The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP018196	Fusobacterium necrophorum subsp. funduliforme strain F1291 chromosome, complete genome	2135983	350533	355155	2135983		Enterobacteria_phage(33.33%)	6	NA	NA
AYV92482.1|350533_351238_+	acylneuraminate cytidylyltransferase family protein	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	30.1	1.1e-14
AYV92483.1|351388_352282_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	61.5	3.2e-101
AYV92484.1|352260_352836_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	40.7	2.9e-34
AYV92485.1|352832_353672_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	29.7	7.7e-20
AYV92486.1|353668_354769_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	40.4	9.9e-68
AYV92487.1|354786_355155_-	M15 family peptidase	NA	A9DET4	Yersinia_phage	47.9	8.3e-27
>prophage 2
CP018196	Fusobacterium necrophorum subsp. funduliforme strain F1291 chromosome, complete genome	2135983	415950	439576	2135983	portal,terminase,head	Clostridium_phage(29.41%)	27	NA	NA
AYV92541.1|415950_416556_+	transcriptional regulator	NA	A0A1I9KFA9	Aeromonas_phage	33.6	1.3e-08
AYV92542.1|416769_417006_+	hypothetical protein	NA	NA	NA	NA	NA
AYV92543.1|417173_417371_+	DNA-binding protein	NA	NA	NA	NA	NA
AYV92544.1|417489_417756_+	hypothetical protein	NA	NA	NA	NA	NA
AYV92545.1|417906_418680_+	hypothetical protein	NA	NA	NA	NA	NA
AYV92546.1|418681_419137_+	hypothetical protein	NA	NA	NA	NA	NA
AYV92547.1|419136_420306_+	DUF2800 domain-containing protein	NA	H7BVP9	unidentified_phage	45.3	2.0e-87
AYV92548.1|420329_420908_+	DUF2815 family protein	NA	S5MC21	Brevibacillus_phage	47.5	4.3e-38
AYV92549.1|420953_422924_+	hypothetical protein	NA	H7BVQ1	unidentified_phage	55.1	1.1e-207
AYV92550.1|422933_423176_+	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	56.4	5.6e-16
AYV92551.1|423178_423826_+	HNH endonuclease	NA	A0A2H4JIA5	uncultured_Caudovirales_phage	32.0	3.6e-25
AYV92552.1|423782_424370_+	hypothetical protein	NA	A0A0E3U2M3	Fusobacterium_phage	36.3	4.4e-30
AYV92553.1|424366_425020_+	DUF3310 domain-containing protein	NA	Q7Y4J5	Streptococcus_phage	46.8	2.5e-10
AYV92554.1|425041_427486_+	virulence-associated protein E	NA	A0A0A7RTG3	Clostridium_phage	42.6	1.5e-185
AYV92555.1|427792_428086_+	VRR-NUC domain-containing protein	NA	A0A2I7QIL0	Bacillus_phage	50.6	2.6e-15
AYV92556.1|428099_429479_+	DEAD/DEAH box helicase	NA	S5MA26	Brevibacillus_phage	54.9	2.4e-143
AYV92557.1|429475_429688_+	hypothetical protein	NA	NA	NA	NA	NA
AYV92558.1|429698_430223_+	hypothetical protein	NA	NA	NA	NA	NA
AYV92559.1|430380_431205_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AYV92560.1|431412_431931_+|terminase	terminase small subunit	terminase	A0A0A0RSW5	Bacillus_phage	37.8	3.2e-24
AYV92561.1|431917_433324_+|terminase	terminase	terminase	A0A090EUA8	Clostridium_phage	73.7	3.0e-194
AYV92562.1|433336_434731_+|portal	phage portal protein	portal	A0A0A7S074	Clostridium_phage	39.4	1.2e-89
AYV92563.1|434717_436307_+|head	phage head morphogenesis protein	head	A0A0A8WIE7	Clostridium_phage	44.2	3.9e-73
AYV92564.1|436299_436581_+	hypothetical protein	NA	NA	NA	NA	NA
AYV92565.1|436555_437062_+	hypothetical protein	NA	NA	NA	NA	NA
AYV92566.1|437373_437979_+	hypothetical protein	NA	I1TLE1	Bacillus_phage	39.0	3.2e-20
AYV92567.1|439186_439576_+	hypothetical protein	NA	A0A0A8WIE8	Clostridium_phage	40.6	8.8e-19
>prophage 3
CP018196	Fusobacterium necrophorum subsp. funduliforme strain F1291 chromosome, complete genome	2135983	1060129	1067843	2135983		Prochlorococcus_phage(42.86%)	8	NA	NA
