The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033605	Escherichia coli O157:H7 strain TR01 chromosome, complete genome	5569804	254643	351729	5569804	tail,transposase,protease,integrase,plate	Enterobacteria_phage(27.59%)	98	302666:302712	314573:314619
AYV39666.1|254643_255975_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
AYV39667.1|255977_256502_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
AYV39668.1|256498_257779_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
AYV39669.1|257803_258886_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
AYV39670.1|258849_260700_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AYV39671.1|260703_261117_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AYV39672.1|261207_262599_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
AYV39673.1|262649_262874_-	hypothetical protein	NA	NA	NA	NA	NA
AYV39674.1|262908_263409_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
AYV39675.1|264105_264624_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
AYV39676.1|264833_266975_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
AYV39677.1|267050_271283_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
AYV44525.1|271422_272139_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
AYV39678.1|272296_273829_+	RHS repeat protein	NA	NA	NA	NA	NA
AYV44526.1|273897_274455_+	sel1 repeat family protein	NA	NA	NA	NA	NA
AYV39679.1|274802_275093_+	hypothetical protein	NA	NA	NA	NA	NA
AYV39680.1|276338_278099_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
AYV39681.1|278300_278564_+	dCTP deaminase	NA	NA	NA	NA	NA
AYV39682.1|278478_278664_-	hypothetical protein	NA	NA	NA	NA	NA
AYV39683.1|278744_279917_+|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
AYV39684.1|280034_280805_-	amidohydrolase	NA	NA	NA	NA	NA
AYV39685.1|280958_281432_+	inhibitor of vertebrate lysozyme	NA	NA	NA	NA	NA
AYV39686.1|281474_283919_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AYV39687.1|284158_284737_+	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
AYV39688.1|284942_285710_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
AYV39689.1|285680_286421_-	transpeptidase	NA	NA	NA	NA	NA
AYV39690.1|286576_286855_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
AYV39691.1|286857_287118_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
AYV39692.1|287327_288077_+	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
AYV39693.1|288896_290636_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
AYV44527.1|290595_291366_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
AYV39694.1|291436_292492_+	DNA polymerase IV	NA	NA	NA	NA	NA
AYV39695.1|292543_292837_+	antitoxin YafN	NA	NA	NA	NA	NA
AYV39696.1|292839_293238_+	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
AYV39697.1|293247_293700_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYV44528.1|294149_294743_+	peptide chain release factor H	NA	NA	NA	NA	NA
AYV39698.1|294799_296257_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
AYV39699.1|296517_296976_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
AYV39700.1|297067_298312_+	esterase FrsA	NA	NA	NA	NA	NA
AYV39701.1|298369_298771_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
AYV39702.1|298809_299865_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
AYV39703.1|300152_301256_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
AYV39704.1|301267_302521_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
302666:302712	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCAT	NA	NA	NA	NA
AYV44529.1|302725_303385_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.5	5.3e-125
AYV39705.1|303589_303835_-	antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
AYV39706.1|304161_305375_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AYV39707.1|305400_305784_-	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.2	4.4e-07
AYV39708.1|305911_306625_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
AYV39709.1|306725_306926_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
AYV39710.1|307044_307338_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
AYV39711.1|308289_308601_+	phage replication protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
AYV39712.1|308600_309395_+|tail	phage tail protein	tail	K7PH60	Enterobacterial_phage	82.3	1.9e-81
AYV39713.1|309394_309988_+|tail	tail fiber assembly protein	tail	K7P870	Enterobacteria_phage	65.5	6.3e-61
AYV39714.1|309959_310403_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.3	8.3e-82
AYV39715.1|310423_310834_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	98.4	5.9e-66
AYV39716.1|310863_311418_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	87.3	4.8e-87
AYV39717.1|313071_313815_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYV39718.1|314780_315962_+	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	61.1	2.3e-142
314573:314619	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCAT	NA	NA	NA	NA
AYV39719.1|315965_316382_+	hypothetical protein	NA	NA	NA	NA	NA
AYV39720.1|316354_316972_+	hypothetical protein	NA	NA	NA	NA	NA
AYV39721.1|316971_317430_+	hypothetical protein	NA	NA	NA	NA	NA
AYV39722.1|317422_318055_+	AAA family ATPase	NA	NA	NA	NA	NA
AYV39723.1|318085_318475_+	hypothetical protein	NA	NA	NA	NA	NA
AYV39724.1|318471_318675_+	hypothetical protein	NA	NA	NA	NA	NA
AYV39725.1|318674_319241_+	hypothetical protein	NA	NA	NA	NA	NA
AYV39726.1|319299_319503_-	hypothetical protein	NA	NA	NA	NA	NA
AYV39727.1|319650_319923_-	hypothetical protein	NA	NA	NA	NA	NA
AYV39728.1|319928_320480_-	phage polarity suppression protein	NA	NA	NA	NA	NA
AYV39729.1|320476_321229_-	septation initiation protein	NA	NA	NA	NA	NA
AYV39730.1|322162_322423_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
AYV39731.1|322419_322977_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	65.8	8.7e-28
AYV39732.1|322973_323195_+	hypothetical protein	NA	NA	NA	NA	NA
AYV39733.1|323194_323518_+|protease	Clp protease ClpB	protease	NA	NA	NA	NA
AYV39734.1|323531_325865_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
AYV39735.1|325997_326954_-	hypothetical protein	NA	NA	NA	NA	NA
AYV39736.1|327629_328529_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYV39737.1|328627_329350_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AYV39738.1|329513_329792_+	hypothetical protein	NA	NA	NA	NA	NA
AYV39739.1|330494_331397_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYV44530.1|331642_332701_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYV39740.1|332842_333970_+	MFS transporter	NA	NA	NA	NA	NA
AYV39741.1|334148_335105_-	XdhC family protein	NA	NA	NA	NA	NA
AYV39742.1|335114_337313_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
AYV39743.1|337309_338266_-	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
AYV39744.1|338262_338952_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
AYV39745.1|339369_339984_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
AYV39746.1|340231_340561_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
AYV39747.1|340873_341584_-	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
AYV39748.1|341552_343196_-	fimbria adhesin EcpD	NA	NA	NA	NA	NA
AYV39749.1|343185_345711_-	usher protein EcpC	NA	NA	NA	NA	NA
