The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP019306	Fusobacterium necrophorum subsp. funduliforme strain F1260 chromosome, complete genome	2288480	262035	337073	2288480	holin,capsid,tail,terminase,protease,portal,tRNA,transposase,plate	Fusobacterium_phage(35.71%)	91	NA	NA
AYV94338.1|262035_263346_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
AYV94339.1|264030_265206_+	MFS transporter	NA	NA	NA	NA	NA
AYV94340.1|265373_265574_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94341.1|265576_266017_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94342.1|266145_267489_-	recombinase family protein	NA	Q9JML1	Wolbachia_phage	25.9	2.6e-17
AYV94343.1|267492_267768_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94344.1|267764_267983_-	hypothetical protein	NA	NA	NA	NA	NA
AYV96198.1|267963_268254_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94345.1|268433_268775_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94346.1|268771_269008_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94347.1|269036_269270_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94348.1|269270_269816_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94349.1|269829_270651_-	SAM-dependent methyltransferase	NA	A0A2I6PG28	Plesiomonas_phage	33.9	2.2e-43
AYV94350.1|270788_271097_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94351.1|271197_271878_-	hypothetical protein	NA	A0A0E3U242	Fusobacterium_phage	53.5	2.0e-55
AYV94352.1|271870_272587_-	ParA family protein	NA	A0A0E3Y677	Fusobacterium_phage	56.4	8.2e-63
AYV94353.1|272600_272993_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94354.1|272998_273208_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94355.1|273189_273825_-	hypothetical protein	NA	Q3HQZ7	Burkholderia_phage	32.6	3.1e-05
AYV94356.1|273821_274652_-	replication protein	NA	A0A141E184	Streptococcus_phage	52.3	5.1e-32
AYV94357.1|274644_274932_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94358.1|275178_275397_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94359.1|275642_275876_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYV94360.1|276078_276354_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94361.1|277006_277231_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYV94362.1|277340_277799_+	hypothetical protein	NA	NA	NA	NA	NA
AYV94363.1|277795_277981_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94364.1|278047_278251_+	hypothetical protein	NA	NA	NA	NA	NA
AYV94365.1|278287_278467_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94366.1|278475_278670_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94367.1|278820_279300_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYV94368.1|279322_279730_+	hypothetical protein	NA	NA	NA	NA	NA
AYV94369.1|279746_281597_+	DEAD/DEAH box helicase	NA	A0A2I5ARD8	Synechococcus_phage	24.2	1.8e-16
AYV94370.1|281599_281935_+	hypothetical protein	NA	NA	NA	NA	NA
AYV94371.1|282035_283028_+	Abi family protein	NA	A0A0S2MYH0	Enterococcus_phage	31.7	1.1e-30
AYV94372.1|283273_283486_+	hypothetical protein	NA	NA	NA	NA	NA
AYV94373.1|283478_283679_+	hypothetical protein	NA	NA	NA	NA	NA
AYV94374.1|283686_284820_+	hypothetical protein	NA	A0A0E3U246	Fusobacterium_phage	53.0	4.4e-103
AYV94375.1|284961_286272_+	chromosome partitioning protein ParB	NA	A0A0E3Y5D8	Fusobacterium_phage	58.2	3.9e-143
