335122_+	NAD-dependent protein deacylase	NA	A0A068EPD4	Bacillus_phage	30.6	7.1e-19
AYW48042.1|1335305_1337045_+	ABC transporter	NA	W8CYL7	Bacillus_phage	30.1	7.4e-41
AYW48043.1|1337034_1338897_+	ABC transporter	NA	W8CYL7	Bacillus_phage	27.1	6.7e-40
>prophage 6
CP027783	Tetragenococcus osmophilus strain JCM 31126 chromosome, complete genome	2329167	1349377	1359005	2329167		Lactobacillus_phage(42.86%)	7	NA	NA
AYW48053.1|1349377_1350325_+	NADPH:quinone reductase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.9	5.3e-09
AYW48054.1|1350376_1351654_-	NADPH-dependent FMN reductase	NA	A0A2P0ZL82	Lactobacillus_phage	54.3	1.0e-63
AYW48055.1|1351675_1352284_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	51.3	7.0e-55
AYW48056.1|1352781_1353486_-	deoxynucleoside kinase	NA	A0A2P0ZKV1	Lactobacillus_phage	39.1	3.9e-41
AYW48057.1|1353841_1355311_+	peptide ABC transporter permease	NA	A0A0P0IY73	Acinetobacter_phage	36.7	2.3e-72
AYW48058.1|1355523_1357239_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.3	4.6e-35
AYW48059.1|1357235_1359005_+	ABC transporter	NA	W8CYL7	Bacillus_phage	26.4	1.0e-45
>prophage 7
CP027783	Tetragenococcus osmophilus strain JCM 31126 chromosome, complete genome	2329167	1451938	1463013	2329167	transposase	Streptococcus_phage(62.5%)	12	NA	NA
AYW48147.1|1451938_1453339_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	29.2	2.7e-41
AYW48148.1|1453545_1455276_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	35.9	2.0e-54
AYW48149.1|1455298_1455610_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AYW48150.1|1455652_1456249_+	recombination protein RecR	NA	NA	NA	NA	NA
AYW48151.1|1456280_1456934_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	53.0	3.8e-51
AYW48152.1|1456930_1457263_+	hypothetical protein	NA	NA	NA	NA	NA
AYW48153.1|1457292_1458243_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	32.3	1.1e-30
AYW48154.1|1458270_1458624_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	62.2	6.3e-08
AYW48155.1|1458687_1459563_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	54.7	2.2e-78
AYW48156.1|1459612_1460734_+	DNA polymerase IV	NA	NA	NA	NA	NA
AYW48157.1|1460856_1462176_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	34.5	1.2e-62
AYW48158.1|1462410_1463013_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0C5K925	Enterococcus_phage	54.1	1.5e-49
>prophage 8
CP027783	Tetragenococcus osmophilus strain JCM 31126 chromosome, complete genome	2329167	1491706	1554725	2329167	tRNA,transposase,integrase	Bacillus_phage(27.27%)	62	1527953:1528012	1549837:1551213
AYW48187.1|1491706_1493029_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	42.8	4.4e-94
AYW48188.1|1493232_1493601_+	DUF3397 domain-containing protein	NA	NA	NA	NA	NA
AYW48189.1|1493773_1494205_+	cell division/cell wall cluster transcriptional repressor MraZ	NA	NA	NA	NA	NA
AYW48190.1|1494219_1495173_+	16S rRNA (cytosine(1402)-N(4))-methyltransferase	NA	NA	NA	NA	NA
AYW48191.1|1495178_1495586_+	cell division protein FtsL	NA	NA	NA	NA	NA
AYW48192.1|1495586_1497803_+	cell division protein FtsI	NA	NA	NA	NA	NA
AYW48193.1|1497853_1498819_+	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
AYW48194.1|1498861_1500241_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
AYW48195.1|1500237_1501329_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
AYW48196.1|1501382_1502375_+	cell division protein FtsQ	NA	NA	NA	NA	NA
AYW48197.1|1502543_1503881_+	cell division protein FtsA	NA	NA	NA	NA	NA
AYW48198.1|1503904_1505140_+	cell division protein FtsZ	NA	NA	NA	NA	NA
AYW48199.1|1505153_1505828_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AYW48200.1|1505842_1506487_+	cell division protein SepF	NA	NA	NA	NA	NA
AYW48201.1|1506541_1506775_+	YggT family protein	NA	NA	NA	NA	NA