AYV93076.1|1060129_1060750_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	36.0	4.3e-20
AYV93077.1|1060919_1062146_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
AYV93078.1|1062163_1063666_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase PurH	NA	Q58MG4	Prochlorococcus_phage	46.2	9.4e-69
AYV93079.1|1063667_1064228_-	phosphoribosylglycinamide formyltransferase	NA	R9S626	Prochlorococcus_phage	35.7	5.0e-23
AYV93080.1|1064215_1065232_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.2	1.4e-68
AYV93081.1|1065245_1066595_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	6.5e-45
AYV93082.1|1066622_1067339_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3HI61	Synechococcus_phage	41.9	5.2e-41
AYV93083.1|1067366_1067843_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	47.4	5.1e-29
>prophage 4
CP018196	Fusobacterium necrophorum subsp. funduliforme strain F1291 chromosome, complete genome	2135983	1657941	1730625	2135983	head,integrase,tRNA,tail,capsid,protease,portal,terminase,plate	Clostridium_phage(32.0%)	81	1677831:1677877	1712108:1712154
AYV93543.1|1657941_1659216_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.0	3.6e-93
AYV93544.1|1659209_1659824_-	DUF2344 domain-containing protein	NA	NA	NA	NA	NA
AYV93545.1|1659896_1660898_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AYV93546.1|1660919_1661399_-	OmpH family outer membrane protein	NA	NA	NA	NA	NA
AYV93547.1|1661439_1663563_-	outer membrane protein assembly factor	NA	NA	NA	NA	NA
AYV93548.1|1663633_1667653_-	hypothetical protein	NA	NA	NA	NA	NA
AYV93549.1|1667668_1668373_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
AYV93550.1|1668374_1670267_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
AYV93551.1|1670284_1670944_-	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
AYV93552.1|1670957_1672292_-	potassium transporter KtrB	NA	NA	NA	NA	NA
AYV93553.1|1672306_1673533_-	peptidase T	NA	NA	NA	NA	NA
AYV93554.1|1673529_1674909_-	MATE family efflux transporter	NA	NA	NA	NA	NA
AYV93555.1|1674923_1676504_-	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
AYV93556.1|1676496_1677300_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
AYV93557.1|1677454_1677700_+	hypothetical protein	NA	NA	NA	NA	NA
1677831:1677877	attL	TATAACGTTTCCTTAAATTTTAGTTTTAATTTCTACGAAAAGAAAAG	NA	NA	NA	NA
AYV93558.1|1678027_1679053_-|integrase	site-specific integrase	integrase	A0A0E3Y5J2	Fusobacterium_phage	35.8	3.1e-47
AYV93559.1|1679185_1679458_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94088.1|1679690_1680206_-	hypothetical protein	NA	A0A0F6N4L7	Staphylococcus_phage	31.2	7.5e-10
AYV93560.1|1680228_1680660_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
AYV93561.1|1680669_1681290_-	XRE family transcriptional regulator	NA	B5WZL2	Staphylococcus_phage	74.2	1.1e-18
AYV93562.1|1681469_1681670_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYV93563.1|1681705_1681894_+	hypothetical protein	NA	NA	NA	NA	NA
AYV93564.1|1682296_1683085_+	phage antirepressor Ant	NA	A0A0A8WIE3	Clostridium_phage	39.8	4.7e-35
AYV93565.1|1683140_1683377_+	hypothetical protein	NA	NA	NA	NA	NA
AYV93566.1|1683411_1683669_+	hypothetical protein	NA	NA	NA	NA	NA
AYV93567.1|1683816_1684029_+	hypothetical protein	NA	NA	NA	NA	NA
AYV93568.1|1684103_1684289_+	hypothetical protein	NA	NA	NA	NA	NA
AYV93569.1|1684290_1685382_+	hypothetical protein	NA	A0A139ZPJ9	Marinitoga_camini_virus	40.6	2.1e-33
AYV93570.1|1686374_1686857_+	hypothetical protein	NA	NA	NA	NA	NA