AYV94376.1|286286_286964_+	hypothetical protein	NA	A0A0E3Y615	Fusobacterium_phage	46.8	1.3e-46
AYV94377.1|287095_287680_+	hypothetical protein	NA	A0A0E3Y4U4	Fusobacterium_phage	30.9	3.3e-09
AYV94378.1|287672_289499_+|terminase	phage terminase large subunit family protein	terminase	A0A0E3U2N4	Fusobacterium_phage	44.0	5.2e-130
AYV94379.1|289495_289903_+	hypothetical protein	NA	NA	NA	NA	NA
AYV94380.1|289912_291460_+|portal	phage portal protein	portal	A0A0C5AJ48	Bacteriophage	42.2	1.1e-99
AYV94381.1|291422_292454_+|protease	Clp protease ClpP	protease	A0A0C5AEN1	Bacteriophage	31.5	8.0e-35
AYV94382.1|292466_292787_+	hypothetical protein	NA	NA	NA	NA	NA
AYV94383.1|292805_293834_+|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYV94384.1|293844_294138_+	hypothetical protein	NA	NA	NA	NA	NA
AYV94385.1|294137_294473_+	hypothetical protein	NA	NA	NA	NA	NA
AYV94386.1|294476_295022_+	hypothetical protein	NA	NA	NA	NA	NA
AYV94387.1|295012_295546_+	hypothetical protein	NA	NA	NA	NA	NA
AYV94388.1|295555_295774_+	hypothetical protein	NA	NA	NA	NA	NA
AYV94389.1|295785_297234_+|tail	phage tail protein	tail	A0A059WKP9	Vibrio_phage	34.3	1.6e-73
AYV94390.1|297245_297752_+|tail	phage tail protein	tail	NA	NA	NA	NA
AYV94391.1|297761_298145_+	hypothetical protein	NA	NA	NA	NA	NA
AYV94392.1|298316_300935_+|tail	phage tail tape measure protein	tail	H9A124	Staphylococcus_phage	32.0	4.7e-39
AYV94393.1|300915_301128_+|tail	phage tail protein	tail	A0A2K9V353	Faecalibacterium_phage	46.4	2.7e-06
AYV94394.1|301109_302144_+	late control protein	NA	A0A0E3U253	Fusobacterium_phage	27.5	4.3e-20
AYV94395.1|302140_302653_+|plate	phage baseplate protein	plate	NA	NA	NA	NA
AYV96199.1|302652_303285_+	hypothetical protein	NA	NA	NA	NA	NA
AYV94396.1|303286_303562_+	hypothetical protein	NA	NA	NA	NA	NA
AYV94397.1|303554_304655_+|plate	baseplate assembly protein	plate	R9U1E3	Rhizobium_phage	23.9	5.4e-13
AYV94398.1|304651_305311_+|tail	phage tail protein I	tail	A0A0C5AJ63	Bacteriophage	29.0	2.7e-12
AYV94399.1|305303_306980_+	hypothetical protein	NA	NA	NA	NA	NA
AYV94400.1|307651_308320_+	DUF4376 domain-containing protein	NA	A0A0E3U258	Fusobacterium_phage	42.2	3.7e-09
AYV94401.1|308347_308809_+	M15 family peptidase	NA	A0A0E3Y6B0	Fusobacterium_phage	50.3	1.1e-33
AYV94402.1|308839_309223_+	hypothetical protein	NA	NA	NA	NA	NA
AYV94403.1|309209_309662_+	DUF1353 domain-containing protein	NA	A0A0K2QQU0	Ralstonia_phage	45.9	4.9e-13
AYV94404.1|309677_310154_+|holin	holin	holin	Q2I8E7	Bacillus_phage	39.1	2.9e-16
AYV94405.1|310174_310345_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
AYV94406.1|310789_311353_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94407.1|311349_312012_-	O-methyltransferase	NA	NA	NA	NA	NA
AYV94408.1|312018_312912_-	DMT family transporter	NA	NA	NA	NA	NA
AYV94409.1|312996_314337_-	magnesium transporter	NA	NA	NA	NA	NA
AYV94410.1|314472_315771_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
AYV94411.1|316215_317274_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
AYV94412.1|317706_319092_+	transporter	NA	NA	NA	NA	NA
AYV94413.1|319095_320052_+	RloB domain-containing protein	NA	NA	NA	NA	NA
AYV94414.1|320157_321051_+	hypothetical protein	NA	NA	NA	NA	NA
AYV94415.1|321054_322968_+	hypothetical protein	NA	NA	NA	NA	NA
AYV94416.1|323055_323736_+	CRISPR-associated protein	NA	NA	NA	NA	NA
AYV96200.1|324302_324968_+	hypothetical protein	NA	NA	NA	NA	NA
AYV94417.1|324969_325839_+	hypothetical protein	NA	NA	NA	NA	NA
