The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033635	Escherichia coli isolate ECCNB12-2 chromosome, complete genome	5539489	541021	549029	5539489		Escherichia_phage(55.56%)	15	NA	NA
AYW28935.1|541021_542410_+	replicative DNA helicase	NA	O80281	Escherichia_phage	50.1	9.8e-113
AYW28936.1|542399_544049_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
AYW28937.1|544041_544773_+	DUF2786 domain-containing protein	NA	L7P7W8	Pseudomonas_phage	36.6	1.4e-17
AYW28938.1|544769_545348_+	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
AYW28939.1|545344_545593_+	hypothetical protein	NA	NA	NA	NA	NA
AYW28940.1|545772_545985_+	enterohemolysin 2	NA	A0A2D1GLY5	Escherichia_phage	82.2	1.7e-13
AYW28941.1|545981_546203_+	hypothetical protein	NA	NA	NA	NA	NA
AYW28942.1|546189_546789_+	ead/Ea22-like family protein	NA	A0A2D1GLY5	Escherichia_phage	64.8	1.4e-55
AYW28943.1|546962_547226_+	hypothetical protein	NA	NA	NA	NA	NA
AYW28944.1|547302_547701_+	hypothetical protein	NA	A0A1U9AJ59	Stx1_converting_phage	62.6	1.4e-32
AYW28945.1|547702_547924_+	hypothetical protein	NA	K7P6F8	Enterobacteria_phage	74.6	4.5e-20
AYW28946.1|547925_548123_+	hypothetical protein	NA	A0A1I9SEY0	Klebsiella_phage	86.2	1.3e-31
AYW28947.1|548133_548547_+	hypothetical protein	NA	A0A076G611	Escherichia_phage	77.8	1.5e-29
AYW28948.1|548595_548811_+	hypothetical protein	NA	NA	NA	NA	NA
AYW28949.1|548807_549029_+	hypothetical protein	NA	G8C7U9	Escherichia_phage	54.1	1.2e-12
>prophage 2
CP033635	Escherichia coli isolate ECCNB12-2 chromosome, complete genome	5539489	1129266	1145479	5539489	terminase,integrase	Escherichia_phage(40.0%)	26	1132514:1132530	1147769:1147785
AYW29457.1|1129266_1130733_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
AYW29458.1|1130801_1132379_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
1132514:1132530	attL	ATTACCTTAAAGGTATA	NA	NA	NA	NA
AYW29459.1|1132571_1133822_+|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.5	1.2e-239
AYW29460.1|1133825_1134020_-	DUF1382 family protein	NA	G9L698	Escherichia_phage	96.9	2.8e-26
AYW29461.1|1134016_1134667_-	adenine methylase	NA	A0A0F6TJC3	Escherichia_coli_O157_typing_phage	96.8	1.7e-123
AYW33344.1|1134659_1134911_-	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	98.8	1.2e-40
AYW29462.1|1135068_1135317_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
AYW29463.1|1135366_1136248_-	recombinase RecT	NA	G9L6A2	Escherichia_phage	100.0	1.6e-161
AYW29464.1|1136244_1137066_-	exodeoxyribonuclease VIII	NA	A0A2R9YJH7	Escherichia_phage	98.9	1.8e-162
AYW29465.1|1137062_1137362_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	98.0	1.4e-45
AYW29466.1|1137670_1138255_-	XRE family transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
AYW29467.1|1138409_1138640_+	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
AYW29468.1|1138788_1139001_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	54.7	3.3e-12
AYW29469.1|1138981_1139812_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	96.4	5.8e-153
AYW29470.1|1139783_1140560_+	replication protein	NA	G9L6A9	Escherichia_phage	100.0	4.6e-152
AYW29471.1|1140677_1141022_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	98.2	4.8e-61
AYW29472.1|1141083_1141626_+	hypothetical protein	NA	G9L6B1	Escherichia_phage	58.7	2.5e-40
AYW29473.1|1141622_1141808_+	hypothetical protein	NA	K7P7P5	Enterobacteria_phage	91.8	1.6e-26
AYW29474.1|1141914_1142232_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	91.0	4.0e-46
AYW29475.1|1142218_1142773_+	ead/Ea22-like family protein	NA	K7P6J7	Enterobacteria_phage	66.8	2.5e-75
AYW29476.1|1142932_1143124_+	hypothetical protein	NA	A0A0F6R8N3	Escherichia_coli_O157_typing_phage	52.2	4.4e-08
AYW29477.1|1143125_1143875_+	DUF551 domain-containing protein	NA	A0A2I6PID2	Escherichia_phage	94.1	1.6e-56
AYW29478.1|1143874_1144159_+	DUF4752 family protein	NA	A5VWB4	Enterobacteria_phage	100.0	3.8e-48
AYW29479.1|1144151_1144433_+	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	98.9	1.5e-49
AYW29480.1|1144425_1144764_+	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	87.5	6.4e-50
AYW29481.1|1144804_1145479_+|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	100.0	9.0e-120
1147769:1147785	attR	TATACCTTTAAGGTAAT	NA	NA	NA	NA
>prophage 3
CP033635	Escherichia coli isolate ECCNB12-2 chromosome, complete genome	5539489	1148480	1173614	5539489	tail,holin	Escherichia_phage(69.23%)	29	NA	NA
AYW29483.1|1148480_1148687_+	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
AYW29484.1|1148701_1150381_+|tail	phage tail protein	tail	G9L6C2	Escherichia_phage	99.5	3.6e-303
AYW29485.1|1150377_1150674_+	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
AYW29486.1|1150676_1151372_+	peptidase	NA	G9L6C4	Escherichia_phage	99.1	3.9e-94
AYW29487.1|1151386_1152373_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	100.0	1.5e-187
AYW29488.1|1152424_1152862_+	hypothetical protein	NA	G9L6C6	Escherichia_phage	100.0	2.2e-74
AYW29489.1|1152872_1153208_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	99.1	7.7e-56
AYW29490.1|1153258_1153582_+	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	98.1	2.6e-53
AYW29491.1|1153581_1154187_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	99.5	1.8e-111
AYW29492.1|1154186_1156658_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	99.3	0.0e+00
AYW29493.1|1156657_1157122_+	hypothetical protein	NA	G9L6D1	Escherichia_phage	98.7	1.2e-83
AYW29494.1|1157121_1157667_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	98.3	1.9e-91
AYW29495.1|1157666_1160180_+	hypothetical protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	98.4	0.0e+00
AYW29496.1|1160176_1161979_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	97.8	0.0e+00
AYW29497.1|1161984_1164459_+	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	96.5	0.0e+00
AYW29498.1|1164468_1164882_+	hypothetical protein	NA	NA	NA	NA	NA
AYW29499.1|1164920_1165082_-	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
AYW29500.1|1165174_1165615_-	hypothetical protein	NA	NA	NA	NA	NA
AYW29501.1|1165902_1166589_-	anti-repressor protein	NA	G9L6E2	Escherichia_phage	81.8	4.5e-103
AYW29502.1|1166901_1167159_-	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	98.8	1.7e-42
AYW29503.1|1167354_1169544_+|tail	phage tail protein	tail	A0A2H4YDP3	Escherichia_virus	46.4	1.6e-130
AYW33345.1|1169552_1169837_+	hypothetical protein	NA	NA	NA	NA	NA
AYW29504.1|1170039_1170444_+	hypothetical protein	NA	G9L6E6	Escherichia_phage	97.0	2.7e-63
AYW29505.1|1170430_1170739_+|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	93.1	4.6e-47
AYW29506.1|1170728_1171358_+	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	96.7	2.6e-113
AYW29507.1|1171354_1171837_+	DUF2514 domain-containing protein	NA	A0A2R9YJI7	Escherichia_phage	95.6	1.3e-75
AYW29508.1|1172056_1172596_-	hypothetical protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
AYW29509.1|1172611_1173127_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.0e-62
AYW33346.1|1173440_1173614_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
>prophage 4
CP033635	Escherichia coli isolate ECCNB12-2 chromosome, complete genome	5539489	1320108	1334091	5539489	integrase,capsid	Escherichia_phage(83.33%)	8	1312919:1312933	1322742:1322756
1312919:1312933	attL	TTTTTTTTGCACCTC	NA	NA	NA	NA
AYW29632.1|1320108_1320678_-|integrase	integrase	integrase	A0A2L1IV36	Escherichia_phage	52.2	7.0e-49
AYW29633.1|1321426_1322056_+	pilus assembly protein	NA	A0A2L1IV36	Escherichia_phage	99.0	5.4e-119
AYW29634.1|1322373_1322994_+	LuxR family transcriptional regulator	NA	A0A2L1IV08	Escherichia_phage	99.0	1.3e-117
1322742:1322756	attR	GAGGTGCAAAAAAAA	NA	NA	NA	NA
AYW29635.1|1323018_1330932_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV38	Escherichia_phage	93.4	0.0e+00
AYW29636.1|1330979_1331510_+	OmpH family outer membrane protein	NA	A0A2L1IV11	Escherichia_phage	97.7	3.3e-85
AYW29637.1|1332183_1332432_+	transcriptional regulator	NA	NA	NA	NA	NA
AYW29638.1|1332431_1332776_+	MazF family transcriptional regulator	NA	NA	NA	NA	NA
AYW29639.1|1332819_1334091_-|capsid	phage capsid protein	capsid	F1BUQ8	Erwinia_phage	37.0	8.3e-50
>prophage 5
CP033635	Escherichia coli isolate ECCNB12-2 chromosome, complete genome	5539489	1582303	1680023	5539489	lysis,plate,protease,transposase,tail,integrase,head,terminase,tRNA,portal,capsid	Enterobacteria_phage(57.69%)	100	1649758:1649773	1675690:1675705
AYW29856.1|1582303_1582999_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
AYW29857.1|1582995_1583394_-	hypothetical protein	NA	NA	NA	NA	NA
AYW29858.1|1583632_1584580_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
AYW29859.1|1584810_1585836_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AYW29860.1|1586349_1587045_-	aquaporin	NA	NA	NA	NA	NA
AYW29861.1|1587470_1589129_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AYW29862.1|1589125_1590118_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
AYW29863.1|1590232_1591348_+	MacA family efflux pump subunit	NA	NA	NA	NA	NA
AYW29864.1|1591344_1593291_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
AYW29865.1|1593363_1593588_-	cold-shock protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
AYW29866.1|1593822_1594005_-	hypothetical protein	NA	NA	NA	NA	NA
AYW29867.1|1593992_1595231_+	DUF4102 domain-containing protein	NA	A0A2H4JB45	uncultured_Caudovirales_phage	53.2	1.8e-126
AYW29868.1|1595650_1595860_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	71.4	1.5e-17
AYW29869.1|1598055_1598355_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AYW29870.1|1598351_1600100_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	39.3	5.1e-90
AYW29871.1|1600386_1600644_+	hypothetical protein	NA	NA	NA	NA	NA
AYW29872.1|1600640_1601051_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AYW29873.1|1601068_1601389_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AYW29874.1|1601468_1602053_+	proQ/FINO family protein	NA	NA	NA	NA	NA
AYW29875.1|1602340_1602925_+|terminase	terminase small subunit	terminase	K7PJS9	Enterobacteria_phage	56.7	1.1e-57
AYW33357.1|1603176_1603467_+	hypothetical protein	NA	NA	NA	NA	NA
AYW29876.1|1604154_1604352_-	hypothetical protein	NA	NA	NA	NA	NA
AYW29877.1|1604488_1604809_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
AYW29878.1|1604839_1607116_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
AYW29879.1|1607740_1607959_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AYW29880.1|1608243_1608948_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AYW29881.1|1608989_1610711_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.0	1.9e-20