AYV39750.1|345736_346405_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
AYV39751.1|346462_347050_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
AYV39752.1|347124_347667_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
AYV39753.1|348749_348890_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
AYV39754.1|348889_349153_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
AYV39755.1|349416_349797_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
AYV39756.1|349793_350141_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AYV39757.1|350190_351729_+|transposase	IS66 family transposase ISEc8	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
>prophage 2
CP033605	Escherichia coli O157:H7 strain TR01 chromosome, complete genome	5569804	895403	932575	5569804	tail,holin,protease,terminase,lysis,integrase,portal	Enterobacteria_phage(51.16%)	51	884557:884571	913643:913657
884557:884571	attL	CTATTGCACTGGCGA	NA	NA	NA	NA
AYV40193.1|895403_896474_-|integrase	integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
AYV40194.1|896451_896670_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
AYV40195.1|896709_896877_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
AYV44543.1|896809_896995_+	hypothetical protein	NA	NA	NA	NA	NA
AYV40196.1|897119_897722_+	hypothetical protein	NA	NA	NA	NA	NA
AYV40197.1|897932_898154_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
AYV40198.1|898252_898534_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
AYV40199.1|898544_898736_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
AYV40200.1|898708_898891_-	DUF1317 family protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
AYV40201.1|898887_899568_-	exonuclease	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
AYV44544.1|900265_900448_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
AYV40202.1|900444_900615_+	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
AYV40203.1|900607_901228_+	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
AYV40204.1|901224_901890_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
AYV40205.1|902101_903061_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
AYV40206.1|903398_903521_+	YlcG family protein	NA	NA	NA	NA	NA
AYV40207.1|903535_904225_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
AYV40208.1|904408_905152_+	hypothetical protein	NA	NA	NA	NA	NA
AYV40209.1|905237_905396_+	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
AYV40210.1|905476_905875_-	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
AYV44545.1|906017_906233_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
AYV40211.1|906232_906730_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
AYV40212.1|906726_907194_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	3.2e-76
AYV40213.1|907181_907334_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
AYV44546.1|907740_908019_+	hypothetical protein	NA	NA	NA	NA	NA
AYV40214.1|908008_908500_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
AYV40215.1|908499_910602_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
AYV40216.1|910598_910811_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
AYV40217.1|910738_911863_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
AYV40218.1|911957_912320_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	100.0	7.0e-63
AYV40219.1|912264_914292_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
913643:913657	attR	CTATTGCACTGGCGA	NA	NA	NA	NA
AYV40220.1|914378_914702_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
AYV40221.1|914694_914970_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
AYV40222.1|914981_915560_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
AYV44548.1|915556_915958_+|tail	phage tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
AYV40223.1|915968_916712_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
AYV44547.1|916772_917159_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
AYV40224.1|917167_917497_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
AYV40225.1|917468_920534_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
AYV40226.1|920533_920863_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
AYV40227.1|920872_921571_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
AYV40228.1|921576_922320_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
AYV40229.1|922256_922865_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
AYV40230.1|922925_926339_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
AYV40231.1|926409_927009_+	outer membrane protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
AYV40232.1|927068_928385_+|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	95.6	1.2e-70
AYV40233.1|928386_928656_+|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
AYV40234.1|928832_929813_+	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
AYV40235.1|929846_930866_+|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
AYV44549.1|931362_931524_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
AYV40236.1|931693_932575_+	T3SS effector protein NleH	NA	A5LH48	Enterobacteria_phage	89.8	1.1e-146
>prophage 3
CP033605	Escherichia coli O157:H7 strain TR01 chromosome, complete genome	5569804	1166714	1221279	5569804	tail,transposase,head,protease,lysis,capsid,portal	Escherichia_phage(28.89%)	70	NA	NA
AYV40431.1|1166714_1169186_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
AYV40432.1|1169279_1169471_-	DUF1482 family protein	NA	NA	NA	NA	NA
AYV40433.1|1169467_1169656_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AYV44559.1|1169922_1170228_+	hypothetical protein	NA	NA	NA	NA	NA
AYV40434.1|1170229_1170415_+	hypothetical protein	NA	NA	NA	NA	NA
AYV40435.1|1170601_1170991_-	hypothetical protein	NA	NA	NA	NA	NA
AYV40436.1|1171132_1171288_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
AYV40437.1|1171345_1171564_-	hypothetical protein	NA	NA	NA	NA	NA
AYV40438.1|1171565_1171853_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AYV40439.1|1171852_1172044_-	antitoxin	NA	NA	NA	NA	NA
AYV40440.1|1172071_1172473_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
AYV40441.1|1172581_1172854_+	hypothetical protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
AYV40442.1|1172837_1173263_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AYV40443.1|1173469_1173925_-	hypothetical protein	NA	NA	NA	NA	NA
AYV40444.1|1174003_1175095_+	DNA-binding protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
AYV40445.1|1175101_1175848_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.8	3.1e-113
AYV40446.1|1175869_1176640_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
AYV40447.1|1176655_1177069_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
AYV40448.1|1177420_1178194_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYV40449.1|1178559_1178697_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
AYV40450.1|1178741_1178954_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.4	1.5e-25
AYV40451.1|1179121_1179400_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
AYV40452.1|1179401_1180451_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
AYV40453.1|1180463_1180835_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