AYV94418.1|326230_326788_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AYV94419.1|326810_327356_+	J domain-containing protein	NA	NA	NA	NA	NA
AYV94420.1|327394_328753_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7P8	Chrysochromulina_ericina_virus	34.6	2.2e-32
AYV94421.1|328742_329693_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	36.6	5.6e-43
AYV94422.1|329695_330304_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	32.1	3.0e-21
AYV94423.1|330312_330747_+	hypothetical protein	NA	NA	NA	NA	NA
AYV94424.1|334799_335951_+	YARHG domain-containing protein	NA	NA	NA	NA	NA
AYV94425.1|336092_337073_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 2
CP019306	Fusobacterium necrophorum subsp. funduliforme strain F1260 chromosome, complete genome	2288480	413282	421858	2288480		Enterobacteria_phage(37.5%)	14	NA	NA
AYV94494.1|413282_413987_+	acylneuraminate cytidylyltransferase family protein	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	30.5	5.6e-16
AYV94495.1|414041_414935_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	60.8	3.2e-101
AYV94496.1|414913_415489_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	41.2	7.6e-35
AYV94497.1|415485_416325_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	29.5	9.4e-18
AYV94498.1|416321_417422_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	40.6	1.1e-66
AYV94499.1|417439_417808_-	M15 family peptidase	NA	A9DET4	Yersinia_phage	47.1	7.0e-26
AYV94500.1|417818_418004_-	DNA-binding protein	NA	NA	NA	NA	NA
AYV94501.1|418008_418371_-	DUF1353 domain-containing protein	NA	X2KQ25	Campylobacter_phage	38.1	6.3e-11
AYV94502.1|418523_418769_+	DNA-binding protein	NA	NA	NA	NA	NA
AYV94503.1|418879_419173_+	hypothetical protein	NA	NA	NA	NA	NA
AYV94504.1|419193_419868_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
AYV94505.1|419864_420182_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94506.1|420331_421060_+	hypothetical protein	NA	NA	NA	NA	NA
AYV94507.1|421345_421858_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	28.8	6.3e-09
>prophage 3
CP019306	Fusobacterium necrophorum subsp. funduliforme strain F1260 chromosome, complete genome	2288480	563279	595100	2288480	holin,head,transposase,terminase	Fusobacterium_phage(69.23%)	52	NA	NA
AYV94625.1|563279_564707_-|transposase	transposase	transposase	A0A0H3UZK2	Geobacillus_virus	51.9	3.9e-125
AYV94626.1|564717_565119_-|transposase	IS200/IS605 family transposase	transposase	A0A0A8WIU6	Clostridium_phage	48.0	2.5e-24
AYV94627.1|565748_566006_+	hypothetical protein	NA	NA	NA	NA	NA
AYV96211.1|566019_566484_-|holin	holin	holin	D7RWK5	Brochothrix_phage	31.0	2.3e-05
AYV94628.1|566503_566953_-	DUF1353 domain-containing protein	NA	A0A0E3Y4V5	Fusobacterium_phage	47.0	1.3e-21
AYV94629.1|566962_567247_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94630.1|567260_567725_-	M15 family peptidase	NA	A0A2L0V0S8	Agrobacterium_phage	37.5	2.8e-16
AYV94631.1|567735_568416_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
AYV94632.1|568427_569321_-	hypothetical protein	NA	A0A0E3Y6G8	Fusobacterium_phage	39.6	1.0e-09
AYV94633.1|569324_569852_-	hypothetical protein	NA	A0A0E3Y5G1	Fusobacterium_phage	54.1	3.9e-46
AYV94634.1|569852_570995_-	hypothetical protein	NA	A0A0E3Y634	Fusobacterium_phage	61.6	5.4e-133
AYV94635.1|570991_571330_-	hypothetical protein	NA	A0A0E3U2P9	Fusobacterium_phage	62.2	6.6e-31