AYW29882.1|1610711_1612478_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	9.2e-23
AYW29883.1|1612600_1613566_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
AYW29884.1|1614110_1614605_+	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AYW29885.1|1614739_1618849_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
AYW29886.1|1619007_1619619_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AYW29887.1|1619629_1620973_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
AYW29888.1|1621063_1622356_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AYW29889.1|1622554_1622782_+	hypothetical protein	NA	NA	NA	NA	NA
AYW29890.1|1622932_1623073_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	64.4	2.0e-10
AYW29891.1|1624937_1625078_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	93.5	1.0e-17
AYW29892.1|1625298_1625541_+	hypothetical protein	NA	NA	NA	NA	NA
AYW29893.1|1625755_1625971_+	hypothetical protein	NA	NA	NA	NA	NA
AYW29894.1|1626113_1626365_-	transcriptional regulator	NA	NA	NA	NA	NA
AYW29895.1|1626408_1627536_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	76.0	2.0e-156
AYW29896.1|1627661_1628945_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	77.3	5.6e-187
AYW29897.1|1628944_1629463_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	77.2	1.8e-72
AYW29898.1|1629513_1629876_+|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	62.1	1.9e-28
AYW29899.1|1629884_1630040_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	84.3	3.8e-18
AYW29900.1|1630026_1633338_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	51.0	3.0e-253
AYW29901.1|1633349_1633838_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	80.7	6.1e-70
AYW29902.1|1633908_1634520_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.6	1.5e-60
AYW29903.1|1634519_1636754_-	short-chain fatty acid transporter	NA	A0A0A7NV63	Enterobacteria_phage	67.1	1.2e-72
AYW29904.1|1636757_1637321_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	77.9	2.1e-74
AYW29905.1|1637313_1638210_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	79.5	1.6e-127
AYW29906.1|1638213_1638564_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	74.1	5.1e-42
AYW29907.1|1638560_1639142_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	69.4	1.9e-73
AYW33358.1|1639138_1639753_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	69.3	1.8e-74
AYW29908.1|1639810_1640275_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	70.7	1.9e-60
AYW33359.1|1640261_1640441_-	hypothetical protein	NA	NA	NA	NA	NA
AYW29909.1|1640810_1641356_-	lysozyme	NA	A0A0M3LPQ1	Mannheimia_phage	41.3	5.9e-29
AYW29910.1|1641352_1641643_-|tail	phage tail protein	tail	NA	NA	NA	NA
AYW29911.1|1641636_1641834_-|tail	phage tail protein	tail	A0A0A7NV57	Enterobacteria_phage	76.9	2.5e-22
AYW29912.1|1641833_1642328_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	76.7	6.4e-67
AYW29913.1|1642430_1643207_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	82.6	1.3e-101
AYW29914.1|1643209_1644349_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	74.2	3.1e-149
AYW29915.1|1644377_1645214_-|capsid	phage capsid protein	capsid	A0A0A7NRY7	Enterobacteria_phage	69.8	5.9e-105
AYW29916.1|1645368_1647120_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	84.6	7.4e-291
AYW29917.1|1647119_1648175_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	82.3	6.8e-175
AYW33360.1|1648241_1648745_-	hypothetical protein	NA	NA	NA	NA	NA
AYW33361.1|1649235_1649424_-	hypothetical protein	NA	NA	NA	NA	NA
AYW29918.1|1649633_1649843_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	98.6	7.2e-36
1649758:1649773	attL	CCGAAGTCTGGCGTTT	NA	NA	NA	NA
AYW29919.1|1649844_1650159_-	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	93.3	1.9e-48
AYW29920.1|1650170_1650365_-	hypothetical protein	NA	NA	NA	NA	NA
AYW33362.1|1650361_1650667_-	hypothetical protein	NA	NA	NA	NA	NA
AYW29921.1|1650789_1653300_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	50.8	3.8e-208
AYW29922.1|1653305_1653719_-	hypothetical protein	NA	NA	NA	NA	NA
AYW29923.1|1653787_1654012_-	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	83.6	4.0e-24
AYW29924.1|1654332_1654887_-	DNA-binding protein	NA	A0A2I7QQL0	Vibrio_phage	40.3	4.6e-05
AYW29925.1|1655121_1655604_+	hypothetical protein	NA	NA	NA	NA	NA
AYW29926.1|1655643_1655856_-	hypothetical protein	NA	NA	NA	NA	NA
AYW29927.1|1655852_1656062_-	hypothetical protein	NA	NA	NA	NA	NA
AYW29928.1|1656072_1656366_-	hypothetical protein	NA	NA	NA	NA	NA
AYW29929.1|1656568_1656811_-	DUF4754 domain-containing protein	NA	NA	NA	NA	NA
AYW29930.1|1656849_1657158_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	66.4	1.3e-33
AYW29931.1|1657440_1657647_-	hypothetical protein	NA	NA	NA	NA	NA
AYW29932.1|1657655_1658177_-	transcriptional regulator	NA	NA	NA	NA	NA
AYW29933.1|1658280_1658622_+	XRE family transcriptional regulator	NA	A0A0A7NPW3	Enterobacteria_phage	39.5	5.9e-11
AYW29934.1|1658691_1659687_+|integrase	integrase	integrase	A0A0F7LBR0	Escherichia_phage	55.9	4.6e-104
AYW29935.1|1659983_1662428_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	8.6e-221
AYW29936.1|1662438_1663056_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
AYW29937.1|1663057_1663921_+	dimethyl sulfoxide reductase subunit C	NA	NA	NA	NA	NA
AYW29938.1|1663956_1664583_-	hydrolase	NA	NA	NA	NA	NA
AYW29939.1|1664897_1666046_+	MFS transporter	NA	NA	NA	NA	NA
AYW29940.1|1666255_1667686_+	inner membrane transporter YcaM	NA	NA	NA	NA	NA
AYW29941.1|1667895_1668636_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
AYW29942.1|1668827_1671110_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
AYW29943.1|1671164_1672022_-	formate transporter FocA	NA	NA	NA	NA	NA
AYW29944.1|1672427_1674188_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
AYW29945.1|1674317_1675010_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
AYW29946.1|1675208_1676297_+	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
1675690:1675705	attR	AAACGCCAGACTTCGG	NA	NA	NA	NA
AYW29947.1|1676367_1677651_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AYW29948.1|1677794_1679123_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AYW29949.1|1679258_1680023_+|protease	metalloprotease	protease	NA	NA	NA	NA
>prophage 6
CP033635	Escherichia coli isolate ECCNB12-2 chromosome, complete genome	5539489	2008485	2088078	5539489	protease,transposase,tail,integrase,head,terminase,portal,capsid	Enterobacteria_phage(33.9%)	93	2001939:2001953	2027108:2027122
2001939:2001953	attL	TGGATATGGCTCGTA	NA	NA	NA	NA
AYW30253.1|2008485_2009364_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	61.7	2.7e-84
AYW30254.1|2009459_2009828_+|tail	tail fiber domain-containing protein	tail	K7PGY2	Enterobacteria_phage	54.8	1.3e-27
AYW30255.1|2009916_2010144_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	73.0	4.8e-25
AYW30256.1|2010569_2012363_-	alkaline phosphatase family protein	NA	NA	NA	NA	NA
AYW33379.1|2012881_2013178_-	YciI family protein	NA	NA	NA	NA	NA
AYW33380.1|2013401_2014118_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
AYW30257.1|2014157_2014556_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
AYW30258.1|2014660_2015200_-	septation protein A	NA	NA	NA	NA	NA
AYW30259.1|2015229_2015973_-	UPF0259 family protein	NA	NA	NA	NA	NA
AYW30260.1|2016327_2016966_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
AYW30261.1|2017011_2018142_-|integrase	integrase	integrase	O21940	Phage_21	49.7	7.0e-101
AYW30262.1|2018119_2018368_-	excisionase	NA	NA	NA	NA	NA
AYW30263.1|2018432_2020886_-	exonuclease	NA	V5UQJ3	Shigella_phage	60.6	3.3e-172
AYW30264.1|2021005_2021227_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	87.7	2.7e-33
AYW30265.1|2021272_2022115_-	transcriptional regulator	NA	A0A0P0ZE80	Stx2-converting_phage	56.4	2.8e-54
AYW30266.1|2022392_2022602_+	hypothetical protein	NA	NA	NA	NA	NA
AYW30267.1|2022540_2022741_+	hypothetical protein	NA	NA	NA	NA	NA
AYW30268.1|2023144_2023564_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	4.0e-25
AYW30269.1|2023665_2023947_+	Cro/Cl family transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
AYW30270.1|2023930_2024356_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AYW30271.1|2024426_2025437_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	90.9	2.9e-175
AYW33381.1|2025468_2025891_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
AYW33382.1|2025923_2026688_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	69.4	1.4e-84
AYW33383.1|2026704_2027244_+	ead/Ea22-like family protein	NA	A0A0U2QW67	Escherichia_phage	67.7	1.1e-43
2027108:2027122	attR	TGGATATGGCTCGTA	NA	NA	NA	NA
AYW30272.1|2027240_2027870_+	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	96.2	2.2e-48
AYW30273.1|2027965_2028148_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	2.0e-26
AYW30274.1|2028313_2028829_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	78.1	7.2e-37
AYW30275.1|2029033_2029333_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2R2Z2Y1	Escherichia_phage	92.9	2.4e-48
AYW30276.1|2029338_2029596_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	84.3	7.3e-30
AYW30277.1|2029731_2030010_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	6.3e-11
AYW30278.1|2030011_2031064_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	51.7	2.6e-97
AYW30279.1|2031064_2031430_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.4	1.1e-39
AYW30280.1|2031426_2032095_+	antiterminator	NA	I6PDF8	Cronobacter_phage	50.7	4.3e-58
AYW30281.1|2032345_2033059_+	hypothetical protein	NA	NA	NA	NA	NA
AYW30282.1|2033750_2034023_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	77.8	4.1e-31
AYW30283.1|2034680_2035214_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.9	1.7e-97
AYW30284.1|2035430_2035616_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	78.7	1.9e-19
AYW30285.1|2035936_2036137_+	hypothetical protein	NA	NA	NA	NA	NA
AYW30286.1|2036313_2036763_+	hypothetical protein	NA	I6RSN8	Salmonella_phage	84.6	6.9e-68
AYW33384.1|2037194_2037521_+	TonB family protein	NA	H6WZK5	Escherichia_phage	70.4	1.2e-37
AYW33385.1|2037885_2038137_-	hypothetical protein	NA	NA	NA	NA	NA
AYW30287.1|2038476_2039025_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	66.9	2.0e-61
AYW30288.1|2038996_2040925_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	67.0	1.8e-261
AYW30289.1|2040908_2041115_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AYW30290.1|2041111_2042704_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	1.0e-182