AYV93571.1|1686958_1687684_+	3'-phosphoadenosine 5'-phosphosulfate sulfotransferase (PAPS reductase)/FAD synthetase	NA	Q24LD4	Clostridium_phage	42.2	4.9e-23
AYV93572.1|1687670_1688075_+	hypothetical protein	NA	A0A0E3Y6C4	Fusobacterium_phage	33.3	2.0e-13
AYV93573.1|1688074_1688293_+	hypothetical protein	NA	NA	NA	NA	NA
AYV93574.1|1688285_1688558_+	hypothetical protein	NA	NA	NA	NA	NA
AYV93575.1|1688811_1689036_+	hypothetical protein	NA	NA	NA	NA	NA
AYV93576.1|1689032_1689332_+	hypothetical protein	NA	NA	NA	NA	NA
AYV93577.1|1689328_1689757_+	hypothetical protein	NA	NA	NA	NA	NA
AYV93578.1|1689740_1689968_+	hypothetical protein	NA	NA	NA	NA	NA
AYV93579.1|1690529_1691216_+	hypothetical protein	NA	NA	NA	NA	NA
AYV93580.1|1691217_1692027_+	AAA family ATPase	NA	A0A2K9V3L7	Faecalibacterium_phage	33.3	3.0e-21
AYV93581.1|1692023_1692407_+	hypothetical protein	NA	A0A2I2L3K7	Orpheovirus	48.4	1.7e-22
AYV93582.1|1692406_1692829_+	DUF1492 domain-containing protein	NA	A0A2K5B275	Erysipelothrix_phage	31.5	8.3e-07
AYV93583.1|1693108_1693513_+	endonuclease	NA	I2E8Y8	Clostridium_phage	33.3	2.7e-07
AYV93584.1|1693687_1694179_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
AYV93585.1|1694182_1695889_+|terminase	terminase large subunit	terminase	A0A0A7RVS5	Clostridium_phage	48.9	1.8e-156
AYV93586.1|1695913_1697137_+|portal	phage portal protein	portal	A6M949	Geobacillus_virus	46.5	2.5e-96
AYV93587.1|1697129_1697870_+|protease	Clp protease ClpP	protease	J9QE31	Clostridium_phage	38.5	1.6e-37
AYV93588.1|1697872_1698988_+|capsid	phage major capsid protein	capsid	A0A288WGE9	Bacillus_phage	33.1	4.3e-42
AYV93589.1|1698998_1699280_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0A7RUM3	Clostridium_phage	44.4	7.5e-12
AYV93590.1|1699280_1699616_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
AYV93591.1|1699619_1700051_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
AYV93592.1|1700050_1700485_+	hypothetical protein	NA	NA	NA	NA	NA
AYV93593.1|1700495_1701563_+|tail	phage tail sheath protein	tail	A0A0A8WJL8	Clostridium_phage	35.1	1.6e-54
AYV93594.1|1701575_1702010_+|terminase	terminase	terminase	NA	NA	NA	NA
AYV93595.1|1702028_1702442_+|portal	phage portal protein	portal	NA	NA	NA	NA
AYV93596.1|1703150_1703333_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
AYV93597.1|1703383_1705252_+	hypothetical protein	NA	A0A0E3Y5G6	Fusobacterium_phage	32.2	3.2e-26
AYV93598.1|1705264_1705705_+|portal	phage portal protein	portal	NA	NA	NA	NA
AYV93599.1|1705697_1706678_+|terminase	terminase	terminase	NA	NA	NA	NA
AYV93600.1|1706670_1707207_+	DUF2577 domain-containing protein	NA	NA	NA	NA	NA
AYV93601.1|1707185_1707638_+	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
AYV93602.1|1707634_1708693_+|plate	baseplate J/gp47 family protein	plate	A0A0A7RUN3	Clostridium_phage	42.0	9.0e-66
AYV93603.1|1708693_1709263_+	DUF2313 domain-containing protein	NA	A0A2H4J1P4	uncultured_Caudovirales_phage	35.8	1.8e-12
AYV93604.1|1709255_1709996_+	hypothetical protein	NA	NA	NA	NA	NA
AYV93605.1|1710011_1710542_+	DUF2977 domain-containing protein	NA	NA	NA	NA	NA
AYV93606.1|1710615_1710987_+	M15 family peptidase	NA	A9DET4	Yersinia_phage	54.6	9.2e-34
AYV93607.1|1710991_1711468_+	hypothetical protein	NA	NA	NA	NA	NA
AYV93608.1|1711477_1711735_+	hypothetical protein	NA	NA	NA	NA	NA
AYV93609.1|1712340_1713117_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.1	1.8e-15
1712108:1712154	attR	TATAACGTTTCCTTAAATTTTAGTTTTAATTTCTACGAAAAGAAAAG	NA	NA	NA	NA
AYV93610.1|1713116_1714151_-	iron ABC transporter permease	NA	NA	NA	NA	NA
AYV93611.1|1714204_1715668_-	FMN-binding protein	NA	A0A2P0ZL82	Lactobacillus_phage	35.4	7.4e-10