AYV94636.1|571338_571986_-	hypothetical protein	NA	A0A0E3U262	Fusobacterium_phage	73.4	3.1e-61
AYV94637.1|571982_572840_-	hypothetical protein	NA	A0A0E3Y4V7	Fusobacterium_phage	68.8	1.4e-93
AYV94638.1|572839_573160_-	hypothetical protein	NA	A0A0E3Y6B2	Fusobacterium_phage	63.8	2.3e-33
AYV94639.1|573175_573757_-	hypothetical protein	NA	A0A0E3U263	Fusobacterium_phage	49.7	4.6e-40
AYV94640.1|573758_575456_-	hypothetical protein	NA	A0A0E3Y5G6	Fusobacterium_phage	50.8	2.1e-109
AYV94641.1|575602_576052_-	hypothetical protein	NA	A0A0E3Y638	Fusobacterium_phage	38.5	1.4e-23
AYV94642.1|576014_576242_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94643.1|576249_576672_-	DUF3277 family protein	NA	A0A0E3Y4V9	Fusobacterium_phage	44.4	6.8e-25
AYV94644.1|576687_577677_-	hypothetical protein	NA	A0A0E3U2Q2	Fusobacterium_phage	65.0	6.8e-116
AYV94645.1|577689_578250_-	hypothetical protein	NA	A0A0E3U264	Fusobacterium_phage	39.8	7.4e-27
AYV94646.1|578239_578578_-	hypothetical protein	NA	A0A0E3Y6B6	Fusobacterium_phage	38.7	3.2e-17
AYV94647.1|578577_579036_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94648.1|579046_579445_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94649.1|579441_579681_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94650.1|579690_580800_-	hypothetical protein	NA	A0A2H4J2M3	uncultured_Caudovirales_phage	31.5	7.8e-36
AYV94651.1|580803_581409_-	hypothetical protein	NA	A0A0E3U265	Fusobacterium_phage	33.2	3.4e-17
AYV94652.1|581401_582223_-|head	phage head morphogenesis protein	head	A0A0E3Y641	Fusobacterium_phage	43.3	1.2e-52
AYV94653.1|582197_583691_-	hypothetical protein	NA	A0A0E3Y4W1	Fusobacterium_phage	41.4	2.8e-105
AYV94654.1|583804_585112_-|terminase	PBSX family phage terminase large subunit	terminase	S6AVV7	Thermus_phage	53.1	1.2e-120
AYV94655.1|585062_585473_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYV94656.1|585599_586067_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94657.1|586077_586260_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94658.1|586306_586618_-	hypothetical protein	NA	NA	NA	NA	NA
AYV96212.1|586668_586878_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94659.1|587637_587874_-	DNA-binding protein	NA	NA	NA	NA	NA
AYV94660.1|587926_588838_-	DNA methyltransferase	NA	NA	NA	NA	NA
AYV94661.1|589079_589385_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94662.1|589350_589956_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AYV94663.1|589958_590174_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94664.1|590176_590461_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94665.1|590457_590793_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94666.1|590794_591379_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94667.1|591375_591729_-	DUF4406 domain-containing protein	NA	NA	NA	NA	NA
AYV94668.1|591725_592112_-	DUF1018 domain-containing protein	NA	NA	NA	NA	NA
AYV94669.1|592113_592764_-	DUF3164 family protein	NA	NA	NA	NA	NA
AYV94670.1|592753_593005_-	hypothetical protein	NA	NA	NA	NA	NA
AYV96213.1|593006_593537_-	DUF1874 domain-containing protein	NA	A0A0N9P6N7	Acidianus_rod-shaped_virus	35.8	1.3e-09
AYV94671.1|593686_593914_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94672.1|593923_594115_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94673.1|594125_595100_-|transposase	transposase	transposase	A0A2I7S9C3	Vibrio_phage	27.9	3.2e-17