AYV40454.1|1180824_1181196_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
AYV40455.1|1181347_1182166_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
AYV40456.1|1182452_1182692_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.0	7.7e-18
AYV40457.1|1182786_1183500_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYV40458.1|1183946_1184150_-	hypothetical protein	NA	Q8VNP0	Enterobacteria_phage	96.7	1.8e-28
AYV40459.1|1184267_1186118_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
AYV40460.1|1186293_1187506_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AYV40461.1|1187711_1188026_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AYV40462.1|1188553_1188739_-	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
AYV40463.1|1188960_1189074_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
AYV40464.1|1189294_1189828_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
AYV40465.1|1189860_1190055_-	hypothetical protein	NA	NA	NA	NA	NA
AYV40466.1|1189987_1190260_+	hypothetical protein	NA	NA	NA	NA	NA
AYV40467.1|1190208_1190553_+	hypothetical protein	NA	NA	NA	NA	NA
AYV40468.1|1190515_1190680_-|lysis	lysis protein	lysis	Q6H9V8	Enterobacteria_phage	94.4	3.5e-22
AYV40469.1|1190749_1191962_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AYV40470.1|1192785_1193061_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
AYV40471.1|1193136_1193517_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
AYV40472.1|1193513_1193861_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AYV40473.1|1193910_1195449_+|transposase	IS66 family transposase ISEc8	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
AYV40474.1|1195498_1195741_+	DNA packaging protein	NA	NA	NA	NA	NA
AYV40475.1|1197625_1197832_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AYV40476.1|1197828_1199421_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
AYV40477.1|1199410_1200916_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
AYV40478.1|1200952_1201300_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
AYV40479.1|1201357_1201624_+|capsid	major capsid protein E	capsid	NA	NA	NA	NA
AYV40480.1|1201605_1202346_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
AYV40481.1|1202359_1202791_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
AYV40482.1|1202817_1203231_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
AYV40483.1|1203211_1205791_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
AYV40484.1|1205787_1206117_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
AYV40485.1|1206116_1206815_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
AYV40486.1|1206825_1207569_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
AYV44560.1|1207514_1208147_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
AYV40487.1|1208100_1208307_+	hypothetical protein	NA	NA	NA	NA	NA
AYV40488.1|1208337_1208865_-	superoxide dismutase	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
AYV40489.1|1208998_1212472_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	95.5	0.0e+00
AYV40490.1|1212539_1213139_+	outer membrane protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
AYV40491.1|1213202_1214516_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
AYV40492.1|1214517_1214787_+|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
AYV40493.1|1214911_1215715_-	molecular chaperone Tir	NA	NA	NA	NA	NA
AYV40494.1|1216260_1216443_-	hypothetical protein	NA	H6WZN3	Escherichia_phage	89.7	1.1e-21
AYV40495.1|1217060_1218179_+	hydrogenase-1 small chain	NA	NA	NA	NA	NA
AYV40496.1|1218175_1219969_+	hydrogenase-1 large chain	NA	NA	NA	NA	NA
AYV40497.1|1219987_1220695_+	Ni/Fe-hydrogenase B-type cytochrome subunit	NA	NA	NA	NA	NA
AYV40498.1|1220691_1221279_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 4
CP033605	Escherichia coli O157:H7 strain TR01 chromosome, complete genome	5569804	1321253	1328694	5569804	transposase	Stx2-converting_phage(50.0%)	7	NA	NA
AYV40578.1|1321253_1321343_-	AMP nucleosidase	NA	A0A0N7BTS3	Escherichia_phage	100.0	2.3e-07
AYV40579.1|1321308_1322522_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	100.0	2.2e-169
AYV40580.1|1322582_1323110_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AYV40581.1|1323264_1325625_+	DEAD/DEAH box helicase	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
AYV40582.1|1326381_1327920_-|transposase	IS66 family transposase ISEc8	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
AYV40583.1|1327969_1328317_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AYV40584.1|1328313_1328694_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
>prophage 5
CP033605	Escherichia coli O157:H7 strain TR01 chromosome, complete genome	5569804	1483086	1602114	5569804	tail,head,transposase,holin,protease,terminase,integrase,tRNA,capsid,portal	Enterobacteria_phage(35.92%)	151	1546761:1546776	1569078:1569093
AYV40744.1|1483086_1483908_+	NAD-dependent deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
AYV40745.1|1484062_1485109_-	spermidine/putrescine-binding periplasmic protein	NA	NA	NA	NA	NA
AYV40746.1|1485105_1485900_-	spermidine/putrescine ABC transporter permease	NA	NA	NA	NA	NA
AYV40747.1|1486066_1487185_-|integrase	integrase	integrase	Q77Z04	Phage_21	43.9	1.0e-83
AYV40748.1|1487153_1487423_-	excisionase	NA	NA	NA	NA	NA
AYV44578.1|1487484_1487874_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
AYV40749.1|1488006_1488522_+	hypothetical protein	NA	NA	NA	NA	NA
AYV44579.1|1488636_1488789_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
AYV40750.1|1489104_1489581_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
AYV40751.1|1489705_1490029_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
AYV40752.1|1490012_1490438_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AYV40753.1|1490506_1491544_+	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
AYV44580.1|1491575_1491998_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	91.4	1.8e-73
AYV40754.1|1492031_1492748_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
AYV40755.1|1492744_1493062_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	70.6	1.1e-32
AYV40756.1|1493058_1493361_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
AYV40757.1|1493350_1493668_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
AYV40758.1|1493621_1493939_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
AYV40759.1|1493925_1494363_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
AYV40760.1|1494364_1494556_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
AYV40761.1|1494558_1495146_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
AYV40762.1|1495261_1495366_+	hypothetical protein	NA	NA	NA	NA	NA
AYV40763.1|1495554_1495767_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
AYV40764.1|1495934_1496213_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
AYV40765.1|1496214_1497264_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
AYV40766.1|1497276_1497534_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	65.3	3.1e-20
AYV40767.1|1498954_1499137_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
AYV40768.1|1499174_1499444_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
