The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033606	Lactococcus lactis strain IL6288 chromosome, complete genome	2208218	13280	126262	2208218	tRNA,protease,bacteriocin,transposase	Bacillus_phage(26.09%)	105	NA	NA
AYV49772.1|13280_15272_+|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
AYV49773.1|15273_15909_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.0	3.9e-24
AYV49774.1|16109_16580_+	hypothetical protein	NA	A0A097BYE2	Leuconostoc_phage	30.1	4.0e-10
AYV49775.1|16597_17164_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AYV49776.1|17164_20650_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
AYV49777.1|20809_21280_+	hypothetical protein	NA	NA	NA	NA	NA
AYV49778.1|21350_21668_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
AYV49779.1|21696_22071_+	septum formation initiator family protein	NA	NA	NA	NA	NA
AYV49780.1|22070_22394_+	RNA-binding protein	NA	NA	NA	NA	NA
AYV49781.1|22531_23881_+	serine hydrolase	NA	NA	NA	NA	NA
AYV49782.1|23877_25149_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
AYV49783.1|25129_25681_+	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	29.7	1.8e-09
AYV49784.1|25886_27974_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	49.2	5.4e-107
AYV49785.1|30921_32859_+	transcription antiterminator	NA	NA	NA	NA	NA
AYV49786.1|32906_33338_+	PTS mannitol transporter subunit IIA	NA	NA	NA	NA	NA
AYV49787.1|33475_34633_+	mannitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
AYV49788.1|35250_35700_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYV49789.1|35776_36019_+	TM2 domain-containing protein	NA	NA	NA	NA	NA
AYV49790.1|38970_40118_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.0	2.3e-46
AYV49791.1|40669_41191_+	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	42.9	6.0e-31
AYV49792.1|41654_42830_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AYV49793.1|42928_43684_+	DNA repair protein RecO	NA	NA	NA	NA	NA
AYV49794.1|44041_45460_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.0	3.0e-40
AYV49795.1|45653_47252_-	dienelactone hydrolase	NA	NA	NA	NA	NA
AYV49796.1|47244_48225_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
AYV49797.1|48227_49352_-	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
AYV49798.1|49440_50442_-	lipoate--protein ligase	NA	NA	NA	NA	NA
AYV49799.1|50641_51487_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	31.0	1.7e-11
AYV49800.1|51567_52218_-	HD domain-containing protein	NA	A0A1S5XYU7	Kurlavirus	31.4	4.4e-15
AYV49801.1|52334_53360_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AYV49802.1|53861_54299_+	OsmC family peroxiredoxin	NA	NA	NA	NA	NA
AYV49803.1|54459_55773_+	APC family permease	NA	NA	NA	NA	NA
AYV49804.1|55832_56183_+	hypothetical protein	NA	NA	NA	NA	NA
AYV49805.1|56241_57237_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
AYV49806.1|57339_58152_-	HAD family hydrolase	NA	NA	NA	NA	NA
AYV49807.1|58277_59915_-	ABC-F family ATPase	NA	A0A2K9L3Z8	Tupanvirus	25.9	5.3e-49
AYV49808.1|61042_62323_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A2I2L687	Orpheovirus	26.9	1.4e-09
AYV49809.1|62549_63383_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AYV49810.1|63783_64251_+	universal stress protein	NA	NA	NA	NA	NA
AYV49811.1|64379_64577_+	DUF4649 domain-containing protein	NA	NA	NA	NA	NA
AYV49812.1|64607_65228_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYV49813.1|65278_66448_+	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
AYV49814.1|66458_67049_+	flavin reductase family protein	NA	NA	NA	NA	NA
AYV49815.1|67646_69794_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	26.5	7.2e-38
AYV49816.1|69808_71230_+	HlyD family secretion protein	NA	NA	NA	NA	NA
AYV49817.1|71323_71449_+	hypothetical protein	NA	NA	NA	NA	NA
AYV49818.1|71690_72143_+	transporter	NA	NA	NA	NA	NA
AYV49819.1|72181_72838_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYV49820.1|72940_73222_-	hypothetical protein	NA	NA	NA	NA	NA
AYV49821.1|73231_73384_-	hypothetical protein	NA	NA	NA	NA	NA
AYV49822.1|73722_73941_+	hypothetical protein	NA	NA	NA	NA	NA
AYV49823.1|74034_74172_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
AYV49824.1|74186_74897_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYV49825.1|75322_75775_+	transporter	NA	NA	NA	NA	NA
