The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033625	Klebsiella pneumoniae strain 4743 chromosome, complete genome	5394691	1141947	1208963	5394691	tail,integrase,lysis,plate,head,holin,tRNA,capsid,portal	Salmonella_phage(80.43%)	77	1140790:1140827	1197598:1197635
1140790:1140827	attL	GCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AYW23561.1|1141947_1142988_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	92.7	1.7e-189
AYW23562.1|1142991_1143624_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	57.1	3.8e-64
AYW23563.1|1143740_1143983_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
AYW23564.1|1144015_1144525_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	94.7	3.9e-83
AYW27403.1|1144532_1144733_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	100.0	2.4e-33
AYW23565.1|1144696_1145038_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	97.3	1.7e-55
AYW23566.1|1145105_1145339_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	1.2e-31
AYW23567.1|1145338_1145566_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	97.3	3.0e-35
AYW23568.1|1145562_1146420_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.1	1.1e-159
AYW23569.1|1146416_1148831_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.6	0.0e+00
AYW23570.1|1148984_1149173_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
AYW23571.1|1149111_1149417_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
AYW23572.1|1149531_1150209_+	hypothetical protein	NA	NA	NA	NA	NA
AYW23573.1|1150487_1151639_+	TIGR02391 family protein	NA	NA	NA	NA	NA
AYW23574.1|1151690_1152725_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.3	5.9e-171
AYW23575.1|1152724_1154491_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	99.1	0.0e+00
AYW23576.1|1154633_1155467_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
AYW23577.1|1155483_1156542_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.9e-180
AYW23578.1|1156545_1157196_+	hypothetical protein	NA	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYW23579.1|1157291_1157756_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.1e-76
AYW23580.1|1157755_1157959_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	91.0	5.2e-31
AYW23581.1|1157962_1158178_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYW23582.1|1158158_1158674_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.8	4.0e-88
AYW23583.1|1158670_1159099_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	91.5	1.5e-59
AYW23584.1|1159028_1159232_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	79.1	4.7e-24
AYW23585.1|1159194_1159626_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	1.3e-71
AYW23586.1|1159618_1160083_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	83.6	5.5e-60
AYW23587.1|1160170_1161682_+	hypothetical protein	NA	NA	NA	NA	NA
AYW23588.1|1161808_1162387_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	1.6e-93
AYW23589.1|1162383_1162743_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
AYW23590.1|1162729_1163638_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	4.6e-143
AYW23591.1|1163630_1164236_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
AYW23592.1|1164232_1165954_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	78.9	3.5e-152
AYW23593.1|1165953_1166136_+	hypothetical protein	NA	NA	NA	NA	NA
AYW27404.1|1166116_1166269_-	hypothetical protein	NA	U5P083	Shigella_phage	71.1	5.8e-11
AYW23594.1|1166932_1167499_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	85.2	2.1e-85
AYW23595.1|1167641_1168814_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	89.2	2.5e-202
AYW23596.1|1168823_1169339_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
AYW23597.1|1169393_1169696_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
AYW23598.1|1169710_1169830_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYW23599.1|1169822_1172900_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.3	0.0e+00
AYW23600.1|1172896_1173382_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	4.8e-67
AYW23601.1|1173378_1174479_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	86.9	4.2e-175
AYW23602.1|1174569_1174788_+	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYW23603.1|1175191_1175965_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
AYW23604.1|1176399_1176957_-	hypothetical protein	NA	NA	NA	NA	NA
AYW23605.1|1176959_1177541_-	ComF family protein	NA	NA	NA	NA	NA
AYW23606.1|1177788_1178664_-	DNA-binding protein	NA	NA	NA	NA	NA
AYW23607.1|1179617_1179782_+	antitoxin	NA	NA	NA	NA	NA
AYW23608.1|1180625_1181984_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
AYW23609.1|1182560_1183010_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	63.8	1.8e-44
AYW23610.1|1183383_1183629_-|holin	holin	holin	S4TNY4	Salmonella_phage	71.8	2.7e-26
AYW23611.1|1184026_1184233_-	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	55.3	7.4e-09
AYW23612.1|1184673_1185687_-	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
AYW23613.1|1185697_1186678_-	PTS sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
AYW23614.1|1186674_1187049_-	PTS sorbitol transporter	NA	NA	NA	NA	NA
AYW23615.1|1187045_1187567_-	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
AYW23616.1|1187679_1187964_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.7	4.6e-17
AYW23617.1|1188058_1188415_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYW23618.1|1188733_1190803_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.6	8.7e-73
AYW23619.1|1190838_1191054_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
AYW23620.1|1191535_1195339_-	DNA-binding protein	NA	NA	NA	NA	NA
AYW23621.1|1195527_1196175_-	hypothetical protein	NA	NA	NA	NA	NA
AYW23622.1|1196176_1196266_-|integrase	integrase	integrase	NA	NA	NA	NA
AYW23623.1|1198096_1198579_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1197598:1197635	attR	GCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
AYW23624.1|1198689_1199166_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
AYW23625.1|1199155_1199446_+	RnfH family protein	NA	NA	NA	NA	NA