AYW30291.1|2042693_2044199_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.7	9.7e-98
AYW30292.1|2044235_2044583_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	7.5e-22
AYW30293.1|2044640_2045669_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	2.9e-114
AYW30294.1|2045720_2046083_+	DNA packaging protein	NA	NA	NA	NA	NA
AYW33386.1|2046078_2046432_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	94.7	3.3e-57
AYW30295.1|2046443_2047019_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	60.2	2.0e-51
AYW30296.1|2047015_2047411_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
AYW33387.1|2047418_2048171_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	89.6	4.1e-121
AYW30297.1|2048184_2048616_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
AYW30298.1|2048642_2049032_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	2.4e-56
AYW30299.1|2049024_2051604_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	96.9	0.0e+00
AYW30300.1|2051600_2051930_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	96.3	2.2e-55
AYW30301.1|2051929_2052628_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	7.6e-130
AYW30302.1|2052632_2053376_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.5	4.4e-144
AYW30303.1|2053273_2053921_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	90.2	1.0e-104
AYW33388.1|2056543_2057698_+	DUF1983 domain-containing protein	NA	A5LH43	Enterobacteria_phage	61.2	3.0e-30
AYW30304.1|2057697_2057958_+	hypothetical protein	NA	NA	NA	NA	NA
AYW30305.1|2057957_2058620_+	hypothetical protein	NA	NA	NA	NA	NA
AYW30306.1|2058959_2059190_+|tail	phage tail protein	tail	Q9LA62	Enterobacterial_phage	83.6	9.4e-29
AYW30307.1|2059263_2060472_-|transposase	IS256-like element IS1414 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	7.4e-48
AYW30308.1|2060530_2062111_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	59.0	2.2e-169
AYW30309.1|2062130_2062478_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	77.6	5.2e-47
AYW30310.1|2062477_2063155_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AYW30311.1|2063131_2063251_+	copper resistance protein	NA	NA	NA	NA	NA
AYW30312.1|2063262_2064849_+	hypothetical protein	NA	NA	NA	NA	NA
AYW30313.1|2064863_2065439_+	DUF4376 domain-containing protein	NA	Q9MCI9	Enterobacteria_phage	59.7	2.9e-63
AYW30314.1|2066217_2067597_+	immunoglobulin-binding protein	NA	Q9MCI8	Enterobacteria_phage	76.1	5.7e-20
AYW33389.1|2067889_2068114_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AYW30315.1|2068500_2069709_-|transposase	IS256-like element IS1414 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	9.6e-48
AYW30316.1|2069850_2070069_-	DinI family protein	NA	H6WZN4	Escherichia_phage	83.1	5.4e-26
AYW33390.1|2071340_2071418_-	DUF892 family protein	NA	NA	NA	NA	NA
AYW30317.1|2071463_2071964_-	YciE/YciF family protein	NA	NA	NA	NA	NA
AYW30318.1|2072049_2072229_-	hypothetical protein	NA	NA	NA	NA	NA
AYW30319.1|2072609_2073416_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AYW30320.1|2073415_2074609_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AYW33391.1|2074620_2075979_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	6.6e-37
AYW30321.1|2075982_2077578_-	bifunctional glutamine amidotransferase/anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
AYW30322.1|2077577_2079140_-	anthranilate synthase component I	NA	NA	NA	NA	NA
AYW33392.1|2079231_2079276_-	trp operon leader peptide	NA	NA	NA	NA	NA
AYW30323.1|2079413_2080295_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
AYW30324.1|2080291_2080912_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AYW30325.1|2080939_2082835_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
AYW30326.1|2083045_2083921_+	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
AYW30327.1|2084090_2085092_+	hypothetical protein	NA	NA	NA	NA	NA
AYW30328.1|2085102_2085411_+	hypothetical protein	NA	NA	NA	NA	NA
AYW30329.1|2085463_2086054_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AYW30330.1|2086050_2086809_-	NAD(P)-dependent oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	1.2e-06
AYW30331.1|2087028_2088078_+|protease	protease	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 7
CP033635	Escherichia coli isolate ECCNB12-2 chromosome, complete genome	5539489	2522017	2604951	5539489	transposase,tRNA	Stx2-converting_phage(25.0%)	66	NA	NA
AYW30698.1|2522017_2523946_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
AYW30699.1|2524468_2526367_+	ShET2/EspL2 family type III secretion system effector toxin	NA	NA	NA	NA	NA
AYW30700.1|2526541_2526649_+	hypothetical protein	NA	NA	NA	NA	NA
AYW30701.1|2526701_2527460_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
AYW30702.1|2527746_2528676_+	6-phosphofructokinase II	NA	NA	NA	NA	NA
AYW30703.1|2528776_2529067_+	endoribonuclease GhoS	NA	NA	NA	NA	NA
AYW30704.1|2529172_2530033_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
AYW30705.1|2530073_2530610_-	hypothetical protein	NA	NA	NA	NA	NA
AYW30706.1|2530756_2531425_+	2-deoxyglucose-6-phosphate phosphatase	NA	NA	NA	NA	NA
AYW30707.1|2531587_2532178_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYW30708.1|2532310_2533702_+	L-cystine transporter	NA	NA	NA	NA	NA
AYW30709.1|2533705_2534509_-	hypothetical protein	NA	NA	NA	NA	NA
AYW30710.1|2534797_2535061_-	cell division activator CedA	NA	NA	NA	NA	NA
AYW30711.1|2535243_2537505_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	2.3e-143
AYW30712.1|2537551_2538301_-	chitooligosaccharide deacetylase	NA	NA	NA	NA	NA
AYW30713.1|2538313_2539666_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AYW30714.1|2539769_2540609_-	transcriptional regulator ChbR	NA	NA	NA	NA	NA
AYW30715.1|2540619_2540970_-	N,N'-diacetylchitobiose-specific phosphotransferase enzyme IIA component	NA	NA	NA	NA	NA
AYW30716.1|2541020_2542379_-	N,N'-diacetylchitobiose permease IIC component	NA	NA	NA	NA	NA
AYW33412.1|2542463_2542784_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
AYW30717.1|2543082_2543421_-	osmotically-inducible lipoprotein E	NA	NA	NA	NA	NA
AYW30718.1|2543622_2544450_+	NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
AYW30719.1|2544679_2545567_+	excinuclease Cho	NA	NA	NA	NA	NA
AYW30720.1|2545526_2546102_-	protein Ves	NA	NA	NA	NA	NA
AYW30721.1|2546304_2546790_-	ATP-independent periplasmic protein-refolding chaperone	NA	NA	NA	NA	NA
AYW30722.1|2547119_2548088_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
AYW30723.1|2548080_2549424_-	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
AYW30724.1|2549420_2550899_-	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AYW30725.1|2550895_2551930_-	arginine N-succinyltransferase	NA	NA	NA	NA	NA
AYW30726.1|2551926_2553147_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.6	7.2e-27
AYW30727.1|2553592_2554399_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
AYW30728.1|2554565_2555276_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
AYW30729.1|2555280_2555958_+	protein YdjY	NA	NA	NA	NA	NA
AYW30730.1|2555972_2556680_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
AYW30731.1|2556679_2557228_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
AYW30732.1|2557415_2558603_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	53.6	5.8e-122
AYW30733.1|2561946_2562120_+	hypothetical protein	NA	NA	NA	NA	NA
AYW30734.1|2562617_2563007_-	cytochrome B562	NA	NA	NA	NA	NA
AYW30735.1|2563456_2564203_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
AYW30736.1|2564217_2565759_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
AYW30737.1|2566515_2566728_+	hypothetical protein	NA	NA	NA	NA	NA
AYW30738.1|2566655_2566928_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AYW30739.1|2566945_2567266_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AYW30740.1|2567341_2567518_+	protein convertase	NA	NA	NA	NA	NA
AYW30741.1|2569890_2570073_-	iron(III) transporter permease	NA	NA	NA	NA	NA
AYW30742.1|2570069_2570249_-	ABC transporter permease	NA	NA	NA	NA	NA
AYW30743.1|2570541_2572521_-	PhoX family phosphatase	NA	NA	NA	NA	NA
AYW30744.1|2574856_2575309_-	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
AYW30745.1|2578237_2578489_-	hypothetical protein	NA	NA	NA	NA	NA
AYW30746.1|2578705_2579918_+|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.8	2.6e-101
AYW30747.1|2580236_2582324_-	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	33.8	2.3e-09
AYW30748.1|2582648_2582921_+	hypothetical protein	NA	NA	NA	NA	NA
AYW30749.1|2584077_2585109_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AYW30750.1|2586912_2587305_+|transposase	transposase	transposase	NA	NA	NA	NA
AYW30751.1|2589411_2589603_-	hypothetical protein	NA	NA	NA	NA	NA
AYW30752.1|2590948_2592208_-	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	27.8	1.7e-15
AYW30753.1|2594070_2594814_-	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	96.7	1.1e-91
AYW30754.1|2594813_2595986_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	97.7	1.4e-224
AYW30755.1|2596051_2596372_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	70.9	8.8e-33
AYW30756.1|2596998_2597781_-|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	98.5	1.1e-137
AYW30757.1|2599584_2601156_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
AYW30758.1|2601175_2601523_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	77.6	5.2e-47
AYW30759.1|2601522_2602200_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
AYW30760.1|2602323_2602602_+	hypothetical protein	NA	A0A0P0ZBS5	Stx2-converting_phage	62.0	1.3e-29
AYW30761.1|2603095_2603740_-	transcriptional regulator	NA	A0A0F7L444	uncultured_marine_virus	51.5	1.6e-54
AYW30762.1|2603724_2604951_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	34.2	1.5e-64
>prophage 8
CP033635	Escherichia coli isolate ECCNB12-2 chromosome, complete genome	5539489	2728316	2823014	5539489	protease,tail,transposase,head,terminase,tRNA,portal,capsid	Escherichia_phage(39.06%)	104	NA	NA
AYW30868.1|2728316_2729198_-|protease	protease HtpX	protease	NA	NA	NA	NA
AYW30869.1|2729389_2731438_-|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	8.8e-86
AYW30870.1|2731457_2732156_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
AYW30871.1|2732252_2732750_-	GAF domain-containing protein	NA	NA	NA	NA	NA
AYW30872.1|2732879_2734163_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
AYW30873.1|2734131_2736765_+	PqiB family protein	NA	NA	NA	NA	NA
AYW30874.1|2736844_2738284_+	ribosomal RNA small subunit methyltransferase F	NA	NA	NA	NA	NA
AYW30875.1|2738401_2738638_+	DUF1480 family protein	NA	NA	NA	NA	NA
AYW33420.1|2738742_2738934_+	DUF1482 family protein	NA	NA	NA	NA	NA