>prophage 4
CP019306	Fusobacterium necrophorum subsp. funduliforme strain F1260 chromosome, complete genome	2288480	624467	639789	2288480	head,terminase	Fusobacterium_phage(18.18%)	22	NA	NA
AYV94704.1|624467_624902_-	antitoxin HicB	NA	A0A1L2JY34	Aeribacillus_phage	36.4	5.7e-11
AYV94705.1|624941_625124_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	69.5	9.1e-19
AYV94706.1|625219_625408_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94707.1|625447_625813_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94708.1|625814_626348_-	Rha family transcriptional regulator	NA	A0A0E3Y6H2	Fusobacterium_phage	41.3	7.3e-24
AYV94709.1|626890_627352_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94710.1|627365_628826_-	DUF4041 domain-containing protein	NA	X5JAC1	Clostridium_phage	50.9	5.6e-58
AYV94711.1|628940_629519_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94712.1|629754_630336_-	phage virion morphogenesis protein	NA	B7SDN8	Haemophilus_phage	35.6	2.0e-06
AYV94713.1|630346_630586_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94714.1|630595_633163_-|head	phage head morphogenesis protein	head	M1PF56	Streptococcus_phage	34.6	1.6e-12
AYV96215.1|633174_634467_-|terminase	PBSX family phage terminase large subunit	terminase	E5DV50	Deep-sea_thermophilic_phage	48.1	2.9e-111
AYV94715.1|634541_634892_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94716.1|634873_635806_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYV94717.1|636056_636311_-	DUF3310 domain-containing protein	NA	A1EAD4	Streptococcus_phage	39.5	1.0e-07
AYV94718.1|636286_637090_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94719.1|637070_637886_-	phage antirepressor Ant	NA	A0A0A8WIE3	Clostridium_phage	38.5	8.2e-35
AYV94720.1|637920_638325_-	hypothetical protein	NA	A0A2I2L3K7	Orpheovirus	45.9	4.4e-21
AYV94721.1|638338_638539_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94722.1|638557_639037_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94723.1|639058_639304_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94724.1|639300_639789_-	chromosome partitioning protein ParB	NA	A0A0E3U266	Fusobacterium_phage	59.8	3.9e-40
>prophage 5
CP019306	Fusobacterium necrophorum subsp. funduliforme strain F1260 chromosome, complete genome	2288480	1197025	1204740	2288480		Prochlorococcus_phage(42.86%)	8	NA	NA
AYV95216.1|1197025_1197646_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	35.0	2.5e-20
AYV95217.1|1197816_1199043_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
AYV95218.1|1199060_1200563_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase PurH	NA	Q58MG4	Prochlorococcus_phage	45.9	2.7e-68
AYV95219.1|1200564_1201125_-	phosphoribosylglycinamide formyltransferase	NA	R9S626	Prochlorococcus_phage	35.7	2.2e-23
AYV95220.1|1201112_1202129_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.2	1.4e-68
AYV95221.1|1202142_1203492_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.3	1.5e-44
AYV95222.1|1203519_1204236_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HI61	Synechococcus_phage	41.9	5.2e-41
AYV95223.1|1204263_1204740_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	47.4	8.8e-29
>prophage 6
CP019306	Fusobacterium necrophorum subsp. funduliforme strain F1260 chromosome, complete genome	2288480	1771374	1779592	2288480	integrase	Streptococcus_phage(50.0%)	8	1764084:1764099	1791480:1791495