AYW23626.1|1199512_1199854_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AYW23627.1|1200001_1201663_-	DNA repair protein RecN	NA	NA	NA	NA	NA
AYW23628.1|1201749_1202628_-	NAD(+) kinase	NA	NA	NA	NA	NA
AYW23629.1|1202752_1203343_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AYW23630.1|1203463_1204750_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AYW23631.1|1204769_1205561_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
AYW23632.1|1205724_1207089_+	signal recognition particle protein	NA	NA	NA	NA	NA
AYW23633.1|1207348_1207597_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
AYW23634.1|1207615_1208164_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AYW23635.1|1208195_1208963_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
CP033625	Klebsiella pneumoniae strain 4743 chromosome, complete genome	5394691	1310929	1322307	5394691	integrase	Morganella_phage(25.0%)	18	1310090:1310104	1318577:1318591
1310090:1310104	attL	CGTGCTGCTGGTGAT	NA	NA	NA	NA
AYW27407.1|1310929_1312198_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	60.8	3.3e-147
AYW23721.1|1312205_1313159_+	hypothetical protein	NA	NA	NA	NA	NA
AYW23722.1|1313285_1313504_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
AYW23723.1|1313503_1313935_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	48.9	3.1e-25
AYW23724.1|1313948_1314758_+	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	54.5	3.5e-30
AYW23725.1|1314750_1314930_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AYW27408.1|1315576_1315771_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
AYW27409.1|1315763_1315943_+	hypothetical protein	NA	NA	NA	NA	NA
AYW23726.1|1315939_1316443_+	hypothetical protein	NA	NA	NA	NA	NA
AYW23727.1|1316439_1316649_+	hypothetical protein	NA	NA	NA	NA	NA
AYW23728.1|1316645_1317272_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	37.8	1.8e-26
AYW23729.1|1317281_1317632_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	69.1	8.9e-39
AYW23730.1|1317624_1320075_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	38.0	1.1e-138
1318577:1318591	attR	ATCACCAGCAGCACG	NA	NA	NA	NA
AYW23731.1|1320382_1320781_+	hypothetical protein	NA	NA	NA	NA	NA
AYW23732.1|1320777_1321224_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AYW23733.1|1321237_1321510_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AYW23734.1|1321516_1321900_+	superinfection immunity protein	NA	A0A0S2SY85	Pseudomonas_phage	45.4	2.1e-17
AYW23735.1|1321929_1322307_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	44.7	1.1e-21
>prophage 3
CP033625	Klebsiella pneumoniae strain 4743 chromosome, complete genome	5394691	1333730	1399813	5394691	terminase,tail,integrase,holin,protease,capsid,transposase	Salmonella_phage(40.43%)	72	1334725:1334742	1402561:1402578
AYW23750.1|1333730_1335197_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.5e-87
1334725:1334742	attL	GTATTCCGGTTATCGCTG	NA	NA	NA	NA
AYW23751.1|1335264_1336842_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
AYW23752.1|1337033_1338287_+|integrase	site-specific integrase	integrase	A0A1X9TCT6	Enterobacter_phage	83.6	3.5e-202
AYW23753.1|1338548_1339211_-	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	75.5	4.7e-97
AYW23754.1|1339207_1339810_-	adenine methylase	NA	A0A193GYV6	Enterobacter_phage	92.4	4.0e-103
AYW23755.1|1339806_1340313_-	hypothetical protein	NA	NA	NA	NA	NA
AYW23756.1|1340309_1340468_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	80.8	8.7e-18
AYW23757.1|1340460_1340754_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
AYW23758.1|1340863_1341112_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
AYW23759.1|1341162_1342185_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	95.3	4.0e-180
AYW23760.1|1342194_1343094_-	endonuclease	NA	Q858E0	Salmonella_phage	91.0	6.5e-158
AYW23761.1|1343090_1343390_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
AYW23762.1|1343756_1344338_-	XRE family transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
AYW23763.1|1344492_1344726_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
AYW23764.1|1344872_1345082_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
AYW23765.1|1345081_1345849_+	primosomal protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
AYW23766.1|1345845_1346631_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
AYW23767.1|1346750_1347098_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	81.7	1.9e-49
AYW27410.1|1347290_1347692_+	hypothetical protein	NA	A0A2H4N7F5	Pectobacterium_phage	51.6	8.7e-22
AYW27411.1|1347763_1347973_+	hypothetical protein	NA	NA	NA	NA	NA
AYW23768.1|1347969_1348224_+	hypothetical protein	NA	NA	NA	NA	NA
AYW27412.1|1348223_1348487_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	65.5	3.5e-27
AYW23769.1|1349180_1349420_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	51.7	8.6e-09
AYW23770.1|1349419_1349758_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	79.1	3.1e-44
AYW23771.1|1349832_1350090_+	lF-82	NA	NA	NA	NA	NA
AYW23772.1|1350167_1350752_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.6	9.9e-91
AYW23773.1|1352266_1352638_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	93.5	6.8e-61
AYW23774.1|1352688_1352889_+	hypothetical protein	NA	NA	NA	NA	NA
AYW23775.1|1353225_1353414_+	hypothetical protein	NA	NA	NA	NA	NA
AYW23776.1|1353435_1353639_+	hypothetical protein	NA	NA	NA	NA	NA
AYW23777.1|1353642_1355322_+|tail	phage tail protein	tail	T1S9Z7	Salmonella_phage	59.3	3.6e-194
AYW23778.1|1355318_1355624_+	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
AYW27413.1|1355905_1356304_+	peptidase	NA	T1SAP9	Salmonella_phage	59.5	5.6e-37
AYW23779.1|1356316_1357324_+|capsid	phage capsid protein	capsid	T1S9H9	Salmonella_phage	92.8	2.1e-181
AYW23780.1|1357333_1357726_+	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
AYW23781.1|1357718_1357997_+	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	1.1e-20
AYW23782.1|1358045_1358657_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	9.2e-47
AYW23783.1|1358656_1361134_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.4	2.3e-266
AYW23784.1|1361135_1361606_+	hypothetical protein	NA	Q858G2	Salmonella_phage	55.3	9.5e-44