AYW30876.1|2738934_2739591_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	4.0e-56
AYW30877.1|2739986_2740328_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AYW30878.1|2740340_2741213_-	copper resistance D family protein	NA	NA	NA	NA	NA
AYW30879.1|2741216_2741591_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
AYW30880.1|2741729_2741960_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.7e-14
AYW30881.1|2742061_2742718_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
AYW30882.1|2742741_2743404_+	DNA polymerase III subunit epsilon	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
AYW30883.1|2743400_2745461_-	oligopeptidase B	NA	NA	NA	NA	NA
AYW30884.1|2745667_2746327_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
AYW30885.1|2746643_2747000_-	protein YebF	NA	NA	NA	NA	NA
AYW30886.1|2747066_2747357_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
AYW30887.1|2747490_2748669_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
AYW30888.1|2748724_2749366_-	KHG/KDPG aldolase	NA	NA	NA	NA	NA
AYW30889.1|2749402_2751214_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
AYW30890.1|2751448_2752924_-	glucose-6-phosphate 1-dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
AYW30891.1|2753261_2754131_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AYW30892.1|2754258_2755701_+	pyruvate kinase II	NA	NA	NA	NA	NA
AYW30893.1|2755832_2756804_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
AYW30894.1|2756922_2758245_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
AYW33421.1|2758260_2759193_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
AYW30895.1|2759271_2760027_+	Mn2+/Zn2+ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
AYW30896.1|2760023_2760809_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
AYW30897.1|2760955_2761966_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
AYW30898.1|2761974_2762586_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
AYW33422.1|2762724_2762790_-	hypothetical protein	NA	NA	NA	NA	NA
AYW30899.1|2762860_2763463_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
AYW30900.1|2763464_2763986_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
AYW30901.1|2764020_2764761_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AYW30902.1|2764789_2765242_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
AYW30903.1|2765234_2767007_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AYW30904.1|2767316_2767883_+	hydrolase	NA	NA	NA	NA	NA
AYW30905.1|2768237_2768486_+	DinI family protein	NA	S5MQI1	Escherichia_phage	81.7	9.8e-32
AYW30906.1|2768868_2769324_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AYW30907.1|2771401_2771977_-	DUF4376 domain-containing protein	NA	Q9MCI9	Enterobacteria_phage	59.7	2.9e-63
AYW30908.1|2771991_2773662_-	hypothetical protein	NA	Q9LA62	Enterobacterial_phage	79.1	3.6e-45
AYW30909.1|2773720_2777626_-	DUF1983 domain-containing protein	NA	A5LH43	Enterobacteria_phage	72.7	0.0e+00
AYW30910.1|2777686_2778319_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	97.1	6.1e-94
AYW30911.1|2778255_2778999_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	1.1e-147
AYW30912.1|2779003_2779702_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	4.4e-130
AYW30913.1|2779701_2780031_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	98.2	1.5e-56
AYW30914.1|2780027_2782589_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	90.6	0.0e+00
AYW30915.1|2782581_2783016_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AYW30916.1|2782997_2783420_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	90.0	6.1e-66
AYW33423.1|2783435_2784176_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	94.3	2.0e-125
AYW30917.1|2784183_2784579_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	96.9	2.1e-68
AYW30918.1|2784575_2785151_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	59.2	1.3e-50
AYW33424.1|2785162_2785516_-|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	94.7	3.3e-57
AYW30919.1|2785511_2785874_-	DNA packaging protein	NA	NA	NA	NA	NA
AYW30920.1|2785925_2786954_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	2.9e-114
AYW30921.1|2787011_2787359_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	7.5e-22
AYW30922.1|2787395_2788901_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.0	4.3e-98
AYW30923.1|2788890_2790483_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	1.3e-182
AYW30924.1|2790479_2790686_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AYW30925.1|2790669_2792598_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.9e-261
AYW30926.1|2792569_2793079_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
AYW30927.1|2793502_2793697_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	95.3	1.6e-26
AYW30928.1|2794057_2794351_+	increased serum survival lipoprotein Iss	NA	C6ZCX3	Enterobacteria_phage	91.8	1.6e-44
AYW30929.1|2794441_2794624_-	hypothetical protein	NA	K7PHU6	Enterobacteria_phage	73.3	6.1e-15
AYW30930.1|2794840_2795374_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.9	3.4e-98
AYW30931.1|2796031_2796304_-	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	77.8	4.1e-31
AYW30932.1|2797395_2798376_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
AYW30933.1|2798433_2798616_+	hypothetical protein	NA	NA	NA	NA	NA
AYW30934.1|2798671_2799778_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	54.8	6.4e-107
AYW30935.1|2799956_2800379_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.9	1.7e-55
AYW30936.1|2800378_2801236_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPA6	Escherichia_phage	98.6	9.2e-162
AYW30937.1|2801235_2802204_-	DNA primase	NA	A0A1B5FPA8	Escherichia_phage	98.8	2.3e-185
AYW30938.1|2802205_2803864_-	DEAD/DEAH box helicase	NA	A0A1B5FPA4	Escherichia_phage	95.3	0.0e+00
AYW33425.1|2803854_2804457_-	hypothetical protein	NA	A0A2D2W709	Pectobacterium_phage	38.4	1.4e-18
AYW30939.1|2804715_2805009_-	hypothetical protein	NA	A0A1B5FPB9	Escherichia_phage	99.0	5.2e-48
AYW30940.1|2805021_2805294_-	transcriptional regulator	NA	A0A1B5FPK9	Escherichia_phage	100.0	3.1e-47
AYW30941.1|2805428_2806118_+	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	100.0	2.0e-130
AYW30942.1|2806265_2806694_+	XRE family transcriptional regulator	NA	A0A1B5FPB8	Escherichia_phage	98.6	1.9e-75
AYW30943.1|2806695_2806887_+	hypothetical protein	NA	A0A1B5FPB5	Escherichia_phage	98.4	1.7e-28
AYW30944.1|2806883_2807075_+	hypothetical protein	NA	A0A1B5FPB2	Escherichia_phage	87.3	1.2e-24
AYW30945.1|2807259_2807619_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	79.0	1.9e-44
AYW30946.1|2807618_2807828_+	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	92.8	1.5e-28
AYW30947.1|2807799_2808018_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	81.2	2.5e-23
AYW30948.1|2808014_2808521_+	hypothetical protein	NA	F1C5A2	Cronobacter_phage	57.7	3.2e-53
AYW30949.1|2808533_2809391_+	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	73.2	1.8e-117
AYW30950.1|2809383_2809746_+	hypothetical protein	NA	Q8W655	Enterobacteria_phage	67.8	1.4e-39
AYW30951.1|2809761_2809983_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	88.9	1.7e-27
AYW30952.1|2810086_2810716_+	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	93.3	1.0e-109
AYW30953.1|2810803_2811046_+	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	97.5	2.6e-37
AYW30954.1|2811049_2811196_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	100.0	7.5e-24
AYW30955.1|2811204_2811441_+	excisionase	NA	Q8W657	Enterobacteria_phage	97.4	3.2e-40
AYW30956.1|2811496_2812810_+	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	97.3	1.6e-250
AYW30957.1|2812791_2813562_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	98.4	2.3e-71
AYW30958.1|2813614_2814010_+	hypothetical protein	NA	NA	NA	NA	NA
AYW30959.1|2814050_2814794_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
AYW30960.1|2814790_2815762_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AYW30961.1|2815796_2818226_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	NA	NA	NA	NA
AYW30962.1|2818250_2819351_-	cytochrome C	NA	NA	NA	NA	NA
AYW30963.1|2819738_2820485_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AYW33426.1|2820498_2821065_-	VOC family protein	NA	NA	NA	NA	NA
AYW30964.1|2821280_2823014_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	4.4e-86
>prophage 9
CP033635	Escherichia coli isolate ECCNB12-2 chromosome, complete genome	5539489	3132025	3141466	5539489		Enterobacteria_phage(85.71%)	10	NA	NA
AYW31224.1|3132025_3133162_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	8.5e-163
AYW31225.1|3133158_3135159_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
AYW31226.1|3135283_3135745_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AYW31227.1|3135784_3136255_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
AYW31228.1|3136301_3137021_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AYW31229.1|3137017_3138703_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.5	9.5e-304
AYW31230.1|3138924_3139656_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
AYW31231.1|3139715_3139823_+	protein YohO	NA	NA	NA	NA	NA
AYW31232.1|3139803_3140535_-	ABC transporter permease	NA	NA	NA	NA	NA
AYW31233.1|3140539_3141466_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 10
CP033635	Escherichia coli isolate ECCNB12-2 chromosome, complete genome	5539489	3898538	3960665	5539489	transposase,tRNA,protease,bacteriocin	uncultured_Mediterranean_phage(10.0%)	56	NA	NA
AYW31917.1|3898538_3899963_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.5e-26
AYW31918.1|3900092_3901610_-	deoxyguanosinetriphosphate triphosphohydrolase	NA	NA	NA	NA	NA
AYW31919.1|3901693_3902392_+	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
AYW31920.1|3902384_3903185_+	cobalamin-binding protein	NA	NA	NA	NA	NA
AYW31921.1|3903222_3903846_+	TRIC cation channel family protein	NA	NA	NA	NA	NA
AYW31922.1|3903892_3904237_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
AYW33464.1|3904229_3904295_-	hypothetical protein	NA	NA	NA	NA	NA
AYW31923.1|3904318_3905740_-	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
AYW31924.1|3905964_3907245_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
AYW31925.1|3907279_3909262_-	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
AYW31926.1|3909258_3910149_-	Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD	NA	NA	NA	NA	NA
AYW31927.1|3910148_3910946_-	iron(3+)-hydroxamate import ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
AYW31928.1|3910996_3913255_-	ferrichrome porin FhuA	NA	NA	NA	NA	NA