AYW48202.1|1506793_1507576_+	RNA-binding protein	NA	NA	NA	NA	NA
AYW48203.1|1507595_1508354_+	DivIVA domain-containing protein	NA	NA	NA	NA	NA
AYW48204.1|1508669_1511462_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	28.0	2.4e-94
AYW48205.1|1511575_1513096_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.7	2.9e-81
AYW48206.1|1513128_1513776_-	Cro/Cl family transcriptional regulator	NA	NA	NA	NA	NA
AYW48207.1|1514006_1515242_-	aminopeptidase	NA	NA	NA	NA	NA
AYW48208.1|1515449_1516040_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYW48209.1|1516085_1516535_-	flavodoxin	NA	NA	NA	NA	NA
AYW48210.1|1516716_1517481_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
AYW48211.1|1518333_1519752_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
AYW48212.1|1520067_1521204_+	undecaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
AYW48213.1|1521325_1521784_+	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
AYW48214.1|1521784_1521994_+	copper-binding protein	NA	NA	NA	NA	NA
AYW48215.1|1522146_1522683_+	prevent-host-death protein	NA	NA	NA	NA	NA
AYW48216.1|1522832_1524017_+	aromatic amino acid aminotransferase	NA	NA	NA	NA	NA
AYW48217.1|1524246_1524585_+	putative DNA-binding protein	NA	NA	NA	NA	NA
AYW48218.1|1524602_1526027_+	signal recognition particle protein	NA	NA	NA	NA	NA
AYW48219.1|1526420_1527983_+	ATPase	NA	NA	NA	NA	NA
1527953:1528012	attL	CCAAAATTTCAAGTTTAAGTTAGCCACTTAGTAAAACTAAATTTCATGCGATATTTGACG	NA	NA	NA	NA
AYW48220.1|1528139_1529219_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	1.0e-48
AYW48221.1|1529598_1530195_-	NAD(P)H:quinone oxidoreductase, type IV	NA	NA	NA	NA	NA
AYW48222.1|1530316_1530871_-	NADPH-dependent FMN reductase	NA	A0A2P0ZL77	Lactobacillus_phage	28.6	9.9e-08
AYW48223.1|1531086_1531362_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AYW48224.1|1531373_1531622_+	RNA-binding protein	NA	NA	NA	NA	NA
AYW48225.1|1532008_1532263_+	hypothetical protein	NA	NA	NA	NA	NA
AYW48928.1|1532322_1533168_-	triphosphoribosyl-dephospho-CoA synthase CitG	NA	NA	NA	NA	NA
AYW48226.1|1533178_1533874_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYW48227.1|1534177_1535176_+	[citrate (pro-3S)-lyase] ligase	NA	NA	NA	NA	NA
AYW48228.1|1535190_1535499_+	citrate lyase acyl carrier protein	NA	NA	NA	NA	NA
AYW48229.1|1535486_1536374_+	citrate lyase subunit beta	NA	NA	NA	NA	NA
AYW48230.1|1536376_1537909_+	citrate lyase subunit alpha	NA	NA	NA	NA	NA
AYW48231.1|1537901_1538435_+	citrate lyase holo-[acyl-carrier protein] synthase	NA	NA	NA	NA	NA
AYW48929.1|1538490_1539594_-	cation transporter	NA	NA	NA	NA	NA
AYW48232.1|1539759_1540332_-	hypothetical protein	NA	NA	NA	NA	NA
AYW48233.1|1540332_1540806_-	hypothetical protein	NA	NA	NA	NA	NA
AYW48930.1|1540848_1541583_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AYW48234.1|1541572_1542097_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AYW48235.1|1542238_1542673_+	universal stress protein	NA	NA	NA	NA	NA
AYW48236.1|1542835_1543105_+	ACT domain-containing protein	NA	NA	NA	NA	NA
AYW48237.1|1543115_1544465_+	hypothetical protein	NA	NA	NA	NA	NA
AYW48238.1|1544486_1544954_+	GAF domain-containing protein	NA	NA	NA	NA	NA
AYW48239.1|1546122_1547259_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	36.3	2.0e-55
AYW48240.1|1547420_1548389_-	hypothetical protein	NA	O64371	Lactobacillus_phage	48.2	4.3e-22
AYW48241.1|1548499_1549641_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	52.4	1.6e-73
AYW48242.1|1550023_1551103_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	1.0e-48
AYW48243.1|1551662_1552136_-	hypothetical protein	NA	NA	NA	NA	NA