AYW23785.1|1361598_1362096_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	41.7	8.9e-24
AYW23786.1|1362108_1364853_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	39.7	3.9e-97
AYW23787.1|1364852_1368242_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	42.0	2.4e-120
AYW23788.1|1368251_1368866_+	hypothetical protein	NA	NA	NA	NA	NA
AYW23789.1|1368901_1369054_-	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	83.7	5.6e-14
AYW23790.1|1369146_1369482_-	hypothetical protein	NA	NA	NA	NA	NA
AYW23791.1|1369483_1369672_-	hypothetical protein	NA	NA	NA	NA	NA
AYW23792.1|1369823_1370513_-	anti-repressor protein	NA	A0A193GYJ9	Enterobacter_phage	58.5	9.9e-74
AYW23793.1|1371002_1371836_+	hypothetical protein	NA	NA	NA	NA	NA
AYW23794.1|1372049_1372346_-	hypothetical protein	NA	T1SA06	Salmonella_phage	62.7	1.2e-23
AYW23795.1|1375014_1375290_+	hypothetical protein	NA	NA	NA	NA	NA
AYW23796.1|1375402_1375807_+	hypothetical protein	NA	T1SA79	Salmonella_phage	82.6	2.1e-55
AYW23797.1|1375793_1376099_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	4.6e-39
AYW23798.1|1376088_1376718_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	78.4	1.5e-92
AYW23799.1|1376714_1377215_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	90.0	1.1e-69
AYW23800.1|1377401_1379270_-	phosphatase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
AYW23801.1|1379253_1380432_-	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
AYW23802.1|1380725_1381958_-	MFS transporter	NA	NA	NA	NA	NA
AYW23803.1|1382055_1382943_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYW23804.1|1383039_1383231_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	79.3	3.3e-19
AYW23805.1|1383583_1385812_+	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
AYW23806.1|1385865_1387398_-	exopolyphosphatase	NA	NA	NA	NA	NA
AYW23807.1|1387401_1389462_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
AYW23808.1|1389642_1390284_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	9.0e-29
AYW23809.1|1390280_1391318_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
AYW23810.1|1391581_1392475_+	ROK family protein	NA	NA	NA	NA	NA
AYW23811.1|1392484_1393918_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
AYW23812.1|1394135_1394762_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
AYW23813.1|1394857_1396144_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
AYW23814.1|1396242_1396944_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
AYW23815.1|1396940_1397852_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
AYW23816.1|1397980_1398340_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
AYW23817.1|1398349_1399813_-|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
1402561:1402578	attR	GTATTCCGGTTATCGCTG	NA	NA	NA	NA
>prophage 4
CP033625	Klebsiella pneumoniae strain 4743 chromosome, complete genome	5394691	1790029	1798408	5394691		Enterobacteria_phage(28.57%)	7	NA	NA
AYW24135.1|1790029_1791436_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	1.8e-37
AYW24136.1|1791658_1792723_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	4.4e-105
AYW24137.1|1792749_1793619_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
AYW24138.1|1793650_1794541_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
AYW24139.1|1794555_1795110_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
AYW24140.1|1795289_1796456_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
AYW24141.1|1797403_1798408_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
>prophage 5
CP033625	Klebsiella pneumoniae strain 4743 chromosome, complete genome	5394691	1930054	2002737	5394691	terminase,integrase,tail,holin,head,protease,capsid,portal	Klebsiella_phage(17.46%)	86	1918596:1918614	2009555:2009573
1918596:1918614	attL	GCGGTGCAAAAAGCGATCG	NA	NA	NA	NA
AYW24247.1|1930054_1931047_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	87.2	4.9e-175
AYW24248.1|1931048_1931276_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	78.4	3.8e-30
AYW24249.1|1931308_1931587_-	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	44.9	6.7e-13
AYW24250.1|1931583_1932492_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	61.6	9.8e-45
AYW24251.1|1932484_1933561_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	74.1	2.1e-147
AYW24252.1|1933688_1934474_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.2	1.4e-60
AYW24253.1|1934473_1934773_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	46.7	3.8e-14
AYW24254.1|1934860_1935778_-	hypothetical protein	NA	A0A1W6JP69	Morganella_phage	36.9	3.1e-46
AYW27443.1|1936224_1936872_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	63.0	9.3e-74
AYW24255.1|1936976_1937174_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	66.1	2.7e-16
AYW24256.1|1937199_1937661_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
AYW24257.1|1937898_1938078_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	4.6e-15
AYW24258.1|1938067_1939036_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	66.4	1.0e-84
AYW24259.1|1939241_1940066_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.5	2.6e-113
AYW24260.1|1940075_1940453_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	72.8	3.3e-47
AYW24261.1|1940465_1941446_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.2	8.4e-135
AYW24262.1|1941459_1942038_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.7	1.7e-50
AYW24263.1|1942189_1942429_+	hypothetical protein	NA	NA	NA	NA	NA
AYW27444.1|1942599_1942899_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	84.8	1.5e-39
AYW24264.1|1942895_1943435_+	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	2.0e-101
AYW24265.1|1943431_1943779_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	81.7	2.1e-40
AYW24266.1|1943775_1944051_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	70.3	3.9e-05
AYW24267.1|1944001_1944196_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	87.3	4.6e-21
AYW24268.1|1944182_1944425_+	hypothetical protein	NA	NA	NA	NA	NA
AYW24269.1|1944553_1944799_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	98.8	1.6e-34