AYW31929.1|3913474_3916009_-	bifunctional glycosyl transferase/transpeptidase	NA	NA	NA	NA	NA
AYW31930.1|3916102_3918532_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	31.1	6.0e-41
AYW31931.1|3918605_3919136_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
AYW31932.1|3919150_3919855_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
AYW31933.1|3920032_3920488_+	RNA polymerase-binding transcription factor DksA	NA	NA	NA	NA	NA
AYW31934.1|3920524_3921451_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
AYW31935.1|3921489_3922908_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
AYW31936.1|3922904_3923384_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
AYW31937.1|3923754_3924339_+	fimbrial protein	NA	NA	NA	NA	NA
AYW31938.1|3924436_3925177_+	fimbrial chaperone	NA	NA	NA	NA	NA
AYW31939.1|3925211_3927812_+	outer membrane usher protein	NA	NA	NA	NA	NA
AYW31940.1|3927831_3928398_+	fimbrial protein	NA	NA	NA	NA	NA
AYW31941.1|3928412_3929018_+	fimbrial-like protein YadL	NA	NA	NA	NA	NA
AYW31942.1|3929044_3929641_+	fimbrial protein StaF	NA	NA	NA	NA	NA
AYW31943.1|3929694_3930966_+	fimbrial-like adhesin	NA	NA	NA	NA	NA
AYW31944.1|3931077_3931872_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
AYW31945.1|3931883_3932735_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
AYW31946.1|3932816_3933032_-|transposase	transposase	transposase	NA	NA	NA	NA
AYW31947.1|3933100_3934021_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	48.8	1.7e-60
AYW31948.1|3934294_3934675_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
AYW31949.1|3934678_3935908_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AYW31950.1|3935971_3936412_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
AYW31951.1|3936516_3937287_-	inner membrane transport permease YadH	NA	NA	NA	NA	NA
AYW31952.1|3937283_3938210_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
AYW31953.1|3938318_3938981_+	carbonate dehydratase	NA	NA	NA	NA	NA
AYW31954.1|3939021_3939558_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	8.7e-17
AYW31955.1|3939763_3942154_+	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
AYW31956.1|3942200_3943751_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
AYW31957.1|3943916_3944264_+	hypothetical protein	NA	NA	NA	NA	NA
AYW31958.1|3944369_3945236_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
AYW31959.1|3945251_3946046_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
AYW31960.1|3946083_3946446_-	UPF0231 family protein	NA	NA	NA	NA	NA
AYW31961.1|3946620_3949218_-	aconitate hydratase B	NA	NA	NA	NA	NA
AYW31962.1|3949572_3951330_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
AYW33465.1|3951400_3952825_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
AYW31963.1|3953032_3954925_-	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
AYW31964.1|3954939_3957603_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
AYW31965.1|3957763_3958528_-	pyruvate dehydrogenase complex repressor	NA	NA	NA	NA	NA
AYW31966.1|3958983_3959274_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYW31967.1|3959327_3959516_-	HNH endonuclease	NA	NA	NA	NA	NA
AYW31968.1|3959682_3959973_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYW31969.1|3959973_3960213_-	hypothetical protein	NA	NA	NA	NA	NA
AYW31970.1|3960380_3960665_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 11
CP033635	Escherichia coli isolate ECCNB12-2 chromosome, complete genome	5539489	4265639	4278278	5539489	integrase	Enterobacteria_phage(72.73%)	13	4258533:4258546	4269192:4269205
4258533:4258546	attL	GACCTGTTCAAACG	NA	NA	NA	NA
AYW32211.1|4265639_4265936_-|integrase	integrase	integrase	Q38404	Enterobacteria_phage	100.0	2.4e-24
AYW32212.1|4266179_4268513_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.0	0.0e+00
AYW32213.1|4268527_4268848_-	hypothetical protein	NA	NA	NA	NA	NA
AYW32214.1|4268983_4269439_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
4269192:4269205	attR	CGTTTGAACAGGTC	NA	NA	NA	NA
AYW32215.1|4269431_4269719_-	Derepression protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
AYW32216.1|4269711_4270302_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	96.3	1.3e-66
AYW32217.1|4270298_4270565_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	98.9	2.4e-44
AYW32218.1|4271117_4271852_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	99.2	9.4e-131
AYW32219.1|4271848_4272349_+	transactivation protein	NA	NA	NA	NA	NA
AYW32220.1|4272422_4272995_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	4.2e-94
AYW32221.1|4273368_4275501_+	MarR family transcriptional regulator	NA	Q64EU7	Vibrio_phage	72.6	2.6e-24
AYW32222.1|4275561_4276815_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	41.0	2.5e-75
AYW32223.1|4277258_4278278_+	aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	31.0	4.9e-45
>prophage 12
CP033635	Escherichia coli isolate ECCNB12-2 chromosome, complete genome	5539489	4792411	4847535	5539489	plate,lysis,holin,protease,transposase,tail,integrase,head,terminase,portal,capsid	Escherichia_phage(31.91%)	68	4809746:4809792	4844747:4844793
AYW32663.1|4792411_4792942_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
AYW32664.1|4792951_4794283_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
AYW32665.1|4794349_4795276_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
AYW32666.1|4795368_4795854_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
AYW33491.1|4795913_4796588_+	hypothetical protein	NA	NA	NA	NA	NA
AYW33492.1|4796710_4797337_+	hypothetical protein	NA	NA	NA	NA	NA
AYW32667.1|4797375_4797621_-	cell division protein ZapB	NA	NA	NA	NA	NA
AYW32668.1|4798045_4798891_+	glycerol facilitator	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
AYW32669.1|4798913_4800422_+	glycerol kinase	NA	NA	NA	NA	NA
AYW33493.1|4800556_4801567_+	fructose 1,6-bisphosphatase	NA	NA	NA	NA	NA
AYW32670.1|4801663_4802410_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
AYW32671.1|4802414_4802843_-	universal stress protein UspD	NA	NA	NA	NA	NA
AYW32672.1|4802869_4803169_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
AYW32673.1|4803380_4803821_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
AYW32674.1|4803921_4804521_+	DUF1454 family protein	NA	NA	NA	NA	NA
AYW32675.1|4804628_4805396_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
AYW32676.1|4805450_4806206_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
AYW32677.1|4806312_4807302_-	sulfate-binding protein	NA	NA	NA	NA	NA
AYW32678.1|4807621_4808584_-	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
AYW32679.1|4808764_4809667_-	cation-efflux pump FieF	NA	NA	NA	NA	NA
4809746:4809792	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
AYW32680.1|4809975_4811304_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
AYW33494.1|4811342_4811597_-	DNA-binding transcriptional regulator	NA	M1SNR2	Escherichia_phage	100.0	1.3e-44
AYW32681.1|4811642_4812806_-	phage late control D family protein	NA	M1SV93	Escherichia_phage	98.2	2.9e-203
AYW32682.1|4812805_4813285_-|tail	phage tail protein	tail	O64315	Escherichia_phage	98.7	7.3e-84
AYW32683.1|4813299_4815747_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	95.0	0.0e+00
AYW33495.1|4815739_4815859_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AYW32684.1|4815891_4816167_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
AYW32685.1|4816223_4816742_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AYW32686.1|4816754_4817945_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.4e-224
AYW32687.1|4818264_4819164_-	hypothetical protein	NA	Q7Y4D2	Escherichia_virus	99.7	4.0e-168
AYW32688.1|4819379_4819907_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	88.6	5.1e-86
AYW32689.1|4819908_4821930_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	64.5	3.5e-260
AYW32690.1|4821940_4822471_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
AYW32691.1|4822463_4823372_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.0	6.3e-161
AYW32692.1|4823376_4823724_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
AYW32693.1|4823720_4824356_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	2.6e-113
AYW32694.1|4824439_4825225_+	hypothetical protein	NA	NA	NA	NA	NA
AYW32695.1|4825296_4825749_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	2.4e-76
AYW32696.1|4825741_4826209_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	1.9e-81
AYW32697.1|4826171_4826345_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
AYW32698.1|4826316_4826742_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	98.6	5.5e-67
AYW32699.1|4826729_4827155_-	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	93.6	1.4e-57
AYW32700.1|4827169_4827667_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	98.8	1.7e-91
AYW32701.1|4827666_4827948_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	98.9	3.7e-43
AYW32702.1|4827951_4828155_-|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	98.5	8.8e-31
AYW32703.1|4828154_4828664_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
AYW32704.1|4828763_4829507_-|terminase	terminase	terminase	Q94MG8	Enterobacteria_phage	100.0	2.8e-122
AYW32705.1|4829510_4830584_-|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	99.4	2.5e-201
AYW32706.1|4830642_4831497_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	100.0	1.3e-139
AYW32707.1|4831670_4833443_+	oxidoreductase	NA	A0A0F7LCM8	Escherichia_phage	99.8	0.0e+00
AYW32708.1|4833442_4834477_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.7	4.2e-201
AYW33496.1|4834892_4835966_+	hypothetical protein	NA	Q7Y4B3	Escherichia_virus	100.0	1.2e-203
AYW32709.1|4835958_4836996_+	hypothetical protein	NA	Q7Y4B4	Escherichia_virus	100.0	4.6e-200
AYW32710.1|4836992_4837931_-	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	100.0	3.1e-187
AYW32711.1|4838173_4838380_-	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	97.0	2.4e-31
AYW32712.1|4838379_4838832_-	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	96.7	1.0e-79
AYW32713.1|4838831_4841117_-	replication endonuclease	NA	Q858T4	Yersinia_virus	97.4	0.0e+00
AYW32714.1|4841106_4841382_-	hypothetical protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
AYW32715.1|4841378_4841603_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
AYW32716.1|4841602_4841905_-	hypothetical protein	NA	U5N0U2	Enterobacteria_phage	98.0	5.0e-46
AYW32717.1|4841904_4842129_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AYW32718.1|4842192_4842693_-	replication protein B	NA	S4TTB7	Salmonella_phage	99.4	1.7e-91