AYV49826.1|76121_77233_-|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	1.2e-49
AYV49827.1|77269_77875_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYV49828.1|79322_79691_+	hypothetical protein	NA	NA	NA	NA	NA
AYV49829.1|79910_80213_-	hypothetical protein	NA	NA	NA	NA	NA
AYV49830.1|80214_80382_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
AYV49831.1|80948_81098_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
AYV49832.1|81127_81301_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
AYV49833.1|81664_83446_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	29.1	3.8e-61
AYV49834.1|83498_84284_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
AYV49835.1|84338_85598_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	45.4	3.5e-93
AYV49836.1|85641_86130_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYV49837.1|86281_86749_+	DUF3013 family protein	NA	NA	NA	NA	NA
AYV49838.1|86778_88332_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	28.1	3.0e-46
AYV49839.1|88462_88747_+	hypothetical protein	NA	NA	NA	NA	NA
AYV49840.1|88784_89273_+	DUF1905 domain-containing protein	NA	NA	NA	NA	NA
AYV49841.1|89290_90244_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
AYV49842.1|90343_91096_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYV49843.1|91124_92081_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
AYV49844.1|92281_94504_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	U5J9N6	Bacillus_phage	28.3	2.9e-13
AYV49845.1|94519_95455_-	glycosyltransferase	NA	V9QJB1	Oenococcus_phage	49.7	1.3e-76
AYV49846.1|95645_96101_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
AYV49847.1|96093_97089_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
AYV49848.1|97091_97715_+	HAD family phosphatase	NA	NA	NA	NA	NA
AYV49849.1|97854_99264_+	amino acid permease	NA	NA	NA	NA	NA
AYV49850.1|99412_100054_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
AYV51702.1|100091_100583_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYV49851.1|100617_101262_-	FMN-dependent NADH-azoreductase 1	NA	NA	NA	NA	NA
AYV49852.1|101435_104033_+	protein translocase subunit SecA	NA	NA	NA	NA	NA
AYV49853.1|104161_105199_+	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	36.1	5.3e-47
AYV49854.1|105449_105716_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
AYV49855.1|105718_107446_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
AYV49856.1|107560_107875_+	hypothetical protein	NA	NA	NA	NA	NA
AYV49857.1|107915_108215_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
AYV49858.1|108602_109538_-	alpha/beta hydrolase	NA	W5S4D8	Pithovirus	26.0	1.1e-06
AYV49859.1|109746_110100_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
AYV49860.1|110221_111385_+	MFS transporter	NA	NA	NA	NA	NA
AYV51703.1|111826_113020_+	argininosuccinate synthase	NA	NA	NA	NA	NA
AYV49861.1|113050_114430_+	argininosuccinate lyase	NA	NA	NA	NA	NA
AYV49862.1|114445_115642_-	MFS transporter	NA	NA	NA	NA	NA
AYV49863.1|115836_116412_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYV51704.1|116563_116917_+	ribonuclease P protein component	NA	NA	NA	NA	NA
AYV49864.1|116913_117723_+	protein translocase component YidC	NA	NA	NA	NA	NA
AYV49865.1|117811_118726_+	protein jag	NA	NA	NA	NA	NA
AYV49866.1|118857_118992_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
AYV49867.1|120179_120500_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYV49868.1|120630_120858_+|bacteriocin	bacteriocin leader domain-containing protein	bacteriocin	NA	NA	NA	NA
AYV49869.1|121035_121581_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYV49870.1|121633_122314_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYV49871.1|122482_123629_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.0	2.3e-46
AYV49872.1|123686_125058_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.4	1.6e-54
AYV49873.1|125114_126262_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.0	2.3e-46
>prophage 2
CP033606	Lactococcus lactis strain IL6288 chromosome, complete genome	2208218	380462	392593	2208218		Streptococcus_phage(40.0%)	14	NA	NA
AYV50101.1|380462_380780_+	thioredoxin	NA	A0A0K2FIM3	Achromobacter_phage	30.4	4.5e-05
AYV50102.1|380865_381492_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