1549837:1551213	attR	CCAAAATTTCAAGTTTAAGTTAGCCACTTAGTAAAACTAAATTTCATGCGATATTTGACGGTTACTATCTGTGTAGTGAGGGCTTGATAATGAGCTGAGACATGATAGTCTTTTGACAAGCTGGCTTCAGCCAGCTCTACAGCTTTAAAATCATGTCGAAGGAGGCTCGTTGTCAAGCCCTCACGGGTTAAGCCACTTGCTTTTCTAATCGTAAGGCATTGACGAAACACTCATGAGGTGTTTTATAATCCAATATTTTTCTGGGATAATCGTTCATCCATTGTTGTATACGTAAGCATTGTGATTCTAAAACTTGACCCATCGACTTTCCTTTCGGAATGAAGCGACGAATGAATTTATGCTGATTCTCACTCGTTCCTCGCTCAAATGATGCATAAGGATGGCTAAAATAAACATCCAGGGTATCCTTTAACGCTTCATGTAGACCTGCAAATTCAGATCCATTATCTGAAGTAATCGTCTTAAACATAGTAGAAAAGTCATCTCCAGCGCGTTCTTGAAGAGAATAAATGGCTTCGTCCACTGAATATTGATCTTTACCGTTTACCTTCATAATAACTTCAAAGCGGGTTTGTCGTTCAACTAATGTTAGTAGTACGGCATCGGTCTTCTCCTTATTACCAACGACTGTGTCGATTTCCCAGTGACCAAAAGTTTCACGGCTATCAATTTCTTTAGGCCGTTTGTCTATCGATTGCCCGAGAATACGTTTATTTGGGCGTTTCTTCAGAGAGGACACTTTTGGTTTACGAGAGAGCTTTTCTAAAAGATCAAGGTTCGTTGTTCGCATGATTCCTTTATCTATCCAATTGTAAAGTGTTGTTGTACTAGGAATAATGGCACGATCAAACAACTCATGCTCTAACGCAAAACCAGTCACGGCATCAGGGGACCATTTATCAAGCAACATCTTATCATCGGCCCATTCTATAAAGGTATCTATATCCGCCCATTTTGGCCGTCGGCCACAGTTTAAACGATGTCTGTCATAAGCTGCTTGTCCAGCATCAGCGTCATAAGCTTCAGTATAGTAATCATAGACCTTTCCTTTTTGCTTTTGGCGTTTAAGTTGTGTGACCGTTCCGCGCTTCACCTCATTATTGATTGTTTGTGGAGCACGTTCTAAAACACTAGCAATCCGACGATTGGAATAGTTTTCTTGCTTTAAAATAGCGATTTGAGACCGCTCTGAATAAGATAAGTGTTTTCCCTTACGTGCTGATGTGGTATGGTTAGAGTGCGTCATGTGAATTCATCCTGTCTATTGAGAGTTAGTGGTAACTTCAATATAACATGAAATTCACATGGCGTTTTTTATATGTTAGCCAGGTGGCTAACTTCATTATAAAATCCAGC	NA	NA	NA	NA
AYW48244.1|1552554_1553277_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.9	8.9e-33
AYW48245.1|1553276_1554725_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.5	2.3e-32
>prophage 9
CP027783	Tetragenococcus osmophilus strain JCM 31126 chromosome, complete genome	2329167	2204717	2281465	2329167	tRNA,transposase,integrase	Streptococcus_phage(35.71%)	54	2225460:2225476	2267998:2268014
AYW48788.1|2204717_2205797_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.0	1.0e-48
AYW48789.1|2205953_2207789_-	hypothetical protein	NA	NA	NA	NA	NA
AYW48790.1|2207985_2208780_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
AYW48791.1|2209244_2210444_-	CDP-glycerol--poly(glycerophosphate) glycerophosphotransferase	NA	NA	NA	NA	NA
AYW48954.1|2210424_2211153_-	glycosyltransferase	NA	NA	NA	NA	NA
AYW48955.1|2211160_2212273_-	CDP-glycerol--UDP-pyrophosphoryl-N- acetylglucosaminyl-N-acetylmannosamine glycerophosphotransferase	NA	NA	NA	NA	NA
AYW48792.1|2212490_2212718_-	hypothetical protein	NA	NA	NA	NA	NA
AYW48793.1|2212958_2214257_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.2	7.1e-57
AYW48794.1|2214292_2215483_-	aspartate aminotransferase	NA	NA	NA	NA	NA
AYW48956.1|2215509_2215962_-	peptidase	NA	NA	NA	NA	NA
AYW48795.1|2216098_2218849_-	DNA polymerase III subunit epsilon	NA	A0A1X9I5C8	Streptococcus_phage	37.0	2.9e-60
AYW48796.1|2219101_2219302_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.7	1.6e-21
AYW48797.1|2219541_2220636_-	hypothetical protein	NA	NA	NA	NA	NA
AYW48798.1|2220840_2222181_+	excinuclease ABC subunit A	NA	M1Q231	Streptococcus_phage	42.3	1.1e-97
AYW48799.1|2222272_2224321_+	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	32.9	2.8e-71
AYW48800.1|2224477_2225542_+	ABC transporter permease	NA	NA	NA	NA	NA
2225460:2225476	attL	TAGTTTCAGTCGCTATT	NA	NA	NA	NA
AYW48801.1|2225544_2226225_+	hemin ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.5	1.8e-27
AYW48802.1|2226302_2226911_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYW48803.1|2227337_2228054_-	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	36.2	5.4e-30
AYW48804.1|2228057_2229863_-	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
AYW48805.1|2229868_2231386_-	glycerol kinase	NA	NA	NA	NA	NA
AYW48806.1|2231538_2232978_-	transcriptional regulator	NA	NA	NA	NA	NA
AYW48807.1|2232967_2234284_-	oxidoreductase	NA	NA	NA	NA	NA
AYW48808.1|2234775_2235765_-	hypothetical protein	NA	NA	NA	NA	NA