AYW32719.1|4842862_4843135_-	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
AYW32720.1|4843287_4843581_+	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
AYW32721.1|4843650_4844631_+|integrase	integrase	integrase	U5N0A8	Enterobacteria_phage	99.7	2.3e-185
AYW33497.1|4844816_4845317_-	periplasmic protein CpxP	NA	NA	NA	NA	NA
4844747:4844793	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
AYW32722.1|4845466_4846165_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
AYW32723.1|4846161_4847535_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
>prophage 13
CP033635	Escherichia coli isolate ECCNB12-2 chromosome, complete genome	5539489	5179354	5214876	5539489	transposase	Enterobacteria_phage(30.77%)	30	NA	NA
AYW32997.1|5179354_5180563_-|transposase	IS256-like element IS1414 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	7.4e-48
AYW32998.1|5182217_5182331_+	hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	68.6	8.4e-07
AYW32999.1|5183182_5184850_+	immunoglobulin-binding protein	NA	Q9MCI8	Enterobacteria_phage	76.1	6.9e-20
AYW33000.1|5184911_5185367_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AYW33001.1|5185654_5186860_-|transposase	IS256-like element IS1414 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	9.6e-48
AYW33002.1|5187031_5187805_-	YaiO family outer membrane beta-barrel protein	NA	NA	NA	NA	NA
AYW33514.1|5187806_5188388_-	acetyltransferase	NA	NA	NA	NA	NA
AYW33003.1|5188365_5189562_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
AYW33004.1|5189575_5190229_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
AYW33005.1|5191161_5191671_+	TRAP transporter small permease	NA	NA	NA	NA	NA
AYW33006.1|5191670_5192972_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
AYW33007.1|5193110_5194339_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.0	3.8e-169
AYW33515.1|5195236_5195461_+	hypothetical protein	NA	NA	NA	NA	NA
AYW33008.1|5195589_5196114_-	superoxide dismutase	NA	Q9MC02	Salmonella_phage	62.4	3.0e-62
AYW33009.1|5196209_5197286_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
AYW33010.1|5197307_5198144_-	ABC transporter permease	NA	NA	NA	NA	NA
AYW33011.1|5198188_5199055_-	ABC transporter permease	NA	NA	NA	NA	NA
AYW33012.1|5199051_5200119_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.8	1.4e-26
AYW33013.1|5200334_5201165_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
AYW33014.1|5201180_5202293_+	sugar kinase	NA	NA	NA	NA	NA
AYW33516.1|5202387_5202567_+	hypothetical protein	NA	NA	NA	NA	NA
AYW33015.1|5202567_5202741_+	hypothetical protein	NA	NA	NA	NA	NA
AYW33016.1|5203791_5205351_+	AbgT family transporter	NA	NA	NA	NA	NA
AYW33017.1|5205662_5209487_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	32.8	2.6e-171
AYW33018.1|5209624_5210833_-|transposase	IS256-like element IS1414 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	7.4e-48
AYW33019.1|5211242_5212856_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.4	1.2e-181
AYW33020.1|5212886_5213237_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
AYW33021.1|5213233_5213659_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
AYW33022.1|5213740_5213878_-|transposase	transposase	transposase	NA	NA	NA	NA
AYW33023.1|5214162_5214876_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	39.7	6.8e-17
>prophage 1
CP033632	Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence	147451	2467	129077	147451	terminase,tail,integrase,transposase,plate	Escherichia_phage(63.83%)	135	9442:9472	133211:133241
AYW28043.1|2467_3586_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.7	1.5e-71
AYW28044.1|3557_4394_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
AYW28045.1|4393_5197_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AYW28046.1|5257_6073_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
AYW28047.1|6380_7232_-	replication protein	NA	NA	NA	NA	NA
AYW28048.1|7987_8692_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
9442:9472	attL	CTTAGCGTACGATTTTTTCCGAATTCTGCGG	NA	NA	NA	NA
AYW28189.1|9835_10300_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AYW28049.1|11518_11767_-	modulator protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
AYW28050.1|11763_12204_-	peptide-binding protein	NA	Q71TR9	Escherichia_phage	99.3	3.8e-79
AYW28190.1|12237_16176_-	helicase	NA	Q1MVN7	Enterobacteria_phage	98.0	0.0e+00
AYW28051.1|16404_16536_-	replication protein RepA4	NA	NA	NA	NA	NA
AYW28052.1|16788_17040_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AYW28053.1|17036_17324_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	49.5	5.8e-20
AYW28054.1|18634_22150_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	36.1	2.7e-98
AYW28055.1|22595_23576_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
AYW28056.1|23633_23870_+	hypothetical protein	NA	NA	NA	NA	NA
AYW28057.1|24720_25206_+	plasmid transfer protein	NA	NA	NA	NA	NA
AYW28058.1|27504_27846_+	hypothetical protein	NA	NA	NA	NA	NA
AYW28059.1|28250_29123_+	hypothetical protein	NA	NA	NA	NA	NA
AYW28060.1|29175_30338_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
AYW28061.1|31349_32063_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	36.4	4.1e-14
AYW28062.1|32095_33331_-	MFS transporter	NA	NA	NA	NA	NA
AYW28063.1|33343_34168_-	carbon-phosphorus lyase	NA	A0A0E3D9J5	Bacillus_phage	26.7	6.9e-05
AYW28064.1|34501_36676_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
AYW28065.1|39376_39532_+	type I toxin-antitoxin system Hok family toxin	NA	A0A1I9LJU7	Stx_converting_phage	88.2	1.2e-14
AYW28066.1|39725_40838_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
AYW28067.1|40997_41507_-|plate	baseplate protein	plate	Q1MVJ9	Enterobacteria_phage	99.4	6.6e-91
AYW28068.1|41518_42100_-	hypothetical protein	NA	Q71TM4	Escherichia_phage	99.0	8.6e-103
AYW28069.1|42135_42951_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	98.5	2.4e-111
AYW28070.1|42960_44550_-	hypothetical protein	NA	A0A1B0V7E4	Salmonella_phage	97.9	2.4e-301
AYW28071.1|44609_46316_-	hypothetical protein	NA	Q71TM1	Escherichia_phage	99.6	0.0e+00
AYW28072.1|46541_47543_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
AYW28073.1|47559_48756_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
AYW28074.1|48924_49734_-	GIY-YIG nuclease family protein	NA	A0A077SK46	Escherichia_phage	97.8	7.1e-156
AYW28075.1|50026_50911_-	RepB family plasmid replication initiator protein	NA	A0A077SLP3	Escherichia_phage	100.0	2.1e-161
AYW28076.1|51246_51639_-	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	98.5	2.6e-71
AYW28191.1|51816_52053_-	ppfA	NA	Q71TL5	Escherichia_phage	100.0	9.0e-27
AYW28077.1|52195_53395_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AYW28078.1|53404_53593_-	hypothetical protein	NA	NA	NA	NA	NA
AYW28079.1|55347_55590_+	hypothetical protein	NA	NA	NA	NA	NA
AYW28192.1|56213_56405_-	hypothetical protein	NA	Q71T98	Escherichia_phage	98.4	3.9e-28
AYW28080.1|56597_56834_+	hypothetical protein	NA	A0A0A7NQ74	Enterobacteria_phage	50.0	2.1e-07
AYW28081.1|56814_57642_+	SPFH/Band 7/PHB domain protein	NA	A0A077SLJ6	Escherichia_phage	100.0	1.6e-131
AYW28082.1|57825_58041_-	hypothetical protein	NA	NA	NA	NA	NA
AYW28083.1|58031_59396_+	replicative DNA helicase	NA	O80281	Escherichia_phage	99.8	1.6e-253
AYW28084.1|59395_60394_+	hypothetical protein	NA	Q71TK3	Escherichia_phage	97.9	9.0e-193
AYW28085.1|60440_61073_-|plate	baseplate protein	plate	Q71TK2	Escherichia_phage	100.0	6.9e-90
AYW28086.1|61065_62082_-|tail	phage tail tape measure protein	tail	A0A1B0V7N3	Salmonella_phage	100.0	4.5e-192
AYW28087.1|62083_62869_-|plate	baseplate	plate	A0A1B0V7N6	Salmonella_phage	100.0	7.2e-145
AYW28088.1|62855_63584_-|tail	phage tail protein	tail	Q71TJ9	Escherichia_phage	100.0	4.2e-139
AYW28089.1|63587_64805_-|tail	phage tail protein	tail	A0A1B0VAL1	Salmonella_phage	100.0	6.4e-225
AYW28090.1|64814_65192_-	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
AYW28091.1|65338_65584_+	hypothetical protein	NA	A0A1B0VDU5	Salmonella_phage	100.0	1.5e-40
AYW28092.1|65586_66165_+	VRR-NUC domain-containing protein	NA	A0A077SLK0	Escherichia_phage	99.0	1.3e-106
AYW28093.1|66231_66387_+	norphogenetic protein	NA	A0A077SK20	Escherichia_phage	100.0	1.2e-19
AYW28094.1|66328_66991_+	norphogenetic protein	NA	A0A077SL54	Escherichia_phage	100.0	4.5e-124
AYW28095.1|66888_67515_+	norphogenetic protein	NA	A0A077SK52	Escherichia_phage	99.5	2.3e-122
AYW28096.1|67511_68189_+	serine/threonine protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	100.0	7.6e-135
AYW28097.1|68185_68887_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	100.0	7.1e-144
AYW28098.1|68968_69187_+	hypothetical protein	NA	Q71TI9	Escherichia_phage	100.0	3.4e-36
AYW28099.1|69188_70451_+	hypothetical protein	NA	Q1MVG4	Enterobacteria_phage	99.8	2.7e-234
AYW28100.1|70523_71030_+	3'-phosphatase	NA	A0A1B0VAK0	Salmonella_phage	99.4	1.4e-93
AYW28101.1|71224_71806_+	hypothetical protein	NA	A0A077SLQ8	Escherichia_phage	99.0	5.0e-111
AYW28102.1|71798_72059_+	hypothetical protein	NA	Q1MVG1	Enterobacteria_phage	100.0	5.2e-44
AYW28103.1|72051_72696_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	100.0	5.2e-133
AYW28104.1|72692_73202_+	ead/Ea22-like family protein	NA	K7P881	Enterobacteria_phage	56.3	5.0e-30
AYW28105.1|73147_73852_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYW28106.1|73888_75016_-	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
AYW28107.1|75066_75312_-	hypothetical protein	NA	NA	NA	NA	NA
AYW28108.1|75317_75509_+	hypothetical protein	NA	NA	NA	NA	NA
AYW28109.1|75990_76533_-	tunicamycin resistance protein	NA	NA	NA	NA	NA
AYW28110.1|76545_77406_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
AYW28111.1|78502_79207_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AYW28112.1|79253_80501_-	MFS transporter	NA	NA	NA	NA	NA
AYW28113.1|80497_81403_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
AYW28114.1|81524_82229_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYW28193.1|82264_82519_+	recombinase family protein	NA	NA	NA	NA	NA
AYW28115.1|82634_82814_-	hypothetical protein	NA	NA	NA	NA	NA
AYW28116.1|84385_85090_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AYW28117.1|85157_85742_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYW28118.1|85687_86044_+	hypothetical protein	NA	NA	NA	NA	NA
AYW28119.1|86234_86999_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AYW28120.1|86985_87249_+	hypothetical protein	NA	NA	NA	NA	NA
AYW28121.1|87139_87844_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AYW28122.1|88950_89202_+	plasmid stabilization protein	NA	NA	NA	NA	NA