AYV40769.1|1499519_1499735_+|holin	holin	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
AYV40770.1|1499739_1500084_+	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
AYV40771.1|1500134_1500668_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
AYV40772.1|1500938_1501508_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
AYV40773.1|1501507_1501654_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
AYV40774.1|1501881_1502088_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
AYV40775.1|1502152_1502377_+	hypothetical protein	NA	NA	NA	NA	NA
AYV40776.1|1502733_1502874_+	hypothetical protein	NA	NA	NA	NA	NA
AYV40777.1|1503003_1503189_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
AYV40778.1|1503230_1503596_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
AYV40779.1|1503885_1504449_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
AYV40780.1|1504445_1506107_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
AYV40781.1|1506170_1508108_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
AYV44581.1|1508152_1508374_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
AYV40782.1|1508319_1510821_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	98.8	0.0e+00
AYV40783.1|1510900_1511227_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
AYV40784.1|1511236_1511587_+|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
AYV40785.1|1511583_1512030_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
AYV40786.1|1512026_1512371_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AYV40787.1|1512436_1513153_+|tail	phage tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
AYV40788.1|1513167_1513542_+|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	2.3e-64
AYV44582.1|1513637_1513847_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
AYV40789.1|1513899_1517142_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.7	0.0e+00
AYV40790.1|1517134_1517476_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
AYV40791.1|1517475_1518174_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
AYV40792.1|1518190_1518445_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
AYV40793.1|1518554_1518665_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
AYV40794.1|1518967_1519846_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
AYV40795.1|1519899_1520637_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
AYV44583.1|1520582_1520819_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
AYV40796.1|1520831_1520921_+	hypothetical protein	NA	NA	NA	NA	NA
AYV40797.1|1520940_1523289_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
AYV40798.1|1523879_1527281_+	DUF4765 family protein	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
AYV40799.1|1527657_1527849_-	hypothetical protein	NA	NA	NA	NA	NA
AYV40800.1|1529384_1529510_+	NleB	NA	Q8HAB2	Salmonella_phage	58.3	8.7e-05
AYV40801.1|1529589_1529865_-	secretion protein EspO	NA	NA	NA	NA	NA
AYV40802.1|1529925_1531287_-	type III secretion protein GogB	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
AYV40803.1|1531407_1531620_-	hypothetical protein	NA	NA	NA	NA	NA
AYV40804.1|1531650_1532514_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
AYV40805.1|1532497_1533634_-	Fe3+/spermidine/putrescine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
AYV40806.1|1533883_1535110_+	peptidase T	NA	NA	NA	NA	NA
AYV40807.1|1535158_1536280_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AYV40808.1|1536528_1537758_+	DUF4102 domain-containing protein	NA	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
AYV40809.1|1538122_1538311_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
AYV44584.1|1539115_1539313_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
AYV40810.1|1539305_1539518_+	hypothetical protein	NA	NA	NA	NA	NA
AYV40811.1|1539507_1539972_+	hypothetical protein	NA	NA	NA	NA	NA
AYV40812.1|1539964_1540198_+	hypothetical protein	NA	NA	NA	NA	NA
AYV40813.1|1540203_1540503_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
AYV40814.1|1540499_1541900_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	5.6e-116
AYV40815.1|1542100_1542352_+	hypothetical protein	NA	NA	NA	NA	NA
AYV40816.1|1542348_1542759_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
AYV40817.1|1542769_1543042_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AYV40818.1|1542998_1543127_+	trigger factor	NA	NA	NA	NA	NA
AYV40819.1|1543168_1543393_+	hypothetical protein	NA	NA	NA	NA	NA
AYV40820.1|1543644_1543851_+	hypothetical protein	NA	NA	NA	NA	NA
AYV40821.1|1543850_1544906_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
AYV40822.1|1544918_1545254_+|head	head decoration protein	head	NA	NA	NA	NA
AYV40823.1|1545266_1545680_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
AYV40824.1|1545885_1546428_+|terminase	terminase	terminase	O64316	Escherichia_phage	44.2	1.8e-33
AYV40825.1|1546683_1546965_+	hypothetical protein	NA	NA	NA	NA	NA
1546761:1546776	attL	GCCGGACAGCGTGACC	NA	NA	NA	NA
AYV40826.1|1547565_1549026_-	sensor protein PhoQ	NA	NA	NA	NA	NA
AYV40827.1|1549025_1549697_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
AYV40828.1|1549865_1551236_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
AYV44585.1|1551239_1551881_-	lysogenization regulator HflD	NA	NA	NA	NA	NA
AYV40829.1|1551916_1553023_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AYV40830.1|1553076_1553538_-	NUDIX hydrolase	NA	NA	NA	NA	NA
AYV40831.1|1553547_1554201_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
AYV40832.1|1554372_1555623_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
AYV40833.1|1555737_1556880_-|integrase	integrase	integrase	O21940	Phage_21	100.0	8.1e-206
AYV40834.1|1556869_1557106_-	excisionase	NA	NA	NA	NA	NA
AYV40835.1|1557209_1558034_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	69.3	3.8e-96
AYV40836.1|1558030_1558732_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.0	2.5e-125
AYV40837.1|1558728_1559031_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
AYV40838.1|1559098_1559431_+	multidrug SMR transporter	NA	NA	NA	NA	NA
AYV40839.1|1559495_1559618_+	hypothetical protein	NA	NA	NA	NA	NA
AYV40840.1|1561317_1561509_+	hypothetical protein	NA	NA	NA	NA	NA
AYV40841.1|1561699_1562155_+	hypothetical protein	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
AYV40842.1|1562154_1562325_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
AYV40843.1|1562317_1562608_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
AYV40844.1|1562604_1562967_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	94.9	2.1e-59
AYV40845.1|1562963_1563104_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
AYV40846.1|1563100_1563790_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
AYV40847.1|1564111_1564417_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	86.6	1.6e-39
AYV40848.1|1564403_1564880_+	lysozyme	NA	S5FV07	Shigella_phage	95.6	1.7e-85
AYV40849.1|1565096_1565282_+	Spanin from lambdoid prophage Rac, outer membrane subunit	NA	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
AYV40850.1|1565369_1565663_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
AYV40851.1|1565956_1566367_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
AYV40852.1|1566651_1566858_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