AYV50103.1|381654_382995_+	NADH oxidase	NA	NA	NA	NA	NA
AYV50104.1|383084_383474_+	single-stranded DNA-binding protein	NA	A0A0K0MWE1	Streptococcus_phage	45.0	1.4e-24
AYV50105.1|383593_383878_+	co-chaperone GroES	NA	A0A221S386	uncultured_virus	44.1	3.1e-13
AYV50106.1|383965_385594_+	molecular chaperone GroEL	NA	A0A219YK78	uncultured_virus	56.8	4.9e-156
AYV50107.1|385639_386452_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	38.1	3.1e-34
AYV50108.1|386622_388065_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	33.0	1.4e-32
AYV50109.1|388057_388759_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	39.7	1.2e-42
AYV50110.1|388936_389572_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	65.0	5.4e-74
AYV50111.1|389704_390565_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	45.2	5.0e-67
AYV50112.1|390616_391399_+	Signal peptidase	NA	NA	NA	NA	NA
AYV50113.1|391391_391718_+	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
AYV50114.1|391717_392593_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	65.4	8.7e-99
>prophage 3
CP033606	Lactococcus lactis strain IL6288 chromosome, complete genome	2208218	547995	585492	2208218	tRNA,integrase,protease,transposase	Bacillus_phage(35.71%)	32	567319:567378	586014:586125
AYV50255.1|547995_548880_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
AYV50256.1|548962_549631_+	hypothetical protein	NA	NA	NA	NA	NA
AYV50257.1|549801_550698_+	SPFH domain-containing protein	NA	A0A1V0SL90	Klosneuvirus	34.8	1.8e-35
AYV50258.1|551072_551333_+	hypothetical protein	NA	NA	NA	NA	NA
AYV50259.1|551690_552614_+	ribonuclease Z	NA	NA	NA	NA	NA
AYV50260.1|552606_553308_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AYV50261.1|553474_555703_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.4	1.3e-79
AYV50262.1|555780_556338_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.4	2.6e-32
AYV50263.1|556553_557117_+	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
AYV50264.1|557253_558906_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
AYV50265.1|558968_559439_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
AYV50266.1|559557_560705_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.0	2.3e-46
AYV50267.1|560778_562151_-|transposase	IS3-like element ISLla3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.1	2.3e-53
AYV51725.1|562350_562806_+	CtsR family transcriptional regulator	NA	NA	NA	NA	NA
AYV50268.1|562795_565246_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	34.0	5.7e-124
AYV50269.1|565380_565938_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
AYV50270.1|566122_567424_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	87.6	4.0e-217
567319:567378	attL	TACAGACCGTATGGCTAAATACAACCAATTGCTTCGTATCGAAGACCAATTGGCTGAAGT	NA	NA	NA	NA
AYV50271.1|567508_568447_+|integrase	integrase	integrase	A0A142F1N9	Bacillus_phage	27.5	5.2e-25
AYV50272.1|568719_569487_+	hypothetical protein	NA	NA	NA	NA	NA
AYV51726.1|570074_570215_+	hypothetical protein	NA	NA	NA	NA	NA
AYV50273.1|570530_570713_+	hypothetical protein	NA	NA	NA	NA	NA
AYV50274.1|570734_571904_+	hypothetical protein	NA	V9VGE4	Lactococcus_phage	40.4	1.1e-37
AYV50275.1|573776_576764_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	26.4	5.5e-20
AYV50276.1|576803_578351_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	39.1	1.4e-99
AYV50277.1|578347_579571_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	30.7	1.6e-34
AYV50278.1|579591_579717_+	hypothetical protein	NA	NA	NA	NA	NA
AYV50279.1|579694_580774_+	hypothetical protein	NA	NA	NA	NA	NA
AYV50280.1|580935_581205_+	hypothetical protein	NA	NA	NA	NA	NA
AYV50281.1|581506_582618_-|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	1.2e-49
AYV51727.1|582766_582934_+	hypothetical protein	NA	NA	NA	NA	NA
AYV50282.1|583199_583970_+	hypothetical protein	NA	NA	NA	NA	NA
AYV50283.1|584380_585492_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.1	4.2e-50
586014:586125	attR	TACAGACCGTATGGCTAAATACAACCAATTGCTTCGTATCGAAGACCAATTGGCTGAAGTGGCTCAATACAAAGGTCTTAAAGCATTCTACAACCTTAAAAAATAAGGTTTA	NA	NA	NA	NA
>prophage 4
CP033606	Lactococcus lactis strain IL6288 chromosome, complete genome	2208218	933811	947595	2208218		Enterococcus_phage(25.0%)	11	NA	NA
AYV50579.1|933811_934504_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	34.4	2.7e-31