1764084:1764099	attL	AAAGAAGAAAAAGAAA	NA	NA	NA	NA
AYV95671.1|1771374_1772790_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	1.4e-13
AYV95672.1|1772793_1774500_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.2	1.2e-30
AYV95673.1|1774501_1776244_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.7	2.5e-28
AYV95674.1|1776357_1776558_+	conjugal transfer protein	NA	NA	NA	NA	NA
AYV96253.1|1777015_1777459_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	33.6	1.1e-12
AYV95675.1|1777439_1777691_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYV95676.1|1778122_1778326_+	excisionase	NA	A0A1S5SF07	Streptococcus_phage	82.1	1.3e-26
AYV95677.1|1778401_1779592_+|integrase	site-specific integrase	integrase	A0A1S5SEW7	Streptococcus_phage	62.3	5.8e-138
1791480:1791495	attR	AAAGAAGAAAAAGAAA	NA	NA	NA	NA
>prophage 7
CP019306	Fusobacterium necrophorum subsp. funduliforme strain F1260 chromosome, complete genome	2288480	1814403	1887155	2288480	capsid,tail,terminase,protease,tRNA,portal,plate,head,integrase	Clostridium_phage(32.0%)	82	1834294:1834340	1868619:1868665
AYV95710.1|1814403_1815678_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.0	2.7e-93
AYV95711.1|1815671_1816286_-	DUF2344 domain-containing protein	NA	NA	NA	NA	NA
AYV95712.1|1816358_1817360_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AYV95713.1|1817381_1817861_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
AYV95714.1|1817901_1820025_-	outer membrane protein assembly factor	NA	NA	NA	NA	NA
AYV95715.1|1820095_1824115_-	hypothetical protein	NA	NA	NA	NA	NA
AYV95716.1|1824130_1824835_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
AYV95717.1|1824836_1826729_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
AYV95718.1|1826746_1827406_-	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
AYV95719.1|1827419_1828754_-	potassium transporter KtrB	NA	NA	NA	NA	NA
AYV95720.1|1828768_1829995_-	peptidase T	NA	NA	NA	NA	NA
AYV95721.1|1829991_1831371_-	MATE family efflux transporter	NA	NA	NA	NA	NA
AYV95722.1|1831385_1832966_-	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
AYV95723.1|1832958_1833762_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
AYV95724.1|1833916_1834162_+	hypothetical protein	NA	NA	NA	NA	NA
1834294:1834340	attL	TATAACGTTTCCTTAAATTTTAGTTTTAATTTCTACGAAAAGAAAAG	NA	NA	NA	NA
AYV95725.1|1834490_1835516_-|integrase	site-specific integrase	integrase	A0A0E3Y5J2	Fusobacterium_phage	35.8	3.1e-47
AYV95726.1|1835648_1835921_-	hypothetical protein	NA	NA	NA	NA	NA
AYV96255.1|1836153_1836669_-	hypothetical protein	NA	A0A0F6N4L7	Staphylococcus_phage	31.2	7.5e-10
AYV95727.1|1836691_1837123_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
AYV95728.1|1837132_1837753_-	XRE family transcriptional regulator	NA	B5WZL2	Staphylococcus_phage	74.2	1.1e-18
AYV95729.1|1837932_1838133_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYV95730.1|1838168_1838357_+	hypothetical protein	NA	NA	NA	NA	NA
AYV95731.1|1838759_1839548_+	phage antirepressor Ant	NA	A0A0A8WIE3	Clostridium_phage	39.8	4.7e-35
AYV95732.1|1839603_1839840_+	hypothetical protein	NA	NA	NA	NA	NA
AYV95733.1|1839874_1840132_+	hypothetical protein	NA	NA	NA	NA	NA
AYV95734.1|1840279_1840492_+	hypothetical protein	NA	NA	NA	NA	NA
AYV95735.1|1840566_1840752_+	hypothetical protein	NA	NA	NA	NA	NA
AYV95736.1|1840753_1841845_+	hypothetical protein	NA	A0A139ZPJ9	Marinitoga_camini_virus	40.6	2.1e-33