AYV40853.1|1567022_1567217_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	85.9	9.4e-22
AYV40854.1|1568124_1570050_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
1569078:1569093	attR	GCCGGACAGCGTGACC	NA	NA	NA	NA
AYV40855.1|1570046_1570253_+|tail	phage tail protein	tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
AYV40856.1|1570249_1571851_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
AYV40857.1|1571831_1573151_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
AYV40858.1|1573160_1573493_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
AYV40859.1|1573548_1574574_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	95.0	1.5e-182
AYV40860.1|1574615_1575014_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	4.5e-63
AYV40861.1|1575025_1575379_+|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	99.1	4.4e-62
AYV40862.1|1575390_1575969_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
AYV40863.1|1575965_1576361_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
AYV44586.1|1576368_1577109_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
AYV40864.1|1577124_1577547_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
AYV40865.1|1577528_1577963_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
AYV40866.1|1577955_1580505_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
AYV40867.1|1580501_1580831_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
AYV40868.1|1580830_1581529_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
AYV40869.1|1581534_1582278_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
AYV40870.1|1582214_1582847_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
AYV40871.1|1582907_1586306_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
AYV40872.1|1586372_1586972_+	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
AYV40873.1|1590111_1590525_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.4	1.5e-69
AYV40874.1|1590649_1591540_-	manganese catalase family protein	NA	NA	NA	NA	NA
AYV40875.1|1591558_1592065_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AYV40876.1|1592101_1592602_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AYV40877.1|1592680_1592863_-	stress-induced acidophilic repeat motif-containing protein	NA	NA	NA	NA	NA
AYV40878.1|1594085_1594334_+|tail	tail assembly chaperone	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
AYV40879.1|1594409_1594790_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
AYV40880.1|1594786_1595134_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AYV40881.1|1595183_1596722_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
AYV40882.1|1597024_1598509_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYV40883.1|1598691_1599645_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
AYV40884.1|1600143_1600728_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYV40885.1|1600901_1602114_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
>prophage 6
CP033605	Escherichia coli O157:H7 strain TR01 chromosome, complete genome	5569804	1679540	1738945	5569804	tail,head,transposase,holin,terminase,lysis,integrase,capsid,portal	Escherichia_phage(33.93%)	75	1685764:1685822	1743256:1743314
AYV40950.1|1679540_1680671_-|integrase	integrase	integrase	O21940	Phage_21	51.4	3.4e-103
AYV40951.1|1680648_1680897_-	excisionase	NA	NA	NA	NA	NA
AYV40952.1|1680961_1683433_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
AYV40953.1|1683525_1683717_-	DUF1482 family protein	NA	NA	NA	NA	NA
AYV40954.1|1683713_1683902_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AYV44595.1|1684299_1684467_+	hypothetical protein	NA	NA	NA	NA	NA
AYV40955.1|1684460_1684694_+	hypothetical protein	NA	NA	NA	NA	NA
AYV40956.1|1684671_1685079_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
AYV40957.1|1685101_1685320_-	hypothetical protein	NA	NA	NA	NA	NA
AYV40958.1|1685392_1685692_-	hypothetical protein	NA	NA	NA	NA	NA
1685764:1685822	attL	TTCCCCTTAACGCCGGGTAGCGGAACTGTTTGCTGAGAACACCGTGCGGTGTCTTGATG	NA	NA	NA	NA
AYV40959.1|1685955_1686363_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
AYV40960.1|1686439_1686667_+	transcriptional regulator	NA	NA	NA	NA	NA
AYV40961.1|1687172_1688213_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
AYV44596.1|1688244_1688667_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.6	1.2e-77
AYV40962.1|1688853_1689435_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
AYV40963.1|1689431_1689596_+	hypothetical protein	NA	NA	NA	NA	NA
AYV40964.1|1690294_1691053_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
AYV40965.1|1691018_1691279_-	hypothetical protein	NA	NA	NA	NA	NA
AYV40966.1|1691331_1691544_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
AYV40967.1|1691764_1692022_+	hypothetical protein	NA	NA	NA	NA	NA
AYV40968.1|1692091_1692370_+	hypothetical protein	NA	A0A2I6TCC8	Escherichia_phage	45.2	6.7e-05
AYV40969.1|1692371_1693421_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.5	2.2e-109
AYV40970.1|1693433_1693793_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
AYV40971.1|1693801_1694332_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
AYV40972.1|1694573_1694771_+	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
AYV40973.1|1694921_1695980_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
AYV40974.1|1696471_1696657_+	hypothetical protein	NA	Q5MBW5	Stx1-converting_phage	94.6	4.6e-26
AYV40975.1|1696719_1696878_+	DUF1737 domain-containing protein	NA	Q5MBW4	Stx1-converting_phage	100.0	3.5e-11
AYV40976.1|1697746_1697962_+|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
AYV40977.1|1697966_1698311_+	DUF1327 domain-containing protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
AYV40978.1|1698361_1698895_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
AYV40979.1|1699165_1699735_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
AYV40980.1|1699734_1699881_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
AYV40981.1|1699888_1700356_+|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	92.2	1.1e-71
AYV40982.1|1700819_1701134_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AYV40983.1|1701215_1701440_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
AYV40984.1|1701455_1701713_-	hypothetical protein	NA	A0A0K2FJC5	Escherichia_phage	91.4	1.3e-10
AYV40985.1|1701826_1702372_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
AYV40986.1|1702346_1704272_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.0	0.0e+00
AYV40987.1|1704268_1704475_+|tail	phage tail protein	tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
AYV40988.1|1704471_1706073_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
AYV40989.1|1706053_1707373_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
AYV40990.1|1707382_1707715_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
AYV40991.1|1707770_1708796_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
AYV40992.1|1708837_1709236_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
AYV40993.1|1709247_1709601_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
AYV40994.1|1709615_1710149_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
AYV40995.1|1710145_1710541_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