AYW24270.1|1944835_1945246_+	hypothetical protein	NA	NA	NA	NA	NA
AYW27445.1|1945310_1945661_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	80.7	4.6e-51
AYW24271.1|1945792_1946287_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	92.0	1.2e-81
AYW24272.1|1946283_1948014_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	83.4	9.2e-302
AYW24273.1|1948023_1948209_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	63.9	5.2e-14
AYW24274.1|1948208_1949438_+|portal	phage portal protein	portal	U5P411	Shigella_phage	81.5	1.7e-201
AYW24275.1|1949424_1950078_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	87.4	2.1e-105
AYW24276.1|1950092_1951301_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	84.5	9.9e-194
AYW24277.1|1951327_1951543_+	hypothetical protein	NA	M1FN89	Enterobacteria_phage	42.4	1.9e-07
AYW24278.1|1951539_1951860_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	43.1	4.8e-15
AYW24279.1|1951868_1952207_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	74.1	1.4e-41
AYW24280.1|1952203_1952653_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
AYW24281.1|1952649_1952997_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
AYW24282.1|1953053_1953758_+|tail	phage tail protein	tail	K7PHL2	Enterobacterial_phage	66.9	2.5e-80
AYW24283.1|1953788_1954193_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	56.9	3.2e-32
AYW24284.1|1954195_1954501_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	63.6	1.4e-27
AYW24285.1|1954574_1954808_+	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
AYW24286.1|1954868_1958255_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.9	2.5e-303
AYW24287.1|1958275_1958749_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	60.8	4.6e-54
AYW24288.1|1958735_1959221_+	DUF1833 domain-containing protein	NA	A0A286S2B1	Klebsiella_phage	66.2	3.0e-53
AYW24289.1|1959230_1959611_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	80.2	2.1e-57
AYW24290.1|1959607_1962691_+	kinase	NA	A0A286S259	Klebsiella_phage	71.9	0.0e+00
AYW24291.1|1965188_1965479_-	hypothetical protein	NA	NA	NA	NA	NA
AYW24292.1|1965968_1967243_-	hypothetical protein	NA	NA	NA	NA	NA
AYW24293.1|1967375_1967954_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	93.4	2.2e-90
AYW24294.1|1968004_1968427_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	44.5	1.8e-25
AYW24295.1|1968838_1969078_+	DNA polymerase V	NA	I6PD82	Cronobacter_phage	54.4	7.5e-21
AYW24296.1|1969080_1969407_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	53.9	1.6e-26
AYW24297.1|1970010_1971156_-	porin	NA	Q1MVN1	Enterobacteria_phage	58.7	1.1e-117
AYW27446.1|1971547_1971814_-	hypothetical protein	NA	NA	NA	NA	NA
AYW24298.1|1971694_1971976_+	hypothetical protein	NA	NA	NA	NA	NA
AYW24299.1|1972018_1972726_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.7	2.8e-07
AYW24300.1|1972769_1974203_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.7	2.0e-100
AYW27447.1|1974183_1974678_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	50.7	9.7e-31
AYW24301.1|1974652_1975564_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
AYW24302.1|1975747_1976659_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
AYW24303.1|1976773_1978453_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	41.1	3.1e-20
AYW24304.1|1978752_1978977_-	DUF2525 domain-containing protein	NA	NA	NA	NA	NA
AYW24305.1|1979101_1979299_+	protein DsrB	NA	NA	NA	NA	NA
AYW24306.1|1979331_1979955_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
AYW24307.1|1980330_1980762_+	lipoprotein	NA	NA	NA	NA	NA
AYW24308.1|1980803_1982291_-	alpha-amylase	NA	NA	NA	NA	NA
AYW24309.1|1982491_1983292_+	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYW24310.1|1983387_1984374_+	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
AYW24311.1|1984389_1985058_+	cystine ABC transporter permease	NA	NA	NA	NA	NA
AYW24312.1|1985054_1985807_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.4	2.2e-26
AYW24313.1|1986124_1986847_+	transcriptional regulator SdiA	NA	NA	NA	NA	NA
AYW24314.1|1986914_1987139_-	DUF2594 family protein	NA	NA	NA	NA	NA
AYW24315.1|1987600_1988257_+	two-component system response regulator UvrY	NA	NA	NA	NA	NA
AYW24316.1|1988253_1990086_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
AYW24317.1|1990143_1990692_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
AYW24318.1|1991265_1992273_-|integrase	site-specific integrase	integrase	Q1I119	Pasteurella_virus	56.5	1.3e-103
AYW24319.1|1992269_1993136_-	BRCT domain-containing protein	NA	NA	NA	NA	NA
AYW24320.1|1994500_1995658_+|tail	phage tail protein	tail	S4TP62	Salmonella_phage	49.8	2.5e-45
AYW24321.1|1995785_1996274_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	65.0	1.6e-49
AYW24322.1|1996285_1999225_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	44.2	2.6e-208
AYW24323.1|1999205_1999382_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	69.8	1.5e-10
AYW24324.1|1999378_1999678_-|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	73.7	3.1e-32
AYW24325.1|1999732_2000248_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	70.0	2.6e-63
AYW24326.1|2000247_2001429_-|tail	phage tail protein	tail	A0A0A7NV69	Enterobacteria_phage	69.3	1.2e-156
AYW24327.1|2001582_2002737_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	80.7	4.2e-178
2009555:2009573	attR	GCGGTGCAAAAAGCGATCG	NA	NA	NA	NA
>prophage 6
CP033625	Klebsiella pneumoniae strain 4743 chromosome, complete genome	5394691	2829979	2840866	5394691		Escherichia_phage(87.5%)	9	NA	NA
AYW25099.1|2829979_2833087_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
AYW25100.1|2833141_2834407_+	MFS transporter	NA	NA	NA	NA	NA
AYW25101.1|2834437_2835526_-	chromosome segregation protein SMC	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
AYW25102.1|2835612_2835873_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
AYW25103.1|2836170_2837031_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
AYW25104.1|2837051_2837813_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
AYW25105.1|2838073_2838976_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