AYV95737.1|1842837_1843320_+	hypothetical protein	NA	NA	NA	NA	NA
AYV95738.1|1843421_1844147_+	3'-phosphoadenosine 5'-phosphosulfate sulfotransferase (PAPS reductase)/FAD synthetase	NA	Q24LD4	Clostridium_phage	42.2	4.9e-23
AYV95739.1|1844133_1844538_+	hypothetical protein	NA	A0A0E3Y6C4	Fusobacterium_phage	33.3	2.0e-13
AYV95740.1|1844537_1844756_+	hypothetical protein	NA	NA	NA	NA	NA
AYV95741.1|1844748_1845021_+	hypothetical protein	NA	NA	NA	NA	NA
AYV95742.1|1845274_1845499_+	hypothetical protein	NA	NA	NA	NA	NA
AYV95743.1|1845495_1845795_+	hypothetical protein	NA	NA	NA	NA	NA
AYV95744.1|1845791_1846220_+	hypothetical protein	NA	NA	NA	NA	NA
AYV95745.1|1846203_1846431_+	hypothetical protein	NA	NA	NA	NA	NA
AYV95746.1|1846992_1847727_+	hypothetical protein	NA	NA	NA	NA	NA
AYV95747.1|1847728_1848538_+	AAA family ATPase	NA	A0A2K9V3L7	Faecalibacterium_phage	33.3	3.0e-21
AYV95748.1|1848534_1848918_+	hypothetical protein	NA	A0A2I2L3K7	Orpheovirus	48.4	1.7e-22
AYV95749.1|1848917_1849340_+	DUF1492 domain-containing protein	NA	A0A2K5B275	Erysipelothrix_phage	31.5	8.3e-07
AYV95750.1|1849619_1850024_+	endonuclease	NA	I2E8Y8	Clostridium_phage	33.3	2.7e-07
AYV95751.1|1850198_1850690_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
AYV95752.1|1850693_1852400_+|terminase	terminase large subunit	terminase	A0A0A7RVS5	Clostridium_phage	48.9	1.8e-156
AYV95753.1|1852424_1853648_+|portal	phage portal protein	portal	A6M949	Geobacillus_virus	46.5	2.5e-96
AYV95754.1|1853640_1854381_+|protease	Clp protease ClpP	protease	J9QE31	Clostridium_phage	38.5	1.6e-37
AYV95755.1|1854383_1855499_+|capsid	phage major capsid protein	capsid	A0A288WGE9	Bacillus_phage	33.1	4.3e-42
AYV95756.1|1855509_1855791_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0A7RUM3	Clostridium_phage	44.4	7.5e-12
AYV95757.1|1855791_1856127_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AYV95758.1|1856130_1856562_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
AYV95759.1|1856561_1856996_+	hypothetical protein	NA	NA	NA	NA	NA
AYV95760.1|1857006_1858074_+|tail	phage tail sheath protein	tail	A0A0A8WJL8	Clostridium_phage	35.1	1.6e-54
AYV95761.1|1858086_1858521_+|terminase	terminase	terminase	NA	NA	NA	NA
AYV95762.1|1858539_1858953_+|portal	phage portal protein	portal	NA	NA	NA	NA
AYV95763.1|1859661_1859844_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
AYV95764.1|1859894_1861763_+	hypothetical protein	NA	A0A0E3Y5G6	Fusobacterium_phage	32.2	3.2e-26
AYV95765.1|1861775_1862216_+|portal	phage portal protein	portal	NA	NA	NA	NA
AYV95766.1|1862208_1863189_+|terminase	terminase	terminase	NA	NA	NA	NA
AYV95767.1|1863181_1863718_+	DUF2577 domain-containing protein	NA	NA	NA	NA	NA
AYV95768.1|1863696_1864149_+	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
AYV95769.1|1864145_1865204_+|plate	baseplate J/gp47 family protein	plate	A0A0A7RUN3	Clostridium_phage	42.0	9.0e-66
AYV95770.1|1865204_1865774_+	DUF2313 domain-containing protein	NA	A0A2H4J1P4	uncultured_Caudovirales_phage	35.8	1.8e-12
AYV95771.1|1865766_1866507_+	hypothetical protein	NA	NA	NA	NA	NA
AYV95772.1|1866522_1867053_+	DUF2977 domain-containing protein	NA	NA	NA	NA	NA
AYV95773.1|1867126_1867498_+	M15 family peptidase	NA	A9DET4	Yersinia_phage	54.6	9.2e-34
AYV95774.1|1867502_1867979_+	hypothetical protein	NA	NA	NA	NA	NA
AYV95775.1|1867988_1868246_+	hypothetical protein	NA	NA	NA	NA	NA