AYV40996.1|1710548_1711301_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
AYV40997.1|1711314_1711737_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
AYV40998.1|1711763_1712072_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	99.0	1.5e-53
AYV40999.1|1712115_1714761_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	98.6	0.0e+00
AYV41000.1|1714757_1715087_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AYV41001.1|1715086_1715785_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
AYV44597.1|1716484_1717114_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	96.6	2.7e-102
AYV41002.1|1717354_1720210_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	72.8	0.0e+00
AYV41003.1|1720277_1720877_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	96.0	1.0e-106
AYV41004.1|1721028_1722333_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	3.9e-79
AYV41005.1|1722334_1722604_+|tail	phage tail protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
AYV41006.1|1722748_1723291_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	67.2	1.1e-62
AYV41007.1|1723630_1724956_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
AYV41008.1|1725223_1725412_+	hypothetical protein	NA	NA	NA	NA	NA
AYV44598.1|1726553_1726676_+	hypothetical protein	NA	Q687E5	Enterobacteria_phage	91.3	3.8e-05
AYV41009.1|1726782_1727694_+	T3SS effector protein NleH	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
AYV41010.1|1727759_1728329_+	effector protein NleF	NA	NA	NA	NA	NA
AYV41011.1|1729294_1730833_-|transposase	IS66 family transposase ISEc8	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
AYV41012.1|1730882_1731230_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AYV41013.1|1731226_1731607_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
AYV41014.1|1731946_1732225_-	secretion protein EspO	NA	NA	NA	NA	NA
AYV44599.1|1732652_1732799_+	hypothetical protein	NA	NA	NA	NA	NA
AYV41015.1|1732935_1733583_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
AYV41016.1|1733766_1734357_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
AYV44600.1|1736176_1736515_+	DUF1076 domain-containing protein	NA	A0A0P0ZBX1	Stx2-converting_phage	43.2	2.9e-18
AYV44601.1|1737108_1737327_-	hypothetical protein	NA	NA	NA	NA	NA
AYV41017.1|1737814_1738945_-|integrase	integrase	integrase	O21940	Phage_21	51.1	1.7e-102
1743256:1743314	attR	TTCCCCTTAACGCCGGGTAGCGGAACTGTTTGCTGAGAACACCGTGCGGTGTCTTGATG	NA	NA	NA	NA
>prophage 7
CP033605	Escherichia coli O157:H7 strain TR01 chromosome, complete genome	5569804	1743088	1798615	5569804	tail,holin,protease,terminase,portal	Escherichia_phage(32.65%)	66	NA	NA
AYV41022.1|1743088_1743244_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
AYV41023.1|1743433_1743841_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
AYV41024.1|1743918_1744146_+	transcriptional regulator	NA	NA	NA	NA	NA
AYV41025.1|1744129_1744681_+	hypothetical protein	NA	NA	NA	NA	NA
AYV41026.1|1744652_1745693_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.7	1.8e-90
AYV44603.1|1745724_1746147_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	97.1	2.2e-76
AYV41027.1|1746181_1746952_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	65.6	7.2e-81
AYV41028.1|1746967_1747363_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
AYV44604.1|1747419_1747776_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	3.7e-56
AYV41029.1|1747824_1748037_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
AYV41030.1|1748072_1748444_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.0	1.3e-48
AYV41031.1|1748440_1748803_+	DUF551 domain-containing protein	NA	A0A0P0ZCX1	Stx2-converting_phage	97.5	2.8e-67
AYV41032.1|1748918_1749023_+	hypothetical protein	NA	NA	NA	NA	NA
AYV41033.1|1749211_1749424_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
AYV41034.1|1749644_1749902_+	hypothetical protein	NA	NA	NA	NA	NA
AYV41035.1|1749971_1750250_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	1.5e-12
AYV41036.1|1750251_1751301_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.2	3.6e-107
AYV41037.1|1751313_1751688_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	4.2e-34
AYV41038.1|1751684_1752506_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
AYV41039.1|1752732_1752930_+	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
AYV41040.1|1753080_1754139_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	2.6e-206
AYV41041.1|1754733_1756680_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	99.1	0.0e+00
AYV41042.1|1756814_1756994_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
AYV41043.1|1757034_1757280_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
AYV41044.1|1757357_1757573_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
AYV44605.1|1757576_1758134_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	80.9	1.5e-48
AYV41045.1|1758170_1758704_+	lysozyme	NA	G9L6J6	Escherichia_phage	96.6	2.1e-100
AYV41046.1|1759222_1759408_+	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
AYV41047.1|1759882_1760359_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
AYV41048.1|1760355_1762479_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.7	0.0e+00
AYV41049.1|1762475_1762688_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
AYV41050.1|1762687_1764190_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	99.8	3.1e-290
AYV41051.1|1764134_1766159_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
AYV41052.1|1766246_1766573_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
AYV41053.1|1766565_1766847_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
AYV41054.1|1766849_1767473_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	99.5	2.5e-100
AYV41055.1|1767485_1767884_+|tail	phage tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
AYV41056.1|1767891_1768644_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
AYV41057.1|1768657_1769080_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
AYV41058.1|1769106_1769415_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
AYV41059.1|1769458_1772104_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	94.4	0.0e+00
AYV41060.1|1772100_1772430_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AYV41061.1|1772429_1773128_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	98.3	5.2e-131
AYV41062.1|1773138_1773882_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	2.4e-150
AYV44606.1|1773827_1774457_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.1	1.7e-101
AYV41063.1|1774697_1778174_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.6	0.0e+00
AYV41064.1|1778241_1778841_+	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	4.1e-108
AYV41065.1|1778905_1780219_+|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.3	3.9e-79
AYV41066.1|1780220_1780490_+|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	2.4e-44
AYV41067.1|1781623_1782214_+	protein kinase	NA	NA	NA	NA	NA
AYV41068.1|1783251_1783758_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
AYV41069.1|1783803_1784304_-	YciE/YciF family protein	NA	NA	NA	NA	NA
AYV44607.1|1784389_1784569_-	hypothetical protein	NA	NA	NA	NA	NA
AYV41070.1|1784949_1785756_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