AYV50580.1|934496_935432_+	ABC transporter permease	NA	NA	NA	NA	NA
AYV50581.1|935533_936511_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	66.2	2.4e-118
AYV50582.1|936860_939029_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	61.1	3.0e-257
AYV50583.1|939164_939587_-	protein NrdI	NA	A0A142F1R4	Bacillus_phage	37.3	2.3e-12
AYV50584.1|939588_939807_-	NrdH-redoxin	NA	C3U2K9	Lactococcus_phage	47.6	7.6e-12
AYV50585.1|939980_940622_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
AYV50586.1|940896_942831_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	43.2	1.6e-124
AYV50587.1|943566_944400_+	3'-5' exonuclease	NA	A0A0K2SUJ2	Clostridium_phage	39.4	3.1e-21
AYV50588.1|944396_944846_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYV50589.1|945120_947595_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	32.2	4.2e-98
>prophage 5
CP033606	Lactococcus lactis strain IL6288 chromosome, complete genome	2208218	956253	964521	2208218		Staphylococcus_phage(50.0%)	9	NA	NA
AYV50597.1|956253_957342_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	38.8	8.4e-51
AYV50598.1|957341_957992_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	43.6	1.2e-41
AYV50599.1|958000_959197_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	51.0	1.3e-110
AYV50600.1|959224_959689_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	53.0	5.3e-39
AYV50601.1|959791_960244_+	signal peptidase II	NA	NA	NA	NA	NA
AYV50602.1|960304_961210_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.2	5.4e-11
AYV50603.1|961356_961800_+	divergent PAP2 family protein	NA	NA	NA	NA	NA
AYV50604.1|961939_963562_+	hypothetical protein	NA	NA	NA	NA	NA
AYV50605.1|963564_964521_+	glycosyltransferase	NA	I1TED8	Salmonella_phage	37.5	3.1e-49
>prophage 6
CP033606	Lactococcus lactis strain IL6288 chromosome, complete genome	2208218	1415971	1426272	2208218		Synechococcus_phage(33.33%)	8	NA	NA
AYV50996.1|1415971_1417528_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/inosine monophosphate cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	45.6	2.3e-70
AYV50997.1|1417703_1418246_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	29.9	1.8e-09
AYV50998.1|1418382_1419420_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
AYV50999.1|1419550_1420081_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYV51000.1|1420131_1421721_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.2	3.0e-09
AYV51001.1|1421887_1422436_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	31.1	2.8e-18
AYV51002.1|1422463_1423480_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3FGG1	Synechococcus_phage	40.4	6.4e-61
AYV51003.1|1423668_1426272_-	chaperone protein ClpB	NA	K4FB40	Cronobacter_phage	32.8	9.4e-125
>prophage 7
CP033606	Lactococcus lactis strain IL6288 chromosome, complete genome	2208218	1628140	1637999	2208218	tRNA	Prochlorococcus_phage(33.33%)	9	NA	NA
AYV51183.1|1628140_1628902_-	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.5	1.1e-17
AYV51184.1|1629067_1629877_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.5	7.0e-10
AYV51185.1|1629910_1630804_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
AYV51186.1|1630803_1631727_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
AYV51187.1|1631847_1632699_-	phosphate ABC transporter substrate-binding protein PstS family protein	NA	E3SNT9	Prochlorococcus_phage	27.3	4.2e-05
AYV51188.1|1633045_1633942_-	phosphate ABC transporter substrate-binding protein	NA	E3SM63	Prochlorococcus_phage	32.4	7.2e-08
AYV51189.1|1634219_1634687_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	56.6	2.7e-43
AYV51190.1|1634718_1635294_-	esterase	NA	NA	NA	NA	NA
AYV51191.1|1635380_1637999_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	33.7	7.1e-64
>prophage 8
CP033606	Lactococcus lactis strain IL6288 chromosome, complete genome	2208218	1925688	1990846	2208218	tRNA,protease,bacteriocin,transposase	unidentified_phage(20.0%)	59	NA	NA
AYV51450.1|1925688_1926636_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	33.0	3.4e-32
AYV51451.1|1926656_1926866_-	hypothetical protein	NA	NA	NA	NA	NA
AYV51452.1|1926901_1927420_-	peptide-methionine (S)-S-oxide reductase	NA	NA	NA	NA	NA
AYV51453.1|1927594_1928452_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