AYW28123.1|89191_89473_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	62.4	2.9e-24
AYW28194.1|89711_89900_-	hypothetical protein	NA	A0A077SL39	Escherichia_phage	96.7	8.8e-09
AYW28124.1|89969_91169_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AYW28125.1|91178_91367_-	hypothetical protein	NA	NA	NA	NA	NA
AYW28126.1|92945_93740_+	aminoglycoside O-phosphotransferase APH(3')-IIa	NA	Q75ZG1	Hepacivirus	100.0	9.5e-153
AYW28127.1|94046_94751_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYW28128.1|94852_95332_+	transcriptional regulator	NA	NA	NA	NA	NA
AYW28129.1|95401_98554_-	multidrug efflux RND transporter permease subunit OqxB	NA	NA	NA	NA	NA
AYW28130.1|98577_99753_-	multidrug efflux RND transporter periplasmic adaptor subunit OqxA	NA	NA	NA	NA	NA
AYW28131.1|100072_100777_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AYW28132.1|102534_103161_+	hypothetical protein	NA	NA	NA	NA	NA
AYW28133.1|103665_104541_+	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
AYW28134.1|104620_105544_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
AYW28135.1|107294_107999_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYW28136.1|108384_108801_+	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
AYW28137.1|108805_109324_-	hypothetical protein	NA	NA	NA	NA	NA
AYW28138.1|109323_110112_-	winged helix family transcriptional regulator	NA	NA	NA	NA	NA
AYW28139.1|110611_111316_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYW28195.1|111306_111474_+	replication initiator protein	NA	NA	NA	NA	NA
AYW28140.1|111847_112138_+	DUF4752 family protein	NA	A0A2I6TCB0	Escherichia_phage	82.3	1.2e-36
AYW28141.1|112134_112869_+	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	55.2	1.7e-39
AYW28142.1|112865_113384_+	ead/Ea22-like family protein	NA	A0A077SLK5	Escherichia_phage	74.2	2.0e-79
AYW28143.1|113729_113918_+	hypothetical protein	NA	A0A1I9LJM4	Stx_converting_phage	98.4	1.4e-30
AYW28144.1|114091_114355_+	hypothetical protein	NA	NA	NA	NA	NA
AYW28145.1|114431_115289_+	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	99.6	1.1e-170
AYW28146.1|115285_115546_+	eaa protein	NA	A0A077SLR0	Escherichia_phage	98.8	1.9e-41
AYW28147.1|115545_115827_+	ASCH domain-containing protein	NA	A0A077SLL0	Escherichia_phage	100.0	3.4e-49
AYW28148.1|115850_116144_+	hypothetical protein	NA	A0A077SK23	Escherichia_phage	99.0	4.2e-50
AYW28149.1|116150_116525_+	hypothetical protein	NA	A0A077SL57	Escherichia_phage	100.0	1.2e-68
AYW28150.1|116506_117181_+	hypothetical protein	NA	A0A077SK55	Escherichia_phage	98.1	5.1e-115
AYW28151.1|117177_117540_+	hypothetical protein	NA	A0A1B0VBR1	Salmonella_phage	100.0	9.8e-57
AYW28152.1|118004_118244_-	hypothetical protein	NA	NA	NA	NA	NA
AYW28153.1|118615_118972_-	hypothetical protein	NA	A0A1B0VCG1	Salmonella_phage	100.0	2.4e-63
AYW28154.1|118972_119557_-	DNA-binding protein	NA	A0A1B0V861	Salmonella_phage	99.5	1.1e-110
AYW28155.1|119731_120121_+	DNA repair protein	NA	A0A077SK24	Escherichia_phage	97.7	3.2e-69
AYW28156.1|120193_120415_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
AYW28157.1|120414_120795_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	100.0	1.9e-63
AYW28158.1|120799_120979_+	PdcA protein	NA	Q71TH5	Escherichia_phage	100.0	7.1e-24
AYW28159.1|121006_122050_+	DUF968 domain-containing protein	NA	Q1MVE3	Enterobacteria_phage	99.7	1.8e-207
AYW28160.1|122138_122591_+	Late promoter-activating protein	NA	Q71T63	Escherichia_phage	100.0	3.0e-79
AYW28161.1|122676_123870_+|terminase	terminase	terminase	Q5QBP3	Enterobacteria_phage	88.7	7.2e-181
AYW28162.1|123869_125354_+|terminase	terminase	terminase	Q71T61	Escherichia_phage	100.0	1.5e-292
AYW28163.1|125378_126230_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	6.1e-158
AYW28164.1|126340_126550_-	c1 repressor inactivator	NA	Q5XLQ8	Enterobacteria_phage	100.0	4.8e-32
AYW28165.1|126515_126611_-	peptidase	NA	Q38402	Escherichia_phage	100.0	2.8e-11
AYW28166.1|126629_126743_-	peptidase	NA	Q5XLQ7	Enterobacteria_phage	100.0	3.2e-14
AYW28167.1|127154_127376_+	creatininase	NA	Q38403	Escherichia_phage	100.0	2.6e-36
AYW28168.1|127383_128415_+|integrase	site-specific integrase	integrase	Q71TG5	Escherichia_phage	99.7	2.2e-194
AYW28169.1|128465_128777_+	lysogeny establishment protein	NA	Q71TG4	Escherichia_phage	96.1	8.8e-46
AYW28170.1|128969_129077_-	hypothetical protein	NA	A0A1B0V7H9	Salmonella_phage	73.5	1.5e-05
133211:133241	attR	CCGCAGAATTCGGAAAAAATCGTACGCTAAG	NA	NA	NA	NA
>prophage 1
CP033633	Escherichia coli isolate ECCNB12-2 plasmid pTB-nb2, complete sequence	139752	31421	71709	139752	tail,transposase,integrase	Enterobacteria_phage(25.0%)	43	22099:22114	42754:42769
22099:22114	attL	CCGGTGGTGATGGTGG	NA	NA	NA	NA
AYW28233.1|31421_32591_-|integrase	site-specific integrase	integrase	B5WZU7	Pseudomonas_phage	44.0	1.1e-48
AYW28339.1|32687_32879_+	pilus assembly protein PilV	NA	NA	NA	NA	NA
AYW28234.1|32875_33127_-	shufflon protein C	NA	NA	NA	NA	NA
AYW28235.1|33161_33539_+|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	43.4	6.7e-24
AYW28236.1|33543_34878_-	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
AYW28340.1|34874_35525_-	prepilin peptidase	NA	NA	NA	NA	NA
AYW28237.1|35541_36018_-	lytic transglycosylase	NA	A0A0A8J856	Ralstonia_phage	37.0	1.3e-08
AYW28238.1|36076_36613_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
AYW28239.1|36662_37763_-	type II secretion protein F	NA	NA	NA	NA	NA
AYW28240.1|37764_39273_-	type II secretion protein E	NA	NA	NA	NA	NA
AYW28241.1|39369_39966_-	hypothetical protein	NA	NA	NA	NA	NA
AYW28242.1|40664_41117_-	type IV pilus biogenesis protein PilP	NA	NA	NA	NA	NA
AYW28243.1|41106_42402_-	pilus assembly protein	NA	NA	NA	NA	NA
AYW28244.1|42422_44042_-	PilN family type IVB pilus formation outer membrane protein	NA	NA	NA	NA	NA
42754:42769	attR	CCGGTGGTGATGGTGG	NA	NA	NA	NA
AYW28245.1|44072_44510_-	pilM	NA	NA	NA	NA	NA
AYW28246.1|44514_45585_-	pilus assembly protein	NA	NA	NA	NA	NA
AYW28247.1|45706_46102_+	hypothetical protein	NA	NA	NA	NA	NA
AYW28248.1|46102_46534_-	hypothetical protein	NA	NA	NA	NA	NA
AYW28249.1|46606_46924_-	pilus assembly protein PilI	NA	NA	NA	NA	NA
AYW28250.1|46929_48624_-	flotillin family protein	NA	NA	NA	NA	NA
AYW28251.1|48650_49271_-	DUF1449 family protein	NA	NA	NA	NA	NA
AYW28252.1|49424_49574_-	conjugal transfer protein TraC	NA	NA	NA	NA	NA
AYW28253.1|49537_50203_-	traC	NA	NA	NA	NA	NA
AYW28254.1|50343_50985_-	transcription termination factor NusG	NA	NA	NA	NA	NA
AYW28255.1|51608_51698_+	positive regulator for repZ translation	NA	NA	NA	NA	NA
AYW28341.1|51694_52558_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AYW28342.1|52607_52880_+	hypothetical protein	NA	NA	NA	NA	NA
AYW28256.1|53120_53309_-	hypothetical protein	NA	NA	NA	NA	NA
AYW28257.1|53504_53756_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
AYW28258.1|53752_54040_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	48.4	3.8e-19
AYW28259.1|54333_54594_+	hypothetical protein	NA	NA	NA	NA	NA
AYW28260.1|54966_55203_+	hypothetical protein	NA	NA	NA	NA	NA
AYW28343.1|55497_55944_+	serine acetyltransferase	NA	NA	NA	NA	NA
AYW28261.1|56223_56817_-	proQ/FINO family protein	NA	NA	NA	NA	NA
AYW28262.1|57161_57398_+	hypothetical protein	NA	NA	NA	NA	NA
AYW28263.1|58858_59224_-|transposase	transposase	transposase	NA	NA	NA	NA
AYW28264.1|59633_60197_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
AYW28265.1|60397_61606_-|transposase	IS256-like element IS1414 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	7.4e-48
AYW28266.1|61664_61940_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AYW28267.1|62029_62764_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYW28268.1|63173_64707_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.2	2.6e-42
AYW28269.1|65600_69098_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	34.6	1.0e-97
AYW28270.1|70495_71709_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	95.9	2.0e-162
>prophage 2
CP033633	Escherichia coli isolate ECCNB12-2 plasmid pTB-nb2, complete sequence	139752	90955	130608	139752	transposase,integrase	Escherichia_phage(28.57%)	48	88007:88025	135303:135321
88007:88025	attL	AGGGCGTGGAGGATGTCAA	NA	NA	NA	NA
AYW28288.1|90955_92168_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	95.9	2.0e-162
AYW28289.1|92559_93012_+	N-acetyltransferase	NA	NA	NA	NA	NA
AYW28290.1|93043_93229_-	hypothetical protein	NA	NA	NA	NA	NA
AYW28345.1|94109_94388_-	hypothetical protein	NA	NA	NA	NA	NA
AYW28291.1|94389_94608_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
AYW28292.1|94609_94915_+	toxin CcdB	NA	NA	NA	NA	NA
AYW28293.1|94915_95725_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	98.2	7.1e-55
AYW28346.1|97631_98129_+|integrase	integrase	integrase	I3WFA4	Macacine_betaherpesvirus	94.6	4.1e-53
AYW28294.1|98265_98541_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
AYW28295.1|98534_99179_-	chromosome partitioning protein ParA	NA	A0A222YXS3	Escherichia_phage	43.5	8.8e-40
AYW28296.1|99407_100379_+	plasmid segregation protein parM	NA	A0A222YXF2	Escherichia_phage	42.9	1.3e-66
AYW28297.1|100383_100776_+	plasmid stability protein	NA	NA	NA	NA	NA
AYW28298.1|100780_102052_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	60.5	1.4e-142
AYW28299.1|102051_102489_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
AYW28300.1|102485_102734_-	protein ImpC	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
AYW28301.1|102844_103114_+	hypothetical protein	NA	NA	NA	NA	NA
AYW28348.1|103151_104054_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
AYW28302.1|104057_104246_+	hypothetical protein	NA	NA	NA	NA	NA
AYW28303.1|104250_104487_+	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
AYW28347.1|104582_104885_+	antirestriction protein	NA	NA	NA	NA	NA
AYW28304.1|104931_105351_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
AYW28305.1|105350_105542_+	hypothetical protein	NA	NA	NA	NA	NA
AYW28306.1|106108_106315_+	hypothetical protein	NA	NA	NA	NA	NA
AYW28307.1|106311_106839_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	9.3e-48
AYW28308.1|106896_107130_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AYW28309.1|109205_109640_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
AYW28310.1|109636_110356_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
AYW28311.1|110352_110949_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	53.9	3.4e-14
AYW28312.1|111414_111915_+	antirestriction protein ArdA	NA	NA	NA	NA	NA
AYW28313.1|112646_113081_+	post-segregation killing protein PndC	NA	NA	NA	NA	NA
AYW28314.1|113173_113440_+	hypothetical protein	NA	NA	NA	NA	NA