AYW25106.1|2838987_2840253_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
AYW25107.1|2840245_2840866_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 7
CP033625	Klebsiella pneumoniae strain 4743 chromosome, complete genome	5394691	3545342	3554816	5394691	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
AYW25734.1|3545342_3547064_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
AYW25735.1|3547108_3547810_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AYW25736.1|3548163_3548382_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AYW25737.1|3548512_3550792_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
AYW25738.1|3550822_3551140_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
AYW25739.1|3551465_3551687_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
AYW25740.1|3551763_3553704_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
AYW25741.1|3553700_3554816_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 8
CP033625	Klebsiella pneumoniae strain 4743 chromosome, complete genome	5394691	4031331	4076783	5394691	terminase,coat,tail,integrase,head,holin,tRNA	Cronobacter_phage(26.92%)	66	4028285:4028330	4073855:4073900
4028285:4028330	attL	ATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AYW26152.1|4031331_4033809_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.3	2.6e-196
AYW26153.1|4033795_4034191_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.8	3.6e-36
AYW26154.1|4034187_4034658_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	9.6e-28
AYW27532.1|4034657_4035077_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	47.1	5.3e-30
AYW26155.1|4035247_4035511_+	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
AYW26156.1|4035490_4035670_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
AYW26157.1|4035710_4038128_-|tail	phage tail protein	tail	F1C5E9	Cronobacter_phage	62.7	8.3e-208
AYW26158.1|4038172_4038646_-	hypothetical protein	NA	NA	NA	NA	NA
AYW26159.1|4038642_4038975_-	hypothetical protein	NA	NA	NA	NA	NA
AYW27533.1|4038986_4039238_-	hypothetical protein	NA	H6WRV3	Salmonella_phage	62.7	2.8e-26
AYW26160.1|4039410_4039941_-	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	92.0	7.8e-87
AYW26161.1|4040157_4040871_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	54.6	2.1e-63
AYW26162.1|4041762_4041984_-	hypothetical protein	NA	NA	NA	NA	NA
AYW26163.1|4041986_4042370_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	48.0	3.5e-28
AYW26164.1|4042366_4042735_-	HK97 gp10 family phage protein	NA	F1C5E3	Cronobacter_phage	82.8	2.9e-48
AYW26165.1|4042737_4043100_-	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	48.3	1.6e-19
AYW26166.1|4043099_4043273_-	50S ribosomal protein L13	NA	I6R0P9	Salmonella_phage	56.1	2.4e-13
AYW26167.1|4043272_4043653_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	56.1	1.4e-29
AYW26168.1|4043655_4043949_-	hypothetical protein	NA	NA	NA	NA	NA
AYW26169.1|4043958_4045056_-|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	73.6	4.2e-151
AYW26170.1|4045067_4045499_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.1	1.4e-41
AYW26171.1|4045502_4046888_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	64.0	7.6e-166
AYW26172.1|4046954_4047635_-	HNH endonuclease	NA	S5M802	Pseudoalteromonas_phage	38.3	9.6e-37
AYW26173.1|4047736_4048741_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	68.7	1.9e-113
AYW26174.1|4048667_4050137_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.1	1.2e-148
AYW26175.1|4050149_4051622_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.9	6.9e-250
AYW26176.1|4051621_4052224_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	78.7	3.1e-79
AYW26177.1|4052661_4053012_-	hypothetical protein	NA	A0A0K2FIW3	Enterobacter_phage	42.9	7.6e-14
AYW27534.1|4053008_4053506_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	83.0	4.8e-78
AYW26178.1|4053483_4053753_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	78.3	2.8e-32
AYW26179.1|4053972_4054512_-	HNH endonuclease	NA	A5PJ37	Escherichia_virus	46.1	2.1e-34
AYW26180.1|4054949_4055639_-	antiterminator	NA	I6PDF8	Cronobacter_phage	54.9	1.0e-57
AYW26181.1|4055635_4055776_-	YlcG family protein	NA	NA	NA	NA	NA
AYW26182.1|4055772_4056414_-	HNH endonuclease	NA	A0A2H4JH74	uncultured_Caudovirales_phage	40.7	8.4e-35
AYW26183.1|4056410_4057049_-	hypothetical protein	NA	H6WRY9	Salmonella_phage	65.1	2.8e-70
AYW26184.1|4057041_4057212_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	73.2	5.7e-15
AYW26185.1|4057211_4057667_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	68.2	1.5e-54
AYW26186.1|4057918_4058200_-	hypothetical protein	NA	A0A220NQY7	Salmonella_phage	40.2	1.0e-05
AYW27535.1|4058192_4058651_-	DUF551 domain-containing protein	NA	A0A193GYX5	Enterobacter_phage	91.5	2.5e-28
AYW26187.1|4059117_4059306_-	diguanylate phosphodiesterase	NA	A0A192Y8X2	Salmonella_phage	88.7	3.7e-23
AYW26188.1|4059766_4060012_-	hypothetical protein	NA	NA	NA	NA	NA
AYW27536.1|4060008_4060455_-	hypothetical protein	NA	K7P858	Enterobacteria_phage	42.8	4.1e-20
AYW26189.1|4060457_4060751_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	2.5e-26
AYW26190.1|4060750_4062181_-	helicase DnaB	NA	Q9MCT4	Escherichia_phage	66.3	4.9e-184
AYW26191.1|4062170_4063070_-	DNA replication protein	NA	F1C5C3	Cronobacter_phage	55.6	8.4e-89
AYW26192.1|4063294_4063516_-	transcriptional regulator	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
AYW26193.1|4063556_4063784_-	Cro/Cl family transcriptional regulator	NA	A0A2I6PIE5	Escherichia_phage	61.2	5.6e-18
AYW26194.1|4063852_4064575_+	helix-turn-helix domain-containing protein	NA	E7C9R0	Salmonella_phage	62.8	6.1e-74
AYW26195.1|4064672_4065422_+	hypothetical protein	NA	NA	NA	NA	NA
AYW26196.1|4065418_4066246_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
AYW26197.1|4066957_4067164_+	cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
AYW26198.1|4067245_4067530_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	3.3e-39
AYW26199.1|4067539_4068454_+	DNA recombinase	NA	G8C7T0	Escherichia_phage	91.4	1.0e-158
AYW26200.1|4068450_4068933_+	siphovirus Gp157 family protein	NA	G8C7S9	Escherichia_phage	92.5	3.1e-74