AYV51454.1|1928497_1928956_-	N-acetyltransferase	NA	NA	NA	NA	NA
AYV51455.1|1929048_1929606_-	ribosome recycling factor	NA	NA	NA	NA	NA
AYV51456.1|1929817_1930534_-	UMP kinase	NA	NA	NA	NA	NA
AYV51457.1|1930618_1931071_-	hypothetical protein	NA	NA	NA	NA	NA
AYV51458.1|1931204_1932392_-	acetate kinase	NA	NA	NA	NA	NA
AYV51459.1|1932548_1933736_-	acetate kinase	NA	NA	NA	NA	NA
AYV51460.1|1933930_1934869_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYV51461.1|1934956_1935208_-	DUF3165 family protein	NA	NA	NA	NA	NA
AYV51462.1|1935304_1937146_-	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	35.4	1.2e-17
AYV51463.1|1937324_1937783_-	hypothetical protein	NA	NA	NA	NA	NA
AYV51464.1|1937798_1938572_-	hypothetical protein	NA	NA	NA	NA	NA
AYV51465.1|1938908_1939535_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	3.7e-19
AYV51466.1|1939535_1941518_-|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
AYV51467.1|1941521_1941848_-|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
AYV51468.1|1942147_1942876_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
AYV51469.1|1943068_1943290_+	DUF910 family protein	NA	NA	NA	NA	NA
AYV51470.1|1943323_1944295_+	ROK family glucokinase	NA	NA	NA	NA	NA
AYV51471.1|1944297_1944684_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
AYV51472.1|1944766_1945213_-	DNA starvation/stationary phase protection protein	NA	A0A2K9VCK5	Lactobacillus_phage	34.2	6.5e-18
AYV51473.1|1945350_1946462_-|transposase	IS3-like element IS981 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	41.4	1.2e-49
AYV51474.1|1946606_1947272_+	prepilin peptidase	NA	NA	NA	NA	NA
AYV51475.1|1947222_1948314_-	DNA polymerase IV	NA	NA	NA	NA	NA
AYV51476.1|1948392_1948884_-|tRNA	prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
AYV51477.1|1948962_1950456_-	amino acid permease	NA	NA	NA	NA	NA
AYV51478.1|1950647_1951778_-	aminotransferase	NA	NA	NA	NA	NA
AYV51479.1|1952041_1952986_-	carbamate kinase	NA	NA	NA	NA	NA
AYV51480.1|1953017_1953962_-	carbamate kinase	NA	NA	NA	NA	NA
AYV51775.1|1954081_1955554_-	amino acid permease	NA	NA	NA	NA	NA
AYV51481.1|1955684_1956749_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
AYV51482.1|1956932_1958165_-	arginine deiminase	NA	NA	NA	NA	NA
AYV51483.1|1958231_1958429_+	hypothetical protein	NA	NA	NA	NA	NA
AYV51484.1|1958466_1960161_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	34.8	2.1e-80
AYV51485.1|1960228_1960687_+	arginine repressor	NA	NA	NA	NA	NA
AYV51776.1|1960869_1962201_-	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
AYV51486.1|1962403_1962997_-	hypothetical protein	NA	NA	NA	NA	NA
AYV51487.1|1963212_1966317_-	helicase	NA	A0A2L1IWL4	Gordonia_phage	30.1	5.3e-42
AYV51488.1|1966570_1970923_-	VWA domain-containing protein	NA	NA	NA	NA	NA
AYV51489.1|1971345_1973049_-	pyruvate oxidase	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	27.2	1.9e-33
AYV51490.1|1973245_1974232_-	serine hydrolase	NA	NA	NA	NA	NA
AYV51491.1|1974304_1975084_-	proteinase	NA	NA	NA	NA	NA
AYV51492.1|1975437_1976223_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYV51493.1|1976265_1977135_-	aquaporin family protein	NA	NA	NA	NA	NA
AYV51494.1|1977306_1979598_+	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
AYV51495.1|1979599_1980310_+	gamma-glutamyl-gamma-aminobutyrate hydrolase	NA	H9D1C6	Salinivibrio_phage	31.8	5.2e-09
AYV51496.1|1980459_1981302_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYV51497.1|1982820_1984272_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
AYV51498.1|1984435_1984966_-	cysteine hydrolase	NA	NA	NA	NA	NA
AYV51499.1|1985064_1985988_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AYV51500.1|1986216_1986711_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYV51501.1|1986802_1987126_-	DUF1048 domain-containing protein	NA	NA	NA	NA	NA
AYV51502.1|1987112_1987460_-	DUF1048 domain-containing protein	NA	NA	NA	NA	NA
AYV51503.1|1987446_1987809_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AYV51504.1|1987928_1988558_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
AYV51505.1|1988622_1989708_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
AYV51506.1|1989898_1990846_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	33.0	8.9e-33
>prophage 9