AYW28315.1|113504_114467_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.0	3.7e-66
AYW28316.1|114761_114992_+	hypothetical protein	NA	NA	NA	NA	NA
AYW28317.1|115022_115274_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYW28318.1|115514_115730_+	hypothetical protein	NA	NA	NA	NA	NA
AYW28319.1|115854_116703_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AYW28320.1|116788_117124_-	molybdopterin-guanine dinucleotide biosynthesis protein MobC	NA	NA	NA	NA	NA
AYW28321.1|117356_117689_+	nikA protein	NA	NA	NA	NA	NA
AYW28349.1|117817_120403_+	relaxase NikB	NA	NA	NA	NA	NA
AYW28322.1|120471_120720_+	transcriptional regulator	NA	NA	NA	NA	NA
AYW28323.1|120719_121064_+	MazF family transcriptional regulator	NA	NA	NA	NA	NA
AYW28324.1|122086_122458_-	hypothetical protein	NA	NA	NA	NA	NA
AYW28350.1|122766_124275_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
AYW28325.1|124803_125016_+	hypothetical protein	NA	NA	NA	NA	NA
AYW28326.1|126212_127235_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	2.3e-199
AYW28327.1|127248_127332_-	glutathione S-transferase	NA	NA	NA	NA	NA
AYW28328.1|128472_128766_-	hypothetical protein	NA	NA	NA	NA	NA
AYW28329.1|129335_130608_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.3	1.1e-171
135303:135321	attR	TTGACATCCTCCACGCCCT	NA	NA	NA	NA
>prophage 1
CP033634	Escherichia coli isolate ECCNB12-2 plasmid pTB-nb3, complete sequence	82252	15899	38395	82252	transposase	Salmonella_phage(20.0%)	19	NA	NA
AYW28366.1|15899_18866_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
AYW28367.1|18951_19656_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYW28368.1|19921_20626_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYW28438.1|20650_22228_+	PAS domain S-box protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.1e-83
AYW28369.1|22218_23427_-|transposase	IS256-like element IS1414 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	7.4e-48
AYW28439.1|24153_24558_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYW28370.1|24874_25804_-	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
AYW28371.1|25800_27198_-	PTS N-acetyl-D-glucosamine transporter	NA	A0A2I7SAJ6	Vibrio_phage	48.6	1.0e-08
AYW28372.1|27431_28181_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYW28440.1|28718_28898_-	Par-like protein	NA	NA	NA	NA	NA
AYW28373.1|29017_29644_-	cobyrinic acid ac-diamide synthase	NA	E5FFJ3	Burkholderia_phage	31.1	2.0e-17
AYW28374.1|31434_32523_-	hypothetical protein	NA	NA	NA	NA	NA
AYW28375.1|32958_34059_+	hypothetical protein	NA	NA	NA	NA	NA
AYW28376.1|34575_35848_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	8.8e-177
AYW28377.1|36055_36493_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	48.4	1.1e-25
AYW28378.1|36489_36738_-	protein ImpC	NA	Q2A098	Sodalis_phage	48.0	1.4e-14
AYW28379.1|36848_37049_+	hypothetical protein	NA	NA	NA	NA	NA
AYW28441.1|37038_37281_+	hypothetical protein	NA	NA	NA	NA	NA
AYW28380.1|37378_38395_+|transposase	IS110-like element ISShdy1 family transposase	transposase	NA	NA	NA	NA
>prophage 1
CP033636	Escherichia coli isolate ECCNB12-2 plasmid pTB-nb4, complete sequence	253793	63932	158270	253793	integrase,transposase	Escherichia_phage(35.29%)	92	78712:78771	111629:112450
AYW33592.1|63932_65145_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.3	1.6e-167
AYW33593.1|65202_69156_+	conjugal transfer protein TraG	NA	NA	NA	NA	NA
AYW33594.1|69336_70626_+	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	32.9	5.5e-09
AYW33595.1|70733_71300_-	hypothetical protein	NA	NA	NA	NA	NA
AYW33596.1|71382_71922_-	lytic transglycosylase	NA	NA	NA	NA	NA
AYW33597.1|72069_72819_+	thiol:disulfide interchange protein	NA	NA	NA	NA	NA
AYW33598.1|72843_73236_+	hypothetical protein	NA	NA	NA	NA	NA
AYW33599.1|73269_73692_+	hypothetical protein	NA	NA	NA	NA	NA
AYW33600.1|73751_74363_-	hypothetical protein	NA	NA	NA	NA	NA
AYW33601.1|74469_75279_+	DsbA family protein	NA	NA	NA	NA	NA
AYW33602.1|75324_76584_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	44.3	2.6e-96
AYW33603.1|76567_77002_-	peptidase	NA	F1C5A6	Cronobacter_phage	48.8	2.5e-22
AYW33604.1|77195_77813_+	hypothetical protein	NA	NA	NA	NA	NA
AYW33605.1|77962_78319_+	hypothetical protein	NA	NA	NA	NA	NA
78712:78771	attL	GTGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGC	NA	NA	NA	NA
AYW33606.1|78776_79481_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AYW33607.1|79371_79689_-	hypothetical protein	NA	M9Q1K0	Clostridium_phage	54.0	6.3e-07
AYW33766.1|79814_80165_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AYW33608.1|80367_81381_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYW33767.1|81547_82390_+	alpha/beta fold putative hydrolase EstX	NA	NA	NA	NA	NA
AYW33609.1|82485_83094_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
AYW33610.1|83151_83943_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
AYW33611.1|84204_85464_+	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
AYW33612.1|85556_86348_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AYW33613.1|86517_86850_+	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
AYW33614.1|86989_87175_+	hypothetical protein	NA	NA	NA	NA	NA
AYW33615.1|88029_88821_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
AYW33616.1|89289_89535_-	hypothetical protein	NA	NA	NA	NA	NA
AYW33617.1|89572_90436_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
AYW33768.1|90581_90821_-	macrolide transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	46.2	9.5e-08
AYW33618.1|90893_91598_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AYW33769.1|91622_92435_+	AAC(3)-VI family aminoglycoside N-acetyltransferase	NA	NA	NA	NA	NA
AYW33619.1|92455_92677_+	hypothetical protein	NA	NA	NA	NA	NA
AYW33620.1|92663_93689_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
AYW33621.1|94110_94863_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
AYW33622.1|96517_97393_+	acyl-CoA--6-aminopenicillanic acid acyl-transferase	NA	NA	NA	NA	NA
AYW33623.1|97546_98362_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.2	4.8e-160
AYW33624.1|98697_99534_-	APH(6)-I family aminoglycoside O-phosphotransferase	NA	NA	NA	NA	NA
AYW33770.1|99533_100337_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
AYW33625.1|101360_101552_-	hypothetical protein	NA	NA	NA	NA	NA
AYW33626.1|102172_102877_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYW33627.1|103029_103851_-	lincosamide nucleotidyltransferase Lnu(F)	NA	NA	NA	NA	NA
AYW33771.1|103982_104774_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA22	NA	NA	NA	NA	NA
AYW33628.1|104922_105882_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.5	1.7e-47
AYW33629.1|105772_106477_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYW33630.1|106829_107138_+	hypothetical protein	NA	NA	NA	NA	NA
AYW33631.1|107028_107733_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AYW33632.1|107791_108193_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	99.2	1.4e-64
AYW33633.1|108375_109236_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AYW33634.1|110043_110367_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AYW33635.1|110472_111606_+	permease	NA	NA	NA	NA	NA
AYW33636.1|111693_112398_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
AYW33637.1|113133_116121_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.5	1.7e-295
111629:112450	attR	GTGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCACGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCAACGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
AYW33638.1|117408_118227_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AYW33639.1|118223_119429_+	ATP/GTP-binding protein	NA	NA	NA	NA	NA
AYW33640.1|119492_119696_-	hypothetical protein	NA	NA	NA	NA	NA
AYW33641.1|119708_121028_-	DUF1173 family protein	NA	NA	NA	NA	NA
AYW33642.1|121278_122706_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
AYW33643.1|122920_123436_+	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
AYW33644.1|123438_124335_+	hypothetical protein	NA	NA	NA	NA	NA
AYW33772.1|124556_124790_+	hypothetical protein	NA	NA	NA	NA	NA
AYW33645.1|124835_125090_+	hypothetical protein	NA	NA	NA	NA	NA
AYW33646.1|125127_125415_+	hypothetical protein	NA	NA	NA	NA	NA
AYW33647.1|125451_125682_+	hypothetical protein	NA	NA	NA	NA	NA
AYW33648.1|126018_126480_+	hypothetical protein	NA	NA	NA	NA	NA
AYW33649.1|126509_126917_+	hypothetical protein	NA	NA	NA	NA	NA
AYW33773.1|126967_127285_-	hypothetical protein	NA	NA	NA	NA	NA
AYW33774.1|127661_128012_-	hypothetical protein	NA	NA	NA	NA	NA
AYW33775.1|129876_130269_+	cysteine hydrolase	NA	NA	NA	NA	NA
AYW33650.1|130406_131291_+	EamA family transporter	NA	NA	NA	NA	NA
AYW33651.1|131322_132522_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
AYW33652.1|132600_133278_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AYW33776.1|133309_133552_-	relaxase	NA	NA	NA	NA	NA
AYW33653.1|133669_134260_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
AYW33654.1|134396_134969_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
AYW33655.1|135005_136397_+|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
AYW33656.1|137176_137833_-	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
AYW33657.1|138910_139615_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	5.3e-139
AYW33658.1|140845_141298_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-2	NA	NA	NA	NA	NA
AYW33659.1|141618_142878_+	chloramphenicol efflux MFS transporter CmlA5	NA	S4TR35	Salmonella_phage	31.7	1.7e-26
AYW33660.1|143142_143943_+	oxacillin-hydrolyzing class D beta-lactamase OXA-10	NA	NA	NA	NA	NA
AYW33777.1|143959_144751_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AYW33661.1|144825_145299_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
AYW33662.1|145545_146250_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYW33663.1|148036_148342_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYW33664.1|148369_149584_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.3	8.0e-18
AYW33665.1|149800_150685_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
AYW33666.1|151609_152314_+|transposase	IS6 family transposase IS1006	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
AYW33667.1|152398_152788_-	hypothetical protein	NA	NA	NA	NA	NA
AYW33668.1|153052_154057_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
AYW33669.1|154135_157087_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
AYW33778.1|157089_157530_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	3.2e-49
AYW33670.1|157565_158270_+|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