AYV93612.1|1715839_1716601_-	hypothetical protein	NA	NA	NA	NA	NA
AYV94089.1|1716597_1717986_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
AYV93613.1|1718514_1722096_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
AYV93614.1|1722217_1723420_-	acetate kinase	NA	NA	NA	NA	NA
AYV93615.1|1723444_1724458_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
AYV93616.1|1724552_1725596_-	signal recognition particle-docking protein FtsY	NA	D6PHS7	uncultured_phage	36.4	1.2e-14
AYV93617.1|1725579_1727004_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
AYV93618.1|1727018_1727411_-	hypothetical protein	NA	NA	NA	NA	NA
AYV93619.1|1727407_1728496_-	ribosome biogenesis GTPase YqeH	NA	NA	NA	NA	NA
AYV93620.1|1728510_1729299_-	recombinase XerD	NA	NA	NA	NA	NA
AYV93621.1|1729317_1730625_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
>prophage 5
CP018196	Fusobacterium necrophorum subsp. funduliforme strain F1291 chromosome, complete genome	2135983	1746115	1755459	2135983		uncultured_phage(28.57%)	8	NA	NA
AYV93638.1|1746115_1750333_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	29.4	7.1e-21
AYV93639.1|1750441_1751233_-	M48 family peptidase	NA	NA	NA	NA	NA
AYV93640.1|1751565_1752009_+	6-carboxytetrahydropterin synthase QueD	NA	J9PV91	Bacillus_phage	30.2	1.4e-07
AYV93641.1|1751995_1752664_+	putative 7-carboxy-7-deazaguanine synthase QueE	NA	S4TZT1	uncultured_phage	47.9	1.2e-44
AYV93642.1|1752664_1753240_+	GTP cyclohydrolase I FolE	NA	S4U0J3	uncultured_phage	52.3	3.6e-45
AYV93643.1|1753248_1753944_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A1U9WRB5	Streptococcus_virus	56.0	2.9e-65
AYV93644.1|1753944_1754427_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	72.9	6.3e-51
AYV93645.1|1754490_1755459_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.8	2.3e-31
>prophage 6
CP018196	Fusobacterium necrophorum subsp. funduliforme strain F1291 chromosome, complete genome	2135983	1913554	1921810	2135983		Listeria_phage(12.5%)	18	NA	NA
AYV93808.1|1913554_1913872_-	ImmA/IrrE family metallo-endopeptidase	NA	A8ATJ8	Listeria_phage	44.3	2.0e-05
AYV93809.1|1913977_1914415_-	XRE family transcriptional regulator	NA	I3VYZ1	Thermoanaerobacterium_phage	32.2	1.6e-05
AYV93810.1|1914594_1914798_+	hypothetical protein	NA	NA	NA	NA	NA
AYV93811.1|1914809_1915046_+	hypothetical protein	NA	NA	NA	NA	NA
AYV93812.1|1915230_1915743_+	polymer-forming cytoskeletal protein	NA	K4JTL7	Streptococcus_phage	52.0	3.3e-05
AYV93813.1|1915926_1916703_+	hypothetical protein	NA	F7V9C4	Lactobacillus_virus	44.5	3.9e-18
AYV93814.1|1916885_1917617_+	hypothetical protein	NA	NA	NA	NA	NA
AYV93815.1|1917773_1917953_+	hypothetical protein	NA	NA	NA	NA	NA
AYV93816.1|1917962_1918427_+	hypothetical protein	NA	NA	NA	NA	NA
AYV93817.1|1918528_1919254_+	3'-phosphoadenosine 5'-phosphosulfate sulfotransferase (PAPS reductase)/FAD synthetase	NA	Q24LD4	Clostridium_phage	42.2	4.9e-23
AYV93818.1|1919240_1919645_+	hypothetical protein	NA	A0A0E3Y6C4	Fusobacterium_phage	33.3	2.0e-13
AYV93819.1|1919644_1919863_+	hypothetical protein	NA	NA	NA	NA	NA
AYV93820.1|1919855_1920128_+	hypothetical protein	NA	NA	NA	NA	NA
AYV93821.1|1920209_1920623_+	hypothetical protein	NA	B4XYT8	Lactobacillus_phage	36.7	6.5e-12
AYV93822.1|1920606_1920819_+	hypothetical protein	NA	NA	NA	NA	NA
AYV93823.1|1920815_1921022_+	hypothetical protein	NA	NA	NA	NA	NA
AYV93824.1|1921018_1921294_+	hypothetical protein	NA	NA	NA	NA	NA
AYV94091.1|1921495_1921810_+	hypothetical protein	NA	A0A1L2JY27	Aeribacillus_phage	29.0	5.2e-06