AYW48809.1|2235901_2236651_-	DUF4336 domain-containing protein	NA	NA	NA	NA	NA
AYW48810.1|2237080_2237986_-	hypothetical protein	NA	NA	NA	NA	NA
AYW48811.1|2238242_2238713_-	hypothetical protein	NA	NA	NA	NA	NA
AYW48812.1|2240771_2240954_-	hypothetical protein	NA	NA	NA	NA	NA
AYW48813.1|2247790_2248690_-	type I-E CRISPR-associated endoribonuclease Cas2	NA	U5PXE0	Bacillus_virus	33.1	2.2e-12
AYW48814.1|2248689_2249634_-	type I-E CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
AYW48815.1|2249637_2250273_-	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
AYW48816.1|2250274_2250994_-	type I-E CRISPR-associated protein Cas5/CasD	NA	NA	NA	NA	NA
AYW48817.1|2250995_2252081_-	type I-E CRISPR-associated protein Cas7/Cse4/CasC	NA	NA	NA	NA	NA
AYW48818.1|2252083_2252686_-	type I-E CRISPR-associated protein Cse2/CasB	NA	NA	NA	NA	NA
AYW48819.1|2252687_2254376_-	type I-E CRISPR-associated protein Cse1/CasA	NA	NA	NA	NA	NA
AYW48820.1|2254362_2257164_-	CRISPR-associated helicase/endonuclease Cas3	NA	A0A2R2ZGW0	Clostridioides_phage	27.5	3.2e-09
AYW48957.1|2257607_2258267_-	hemolysin expression modulating protein	NA	NA	NA	NA	NA
AYW48821.1|2258374_2259733_+|transposase	transposase	transposase	NA	NA	NA	NA
AYW48822.1|2260287_2261538_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	56.6	1.1e-110
AYW48823.1|2262049_2262253_+	DNA-binding protein	NA	NA	NA	NA	NA
AYW48824.1|2262273_2263713_+|integrase	site-specific integrase	integrase	A0A0A8WF01	Clostridium_phage	26.0	1.7e-22
AYW48825.1|2264213_2265383_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYW48826.1|2266730_2267051_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
AYW48827.1|2270351_2271614_-	ATP-dependent helicase	NA	A0A1V0SBR7	Catovirus	31.7	4.2e-38
2267998:2268014	attR	TAGTTTCAGTCGCTATT	NA	NA	NA	NA
AYW48828.1|2271623_2272631_-	oxidoreductase	NA	NA	NA	NA	NA
AYW48829.1|2272652_2273384_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AYW48830.1|2273553_2274843_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
AYW48831.1|2274885_2275368_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYW48832.1|2275487_2276690_+	hypothetical protein	NA	NA	NA	NA	NA
AYW48833.1|2276712_2276949_-	hypothetical protein	NA	NA	NA	NA	NA
AYW48834.1|2277068_2278379_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.5	2.1e-64
AYW48835.1|2278482_2278986_-	hydrolase	NA	NA	NA	NA	NA
AYW48836.1|2279104_2279863_-	RNA methyltransferase	NA	NA	NA	NA	NA
AYW48837.1|2280046_2281465_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
>prophage 1
CP027785	Tetragenococcus osmophilus strain JCM 31126 plasmid pTO2, complete sequence	27560	0	2556	27560		Streptococcus_phage(100.0%)	1	NA	NA
AYW48988.1|693_2556_-	copper-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	34.8	5.4e-98
>prophage 2
CP027785	Tetragenococcus osmophilus strain JCM 31126 plasmid pTO2, complete sequence	27560	9645	17955	27560	transposase	Clostridium_phage(33.33%)	9	NA	NA
AYW49001.1|9645_10218_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	42.6	3.9e-23
AYW49002.1|10797_11478_+|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	2.5e-109
AYW49003.1|11544_12117_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	41.2	1.2e-21
AYW49004.1|12511_13960_-	hypothetical protein	NA	NA	NA	NA	NA
AYW49005.1|13960_14854_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.1	9.7e-21
AYW49006.1|14840_15779_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.8	3.6e-18
AYW49007.1|15963_16524_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYW49008.1|16880_17246_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
AYW49009.1|17274_17955_-|transposase	IS6-like element ISTeha2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	83.2	7.7e-111