AYV41071.1|1785755_1786949_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
AYV44608.1|1786960_1788319_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	2.3e-37
AYV41072.1|1788322_1789918_-	bifunctional glutamine amidotransferase/anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
AYV41073.1|1789917_1791480_-	anthranilate synthase component I	NA	NA	NA	NA	NA
AYV44609.1|1791571_1791616_-	trp operon leader peptide	NA	NA	NA	NA	NA
AYV41074.1|1791753_1792635_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
AYV41075.1|1792631_1793252_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
AYV41076.1|1793279_1794875_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
AYV41077.1|1795088_1795961_+	23S rRNA pseudouridylate synthase B	NA	NA	NA	NA	NA
AYV41078.1|1796000_1796591_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
AYV41079.1|1796587_1797346_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
AYV41080.1|1797565_1798615_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 8
CP033605	Escherichia coli O157:H7 strain TR01 chromosome, complete genome	5569804	2069021	2178191	5569804	tail,transposase,head,holin,protease,terminase,capsid,portal	Stx2-converting_phage(39.81%)	134	NA	NA
AYV41296.1|2069021_2069225_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
AYV41297.1|2069260_2070721_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
AYV41298.1|2070809_2072093_-	MFS transporter	NA	NA	NA	NA	NA
AYV44624.1|2072152_2072467_+	DinI family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
AYV41299.1|2072463_2072598_-|capsid	capsid protein	capsid	NA	NA	NA	NA
AYV41300.1|2072628_2073270_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
AYV41301.1|2073351_2073981_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
AYV41302.1|2074053_2074629_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
AYV41303.1|2074742_2075012_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
AYV41304.1|2075013_2076327_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.2	1.4e-81
AYV41305.1|2076391_2076991_-	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
AYV41306.1|2077058_2079572_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.5	0.0e+00
AYV41307.1|2079568_2081137_-	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	98.2	1.1e-298
AYV44625.1|2081478_2082111_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
AYV41308.1|2082056_2082800_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
AYV41309.1|2082810_2083509_-|tail	phage minor tail protein L	tail	A0A0P0ZD89	Stx2-converting_phage	97.8	7.6e-130
AYV41310.1|2083508_2083850_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
AYV41311.1|2083842_2087085_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.6	0.0e+00
AYV44626.1|2087136_2087346_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
AYV41312.1|2087441_2087816_-|tail	phage tail protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
AYV41313.1|2087821_2088538_-|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
AYV41314.1|2088596_2088941_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AYV41315.1|2088937_2089384_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
AYV41316.1|2089380_2089731_-|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
AYV41317.1|2089740_2090067_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	99.1	4.5e-53
AYV41318.1|2092107_2092329_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
AYV44627.1|2092872_2093280_-	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	97.2	1.3e-52
AYV41319.1|2093284_2093491_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
AYV41320.1|2093938_2095789_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
AYV41321.1|2096266_2096698_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
AYV41322.1|2097148_2097862_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYV41323.1|2097997_2098195_-	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
AYV41324.1|2098419_2098974_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
AYV41325.1|2099036_2099342_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
AYV41326.1|2099354_2100404_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	2.6e-110
AYV41327.1|2100405_2100678_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
AYV41328.1|2100799_2101144_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
AYV41329.1|2101263_2101476_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
AYV41330.1|2101709_2102267_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
AYV41331.1|2102268_2102487_-	DUF4014 domain-containing protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
AYV41332.1|2102614_2102926_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
AYV41333.1|2102918_2103146_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
AYV44628.1|2103142_2103424_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
AYV41334.1|2103456_2104173_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
AYV44629.1|2104206_2104629_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.0	5.7e-72
AYV41335.1|2104660_2105704_-	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
AYV41336.1|2105772_2106198_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AYV41337.1|2106181_2106424_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
AYV44630.1|2106815_2107154_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
AYV44631.1|2107446_2107599_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
AYV44632.1|2107610_2108249_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
AYV41338.1|2108249_2108459_-	hypothetical protein	NA	NA	NA	NA	NA
AYV41339.1|2109023_2109212_+	cell division inhibitor	NA	NA	NA	NA	NA
AYV41340.1|2109208_2109397_+	DUF1482 family protein	NA	NA	NA	NA	NA
AYV41341.1|2109489_2110728_+	exonuclease	NA	H6WRX1	Salmonella_phage	51.8	2.0e-88
AYV44633.1|2111367_2111682_+	DinI family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
AYV41342.1|2112644_2113025_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
AYV41343.1|2113021_2113369_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AYV41344.1|2113418_2114957_+|transposase	IS66 family transposase ISEc8	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
AYV41345.1|2115539_2116190_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
AYV41346.1|2116174_2116522_-	hypothetical protein	NA	B6ETE2	Enterobacteria_phage	96.8	6.1e-48
AYV41347.1|2116900_2117476_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
AYV41348.1|2117589_2117859_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
AYV41349.1|2117860_2119084_-|tail	phage tail protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
AYV41350.1|2119148_2119748_-	outer membrane protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
AYV41351.1|2119815_2120031_-	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
AYV41352.1|2120033_2123294_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.3	0.0e+00
AYV41353.1|2123481_2123919_-|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	100.0	5.0e-63
AYV41354.1|2123918_2124260_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
AYV41355.1|2124252_2127495_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.6	0.0e+00