AYW26201.1|4068967_4069273_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYW26202.1|4069269_4069926_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.0	2.7e-113
AYW26203.1|4069922_4071059_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	73.1	7.4e-159
AYW26204.1|4071274_4071547_+	hypothetical protein	NA	Q716F1	Shigella_phage	63.5	3.7e-24
AYW26205.1|4071543_4072248_+	hypothetical protein	NA	A0A1W6JP46	Morganella_phage	34.3	1.0e-25
AYW26206.1|4072244_4072463_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	52.2	4.4e-12
AYW27537.1|4072464_4072800_+	DNA-binding protein	NA	NA	NA	NA	NA
AYW27538.1|4072796_4073840_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	85.9	2.2e-178
AYW26207.1|4073909_4074233_-	hypothetical protein	NA	NA	NA	NA	NA
4073855:4073900	attR	ATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
AYW26208.1|4074271_4075138_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
AYW26209.1|4075139_4075352_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
AYW26210.1|4075397_4076783_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 1
CP033626	Klebsiella pneumoniae strain 4743 plasmid unnamed1, complete sequence	22859	7709	22100	22859	tail	Salmonella_phage(20.0%)	20	NA	NA
AYW27608.1|7709_8252_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	33.2	1.3e-20
AYW27609.1|8487_9117_-	hypothetical protein	NA	NA	NA	NA	NA
AYW27610.1|9287_9659_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	58.7	9.2e-34
AYW27611.1|9863_10148_-	hypothetical protein	NA	NA	NA	NA	NA
AYW27612.1|10314_13113_-|tail	tail tape measure protein	tail	A0A1B1W284	Salmonella_phage	32.4	7.7e-48
AYW27613.1|13120_13447_-	hypothetical protein	NA	NA	NA	NA	NA
AYW27614.1|13741_14119_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	44.7	1.1e-21
AYW27615.1|14148_14532_-	superinfection immunity protein	NA	A0A0S2SY85	Pseudomonas_phage	45.4	2.1e-17
AYW27616.1|14538_14811_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AYW27617.1|14824_15271_-	single-stranded DNA-binding protein	NA	A0A1J0MCT7	Streptomyces_phage	37.6	1.3e-05
AYW27618.1|15267_15666_-	hypothetical protein	NA	NA	NA	NA	NA
AYW27619.1|15973_18424_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	38.0	1.1e-138
AYW27620.1|18416_18767_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	69.1	8.9e-39
AYW27621.1|18776_19403_-	hypothetical protein	NA	A0A1B5FPB4	Escherichia_phage	37.6	8.0e-22
AYW27622.1|19399_19609_-	hypothetical protein	NA	NA	NA	NA	NA
AYW27623.1|19605_20109_-	hypothetical protein	NA	NA	NA	NA	NA
AYW27632.1|20105_20285_-	hypothetical protein	NA	NA	NA	NA	NA
AYW27631.1|20277_20472_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
AYW27624.1|21118_21298_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AYW27625.1|21290_22100_-	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	54.5	3.5e-30
>prophage 1
CP033627	Klebsiella pneumoniae strain 4743 plasmid unnamed2, complete sequence	184083	1727	67645	184083	integrase,protease,transposase	uncultured_Caudovirales_phage(27.78%)	59	NA	NA
AYW27635.1|1727_2468_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
AYW27636.1|3611_4559_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
AYW27637.1|4585_4897_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AYW27638.1|4961_5885_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	98.4	2.1e-175
AYW27639.1|6557_6815_-	hypothetical protein	NA	NA	NA	NA	NA
AYW27640.1|7434_8871_+	EAL domain-containing protein	NA	NA	NA	NA	NA
AYW27641.1|9853_11131_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
AYW27796.1|11193_13191_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
AYW27642.1|15529_15961_-	silver-binding protein SilE	NA	NA	NA	NA	NA
AYW27643.1|16211_17687_-	Cu(+)/Ag(+) sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
AYW27644.1|17679_18360_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
AYW27645.1|18549_19935_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
AYW27646.1|19963_20317_+	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYW27647.1|20430_21723_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
AYW27648.1|21733_24880_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
AYW27649.1|24966_25407_+	hypothetical protein	NA	NA	NA	NA	NA
AYW27650.1|25533_27981_+	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
AYW27651.1|28021_28219_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
AYW27652.1|28252_28990_-	peptidase M23	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
AYW27653.1|29278_29728_-	copper resistance protein	NA	NA	NA	NA	NA
AYW27654.1|29961_31779_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
AYW27655.1|31778_32675_+	copper resistance protein B	NA	NA	NA	NA	NA
AYW27656.1|32714_33095_+	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
AYW27657.1|33099_34029_+	copper resistance protein D	NA	NA	NA	NA	NA
AYW27658.1|34083_34764_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
AYW27659.1|34760_36161_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
AYW27660.1|36377_36812_+	copper-binding protein	NA	NA	NA	NA	NA
AYW27797.1|37043_37223_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AYW27661.1|38965_39475_+	porin	NA	NA	NA	NA	NA
AYW27662.1|39524_40022_-	N-acetyltransferase	NA	NA	NA	NA	NA
AYW27663.1|40353_40680_+	transcriptional regulator	NA	NA	NA	NA	NA
AYW27798.1|40679_41390_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
AYW27664.1|41398_41944_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AYW27665.1|42019_42382_+	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AYW27666.1|44278_44815_+	N-acetyltransferase	NA	NA	NA	NA	NA
AYW27667.1|44847_45273_-	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
AYW27668.1|45285_46575_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
AYW27669.1|46622_48374_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
AYW27670.1|48391_48754_-	arsenical resistance operon transcriptional repressor ArsD	NA	NA	NA	NA	NA
AYW27671.1|48803_49154_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
AYW27672.1|49511_49781_+	hypothetical protein	NA	NA	NA	NA	NA