CP033606	Lactococcus lactis strain IL6288 chromosome, complete genome	2208218	2038754	2111152	2208218	tRNA,protease,transposase	unidentified_phage(18.18%)	52	NA	NA
AYV51568.1|2038754_2040605_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AYV51569.1|2040674_2041961_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
AYV51570.1|2041979_2042783_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AYV51571.1|2042782_2043517_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	37.0	5.9e-16
AYV51572.1|2043888_2044221_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
AYV51573.1|2045031_2045511_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
AYV51574.1|2045549_2046497_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	33.0	3.4e-32
AYV51575.1|2046966_2048193_+|protease	serine protease	protease	A0A1B1IRD3	uncultured_Mediterranean_phage	26.3	4.9e-07
AYV51576.1|2048318_2049317_+	glycosyltransferase	NA	NA	NA	NA	NA
AYV51577.1|2049442_2050783_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
AYV51578.1|2050890_2051115_+	DUF1797 family protein	NA	NA	NA	NA	NA
AYV51579.1|2051256_2052261_+	hypothetical protein	NA	NA	NA	NA	NA
AYV51580.1|2052301_2053054_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
AYV51581.1|2053400_2056034_-	DNA polymerase I	NA	A0A068EMS7	Bacillus_phage	31.4	7.7e-50
AYV51582.1|2056271_2057081_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
AYV51583.1|2057570_2058718_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.0	2.3e-46
AYV51584.1|2058790_2060163_-|transposase	IS3-like element ISLla3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.8	2.4e-55
AYV51585.1|2060204_2060738_+	hypothetical protein	NA	NA	NA	NA	NA
AYV51586.1|2066155_2066647_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
AYV51587.1|2066904_2068635_-	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
AYV51588.1|2068820_2069849_-	elongation factor Ts	NA	NA	NA	NA	NA
AYV51589.1|2069970_2070738_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
AYV51590.1|2071096_2072122_+	hypothetical protein	NA	NA	NA	NA	NA
AYV51591.1|2072354_2075066_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
AYV51592.1|2075403_2075901_-	hypothetical protein	NA	NA	NA	NA	NA
AYV51593.1|2075887_2076097_-	hypothetical protein	NA	NA	NA	NA	NA
AYV51594.1|2076093_2076921_-	radical SAM protein	NA	NA	NA	NA	NA
AYV51595.1|2076913_2079037_-	radical SAM protein	NA	NA	NA	NA	NA
AYV51596.1|2079139_2079997_-	transcriptional regulator	NA	A0A1X9I6E0	Streptococcus_phage	28.7	2.3e-11
AYV51597.1|2080117_2081146_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
AYV51598.1|2081132_2081630_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	31.4	8.9e-16
AYV51599.1|2081677_2082244_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
AYV51600.1|2082387_2083608_-	MFS transporter	NA	NA	NA	NA	NA
AYV51601.1|2083691_2084918_-	multidrug efflux MFS transporter LmrP	NA	NA	NA	NA	NA
AYV51602.1|2085105_2085600_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
AYV51603.1|2085623_2086730_+	anti-sigma factor	NA	NA	NA	NA	NA
AYV51604.1|2086825_2088172_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYV51605.1|2088515_2089022_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AYV51606.1|2089055_2089901_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AYV51607.1|2090127_2090406_+	transcriptional regulator	NA	NA	NA	NA	NA
AYV51608.1|2090518_2090851_+	hypothetical protein	NA	NA	NA	NA	NA
AYV51609.1|2090894_2093537_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	41.2	2.0e-151
AYV51610.1|2093792_2094449_-	elongation factor G-binding protein	NA	NA	NA	NA	NA
AYV51611.1|2094725_2094974_-	DUF1912 family protein	NA	NA	NA	NA	NA
AYV51612.1|2095012_2095357_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
AYV51613.1|2095357_2095867_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYV51614.1|2096021_2096729_-	hypothetical protein	NA	NA	NA	NA	NA
AYV51615.1|2097060_2098602_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	32.7	1.2e-71
AYV51616.1|2098830_2101611_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
AYV51617.1|2101679_2102153_-	cell wall anchor protein	NA	NA	NA	NA	NA
AYV51618.1|2102438_2103251_+	regulatory protein RecX	NA	NA	NA	NA	NA
AYV51619.1|2110204_2111152_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.7	1.7e-31