AYV95776.1|1868852_1869629_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.1	1.8e-15
1868619:1868665	attR	TATAACGTTTCCTTAAATTTTAGTTTTAATTTCTACGAAAAGAAAAG	NA	NA	NA	NA
AYV95777.1|1869628_1870663_-	iron ABC transporter permease	NA	NA	NA	NA	NA
AYV95778.1|1870716_1872198_-	FMN-binding protein	NA	A0A2P0ZL82	Lactobacillus_phage	36.2	3.4e-10
AYV95779.1|1872369_1873131_-	hypothetical protein	NA	NA	NA	NA	NA
AYV96256.1|1873127_1874516_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
AYV95780.1|1874808_1875015_-	hypothetical protein	NA	NA	NA	NA	NA
AYV95781.1|1875044_1878626_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
AYV95782.1|1878747_1879950_-	acetate kinase	NA	NA	NA	NA	NA
AYV95783.1|1879974_1880988_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
AYV95784.1|1881082_1882126_-	signal recognition particle-docking protein FtsY	NA	D6PHS7	uncultured_phage	36.4	1.2e-14
AYV95785.1|1882109_1883534_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
AYV95786.1|1883548_1883941_-	hypothetical protein	NA	NA	NA	NA	NA
AYV95787.1|1883937_1885026_-	ribosome biogenesis GTPase YqeH	NA	NA	NA	NA	NA
AYV95788.1|1885040_1885829_-	recombinase XerD	NA	NA	NA	NA	NA
AYV95789.1|1885847_1887155_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
>prophage 8
CP019306	Fusobacterium necrophorum subsp. funduliforme strain F1260 chromosome, complete genome	2288480	1902693	1912037	2288480		uncultured_phage(28.57%)	8	NA	NA
AYV95806.1|1902693_1906911_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	29.4	7.1e-21
AYV95807.1|1907019_1907811_-	M48 family peptidase	NA	NA	NA	NA	NA
AYV95808.1|1908143_1908587_+	6-carboxytetrahydropterin synthase QueD	NA	J9PV91	Bacillus_phage	30.2	1.4e-07
AYV95809.1|1908573_1909242_+	putative 7-carboxy-7-deazaguanine synthase QueE	NA	S4TZT1	uncultured_phage	47.5	1.2e-44
AYV95810.1|1909242_1909818_+	GTP cyclohydrolase I FolE	NA	S4U0J3	uncultured_phage	52.3	3.6e-45
AYV95811.1|1909826_1910522_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A1U9WRB5	Streptococcus_virus	56.0	2.9e-65
AYV95812.1|1910522_1911005_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	72.9	4.8e-51
AYV95813.1|1911068_1912037_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.8	2.3e-31
>prophage 9
CP019306	Fusobacterium necrophorum subsp. funduliforme strain F1260 chromosome, complete genome	2288480	2067036	2073325	2288480		Fusobacterium_phage(33.33%)	11	NA	NA
AYV95976.1|2067036_2067354_-	ImmA/IrrE family metallo-endopeptidase	NA	A8ATJ8	Listeria_phage	43.0	5.9e-05
AYV95977.1|2067459_2067918_-	XRE family transcriptional regulator	NA	A0A0E3U270	Fusobacterium_phage	31.9	3.4e-06
AYV95978.1|2068085_2068289_+	hypothetical protein	NA	NA	NA	NA	NA
AYV95979.1|2068290_2068527_+	hypothetical protein	NA	NA	NA	NA	NA
AYV95980.1|2068711_2069422_+	polymer-forming cytoskeletal protein	NA	K4JTL7	Streptococcus_phage	52.8	3.1e-06
AYV95981.1|2069605_2070382_+	hypothetical protein	NA	F7V9C4	Lactobacillus_virus	44.5	3.9e-18
AYV95982.1|2070564_2071296_+	hypothetical protein	NA	NA	NA	NA	NA
AYV95983.1|2071288_2071630_+	hypothetical protein	NA	NA	NA	NA	NA
AYV95984.1|2071642_2072107_+	hypothetical protein	NA	NA	NA	NA	NA
AYV95985.1|2072208_2072934_+	3'-phosphoadenosine 5'-phosphosulfate sulfotransferase (PAPS reductase)/FAD synthetase	NA	Q24LD4	Clostridium_phage	42.2	4.9e-23
AYV95986.1|2072920_2073325_+	hypothetical protein	NA	A0A0E3Y6C4	Fusobacterium_phage	33.3	2.0e-13