AYW27673.1|49768_50344_+	hypothetical protein	NA	NA	NA	NA	NA
AYW27674.1|50374_50869_+	DNA-binding protein	NA	NA	NA	NA	NA
AYW27675.1|50912_51281_+	hypothetical protein	NA	NA	NA	NA	NA
AYW27676.1|51314_51518_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
AYW27677.1|51566_51824_+	hypothetical protein	NA	NA	NA	NA	NA
AYW27678.1|51899_52154_+	hypothetical protein	NA	NA	NA	NA	NA
AYW27679.1|52329_52596_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AYW27680.1|52583_53066_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYW27681.1|53266_54670_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
AYW27682.1|54698_55331_-	hypothetical protein	NA	NA	NA	NA	NA
AYW27799.1|55560_56907_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
AYW27683.1|58749_59712_-|protease	Zn-dependent protease	protease	NA	NA	NA	NA
AYW27684.1|59698_60448_-	diguanylate cyclase	NA	NA	NA	NA	NA
AYW27685.1|60685_60883_-	hypothetical protein	NA	NA	NA	NA	NA
AYW27686.1|60882_63678_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
AYW27687.1|63792_64362_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
AYW27800.1|64396_64678_-	DNA-binding protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
AYW27688.1|66664_67645_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 2
CP033627	Klebsiella pneumoniae strain 4743 plasmid unnamed2, complete sequence	184083	159172	169816	184083	transposase	Escherichia_phage(50.0%)	17	NA	NA
AYW27764.1|159172_159994_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.4	2.6e-44
AYW27765.1|160091_160310_+	hypothetical protein	NA	NA	NA	NA	NA
AYW27766.1|160827_161241_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYW27767.1|161241_161520_-	XRE family transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
AYW27768.1|161509_161830_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
AYW27769.1|161910_162135_-	hypothetical protein	NA	NA	NA	NA	NA
AYW27770.1|162145_162358_-	hypothetical protein	NA	NA	NA	NA	NA
AYW27771.1|162418_162775_-	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	2.6e-25
AYW27772.1|162879_163098_+	hypothetical protein	NA	NA	NA	NA	NA
AYW27773.1|163410_163761_-	hypothetical protein	NA	NA	NA	NA	NA
AYW27774.1|163757_164030_-	hypothetical protein	NA	NA	NA	NA	NA
AYW27775.1|164640_165345_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYW27776.1|165356_165737_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	2.2e-62
AYW27777.1|166699_167404_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	2.6e-138
AYW27778.1|167514_167751_-	mercury resistance protein	NA	NA	NA	NA	NA
AYW27779.1|167747_168113_-	transcriptional regulator	NA	NA	NA	NA	NA
AYW27780.1|168130_169816_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
>prophage 1
CP033628	Klebsiella pneumoniae strain 4743 plasmid unnamed3, complete sequence	110020	5122	54727	110020	transposase,integrase	Escherichia_phage(36.36%)	53	NA	NA
AYW27816.1|5122_6838_-|integrase	integrase	integrase	NA	NA	NA	NA
AYW27817.1|6947_9977_+|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
AYW27818.1|10083_11109_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
AYW27819.1|11105_11885_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
AYW27820.1|11881_12121_+	hypothetical protein	NA	NA	NA	NA	NA
AYW27821.1|12172_13054_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
AYW27822.1|13303_14623_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
AYW27823.1|14899_16084_-|transposase	ISAs1-like element ISKpn31 family transposase	transposase	NA	NA	NA	NA
AYW27824.1|16587_16947_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	62.0	3.6e-19
AYW27825.1|18112_18733_-	serine recombinase	NA	A0A219Y912	Aeromonas_phage	31.5	2.0e-09
AYW27826.1|18821_21719_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.7	2.7e-181
AYW27827.1|21791_22496_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYW27828.1|24239_25100_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AYW27829.1|25667_26972_-|integrase	integrase	integrase	NA	NA	NA	NA
AYW27830.1|27010_27718_-	EAL domain-containing protein	NA	NA	NA	NA	NA
AYW27831.1|27714_27951_-	mercury resistance protein	NA	NA	NA	NA	NA
AYW27832.1|27947_28310_-	transcriptional regulator	NA	NA	NA	NA	NA
AYW27833.1|28327_30022_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AYW27915.1|30073_30496_-	mercury transporter MerC	NA	NA	NA	NA	NA
AYW27916.1|30531_30657_-	mercury transporter	NA	NA	NA	NA	NA
AYW27834.1|31388_32099_-	AAA family ATPase	NA	NA	NA	NA	NA
AYW27835.1|32172_32589_-	PIN domain-containing protein	NA	NA	NA	NA	NA
AYW27836.1|32585_32816_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AYW27837.1|32799_33234_+	hypothetical protein	NA	NA	NA	NA	NA
AYW27838.1|33377_33728_+	hypothetical protein	NA	NA	NA	NA	NA
AYW27839.1|33778_34522_+	hypothetical protein	NA	NA	NA	NA	NA
AYW27840.1|34518_35295_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
AYW27841.1|35352_35610_-	hypothetical protein	NA	NA	NA	NA	NA
AYW27842.1|36377_37244_+	RepB family plasmid replication initiator protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
AYW27843.1|37600_37870_-	hypothetical protein	NA	NA	NA	NA	NA
AYW27844.1|38284_39490_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
AYW27845.1|39486_40464_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
AYW27846.1|40545_41817_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
AYW27847.1|41816_42248_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
AYW27848.1|42405_42657_+	hypothetical protein	NA	NA	NA	NA	NA
AYW27849.1|42656_44141_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
AYW27850.1|44133_44403_+	hypothetical protein	NA	NA	NA	NA	NA
AYW27851.1|44610_45042_+	hypothetical protein	NA	NA	NA	NA	NA
AYW27852.1|45074_45602_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	39.5	5.7e-21
AYW27853.1|45861_46317_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
AYW27854.1|46388_46754_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
AYW27855.1|46769_47045_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
AYW27856.1|47072_47498_+	mercury transporter MerC	NA	NA	NA	NA	NA
AYW27857.1|47536_49222_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
AYW27858.1|49239_49605_+	transcriptional regulator	NA	NA	NA	NA	NA
AYW27859.1|49601_49838_+	mercury resistance protein	NA	NA	NA	NA	NA
AYW27860.1|49948_50653_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
AYW27861.1|50722_50917_-	hypothetical protein	NA	NA	NA	NA	NA
AYW27862.1|50917_51673_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	4.5e-136
AYW27863.1|52684_52876_-	plasmid stabilization protein	NA	NA	NA	NA	NA
AYW27864.1|52884_53271_-	hypothetical protein	NA	NA	NA	NA	NA
AYW27865.1|53816_54077_+	hypothetical protein	NA	NA	NA	NA	NA
AYW27866.1|54022_54727_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
CP033624	Klebsiella pneumoniae strain 4743 plasmid unnamed6	54773	500	54773	54773	capsid,head,transposase,portal,terminase,tail	Klebsiella_phage(85.19%)	59	NA	NA
AYW22426.1|500_1664_+	plasmid-partitioning protein SopA	NA	Q6UAV7	Klebsiella_phage	98.4	2.1e-225
AYW22427.1|1666_2632_+	ParB/RepB/Spo0J family plasmid partition protein	NA	Q6UAV8	Klebsiella_phage	86.9	1.5e-155
AYW22428.1|2710_4210_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	73.4	1.1e-146
AYW22429.1|4271_15017_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	55.9	0.0e+00
AYW22430.1|15079_15673_-|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	80.7	3.7e-85
AYW22431.1|15689_16517_-	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	44.0	2.3e-08
AYW22432.1|16563_17274_-	peptidase P60	NA	Q6UAW4	Klebsiella_phage	89.8	6.7e-134
AYW22433.1|17275_18031_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.9	2.7e-125
AYW22434.1|18027_18366_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	2.4e-57
AYW22435.1|18365_21722_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	87.0	0.0e+00
AYW22436.1|21721_21934_-	hypothetical protein	NA	Q6UAW9	Klebsiella_phage	90.3	5.8e-33
AYW22437.1|21954_22320_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	88.5	8.1e-51
AYW22438.1|22376_22838_-|tail	phage tail protein	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
AYW22439.1|22869_23271_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	94.0	1.7e-62
AYW22440.1|23267_23657_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
AYW22441.1|23637_23976_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
AYW22442.1|23972_24290_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
AYW22481.1|24270_24468_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	78.0	1.8e-20
AYW22443.1|24724_26011_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	85.0	2.4e-206
AYW22444.1|26088_27009_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	87.9	4.8e-148
AYW22445.1|27045_28305_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.0	3.6e-223
AYW22446.1|28304_28484_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	80.7	2.4e-16
AYW22447.1|28477_30187_-|terminase	terminase large subunit	terminase	Q6UAY0	Klebsiella_phage	95.1	0.0e+00
AYW22448.1|30508_31690_-|transposase	transposase	transposase	A0A1I9KF42	Aeromonas_phage	58.2	1.5e-122
AYW22449.1|31689_31917_-	hypothetical protein	NA	NA	NA	NA	NA
AYW22450.1|31913_32078_-	host cell division inhibitor Icd-like protein	NA	Q7Y3Y4	Yersinia_phage	81.5	7.6e-17
AYW22451.1|32357_32792_-|terminase	terminase	terminase	Q6UAY1	Klebsiella_phage	95.8	2.4e-73
AYW22482.1|33007_33208_-	hypothetical protein	NA	Q6UAR8	Klebsiella_phage	89.4	2.9e-10
AYW22452.1|33293_33725_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	59.9	2.9e-39
AYW22453.1|33721_34006_-	hypothetical protein	NA	Q6UAS1	Klebsiella_phage	37.5	2.4e-05
AYW22454.1|34002_34365_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	92.5	7.8e-62
AYW22455.1|34348_35425_-	hypothetical protein	NA	Q6UAS3	Klebsiella_phage	37.4	9.8e-36
AYW22456.1|35660_35894_-	DUF4406 domain-containing protein	NA	Q6UAS4	Klebsiella_phage	98.7	2.9e-38
AYW22457.1|36147_36624_-	hypothetical protein	NA	Q6UAS7	Klebsiella_phage	79.7	1.7e-61
AYW22458.1|36640_37132_-	hypothetical protein	NA	Q6UAS8	Klebsiella_phage	90.8	1.9e-82
AYW22459.1|37128_37440_-	hypothetical protein	NA	Q6UAS9	Klebsiella_phage	89.1	6.3e-44
AYW22460.1|37498_38560_-	site-specific DNA-methyltransferase	NA	Q6UAT0	Klebsiella_phage	93.2	1.6e-171
AYW22461.1|38830_39058_-	hypothetical protein	NA	Q6UAT1	Klebsiella_phage	84.0	1.6e-28
AYW22483.1|39069_39291_-	hypothetical protein	NA	O64358	Escherichia_phage	90.4	3.0e-32
AYW22462.1|39461_39770_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	94.2	3.9e-46
AYW22463.1|39769_40057_+	XRE family transcriptional regulator	NA	Q6UAT4	Klebsiella_phage	96.8	1.7e-43
AYW22464.1|40146_40350_-	hypothetical protein	NA	Q6UAT5	Klebsiella_phage	76.6	3.5e-19
AYW22465.1|40453_40681_-	hypothetical protein	NA	O64355	Escherichia_phage	80.3	2.8e-25
AYW22466.1|40701_41028_-	hypothetical protein	NA	Q6UAT7	Klebsiella_phage	94.4	3.9e-52
AYW22467.1|41020_41266_-	hypothetical protein	NA	G8C7U9	Escherichia_phage	83.1	5.1e-25
AYW22468.1|41866_42475_-	3'-5' exonuclease	NA	Q6UAU3	Klebsiella_phage	88.5	1.7e-98
AYW22469.1|42886_43624_-	phage antitermination protein	NA	Q6UAU4	Klebsiella_phage	84.5	2.2e-119
AYW22470.1|43613_43823_-	hypothetical protein	NA	Q6UAU5	Klebsiella_phage	92.8	7.7e-30
AYW22471.1|43903_44512_+	helix-turn-helix domain-containing protein	NA	Q6UAU6	Klebsiella_phage	90.6	2.6e-102
AYW22472.1|44762_48737_+	origin of replication binding family protein	NA	Q6UAU7	Klebsiella_phage	95.4	0.0e+00
AYW22473.1|48748_48997_+	hypothetical protein	NA	O64346	Escherichia_phage	96.3	4.4e-40
AYW22474.1|48993_49323_+	hypothetical protein	NA	O64345	Escherichia_phage	73.4	1.1e-43
AYW22475.1|49422_49947_+	hypothetical protein	NA	NA	NA	NA	NA
AYW22476.1|49973_51107_-	hypothetical protein	NA	NA	NA	NA	NA
AYW22477.1|51471_51591_+	hypothetical protein	NA	NA	NA	NA	NA
AYW22478.1|51634_51799_+	host cell division inhibitor Icd-like protein	NA	Q6UAV3	Klebsiella_phage	92.6	1.1e-18
AYW22479.1|51795_52026_+	hypothetical protein	NA	NA	NA	NA	NA
AYW22480.1|52022_52823_+	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	87.2	8.1e-128
AYW22484.1|52877_54773_-	protelomerase	NA	Q6UAV6	Klebsiella_phage	94.6	0.0e+00