AYV44634.1|2127542_2127752_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
AYV41356.1|2127847_2128222_-|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
AYV41357.1|2128236_2128953_-|tail	phage tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
AYV41358.1|2129018_2129363_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AYV41359.1|2129359_2129806_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
AYV41360.1|2129802_2130153_-|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
AYV41361.1|2130162_2130489_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
AYV41362.1|2130491_2133071_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
AYV41363.1|2133016_2133238_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
AYV41364.1|2133282_2135220_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
AYV41365.1|2135283_2136945_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
AYV41366.1|2136941_2137505_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
AYV41367.1|2137620_2137800_-	hypothetical protein	NA	H6WZK7	Escherichia_phage	92.9	1.0e-22
AYV41368.1|2137796_2138162_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
AYV41369.1|2138203_2138431_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
AYV44635.1|2138855_2139041_-	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
AYV41370.1|2139298_2139415_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	3.4e-11
AYV41371.1|2139414_2139984_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
AYV41372.1|2140254_2140788_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	91.5	9.3e-96
AYV41373.1|2140838_2141183_-	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	93.9	1.0e-55
AYV41374.1|2141187_2141394_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.5	4.0e-31
AYV41375.1|2141842_2143693_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
AYV41376.1|2144171_2144600_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
AYV41377.1|2145084_2145207_-	antiterminator	NA	NA	NA	NA	NA
AYV41378.1|2145237_2145927_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
AYV41379.1|2145923_2146283_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
AYV41380.1|2146295_2147345_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
AYV41381.1|2147346_2147625_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
AYV41382.1|2147792_2148005_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
AYV41383.1|2148193_2148298_-	hypothetical protein	NA	NA	NA	NA	NA
AYV41384.1|2148413_2148998_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
AYV41385.1|2149054_2149450_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
AYV41386.1|2150260_2151001_-	replication protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
AYV44636.1|2151007_2151973_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	58.5	6.0e-85
AYV41387.1|2151995_2152421_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AYV41388.1|2152417_2152720_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
AYV41389.1|2152817_2153189_+	hypothetical protein	NA	NA	NA	NA	NA
AYV44637.1|2153209_2153401_+	stability determinant	NA	NA	NA	NA	NA
AYV41390.1|2153402_2153681_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AYV41391.1|2154033_2154333_+	hypothetical protein	NA	NA	NA	NA	NA
AYV41392.1|2154404_2154623_+	hypothetical protein	NA	NA	NA	NA	NA
AYV44638.1|2154626_2154791_-	hypothetical protein	NA	NA	NA	NA	NA
AYV41393.1|2155191_2155380_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
AYV41394.1|2155376_2155568_+	DUF1482 family protein	NA	NA	NA	NA	NA
AYV41395.1|2156796_2158009_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AYV44639.1|2159532_2159769_+	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
AYV41396.1|2160757_2161084_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
AYV41397.1|2161218_2161560_+	DUF1283 family protein	NA	NA	NA	NA	NA
AYV41398.1|2161594_2162155_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
AYV44640.1|2162157_2162868_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
AYV41399.1|2162975_2163281_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
AYV41400.1|2163478_2165905_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	1.0e-213
AYV44641.1|2165965_2168389_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
AYV41401.1|2168399_2169017_+	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
AYV41402.1|2169018_2169873_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AYV41403.1|2169915_2170530_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
AYV44642.1|2170688_2171981_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
AYV41404.1|2171933_2172629_-	dethiobiotin synthase	NA	NA	NA	NA	NA
AYV41405.1|2172753_2173974_-	ROK family transcriptional regulator	NA	NA	NA	NA	NA
AYV41406.1|2174108_2175002_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYV41407.1|2175108_2176362_+	MFS transporter	NA	NA	NA	NA	NA
AYV41408.1|2176758_2177094_+	acid shock protein	NA	NA	NA	NA	NA
AYV41409.1|2177186_2177270_+	hypothetical protein	NA	NA	NA	NA	NA
AYV41410.1|2177369_2178191_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 9
CP033605	Escherichia coli O157:H7 strain TR01 chromosome, complete genome	5569804	2460882	2519730	5569804	integrase,tail,tRNA,transposase	Enterobacteria_phage(63.33%)	63	2498399:2498458	2520835:2520987
AYV41674.1|2460882_2461854_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AYV41675.1|2464472_2465573_-	cytochrome C	NA	NA	NA	NA	NA
AYV41676.1|2465960_2466707_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AYV41677.1|2466720_2467287_-	VOC family protein	NA	NA	NA	NA	NA
AYV41678.1|2467502_2469236_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	2.6e-86
AYV41679.1|2469412_2469901_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
AYV41680.1|2470021_2470414_-	flagellar protein FlhE	NA	NA	NA	NA	NA
AYV41681.1|2470413_2472492_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
AYV41682.1|2472484_2473633_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
AYV41683.1|2473834_2474479_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
AYV41684.1|2474489_2474879_-	two-component system response regulator	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
AYV41685.1|2474893_2475943_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
AYV41686.1|2475945_2476806_-	chemotaxis protein methyltransferase	NA	NA	NA	NA	NA
AYV41687.1|2476824_2478426_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	8.3e-15
AYV41688.1|2478471_2480133_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
AYV41689.1|2480277_2480781_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
AYV41690.1|2480801_2482766_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
AYV41691.1|2482770_2483697_-	motility protein B	NA	NA	NA	NA	NA
AYV41692.1|2483693_2484581_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
AYV41693.1|2484707_2485286_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
AYV41694.1|2485288_2485639_-	flagellar transcriptional activator FlhD	NA	NA	NA	NA	NA
AYV41695.1|2486418_2486847_+	universal stress protein UspC	NA	NA	NA	NA	NA
AYV41696.1|2486853_2488278_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
AYV41697.1|2488252_2489053_-	trehalose-phosphatase	NA	NA	NA	NA	NA
AYV41698.1|2489219_2490206_-	arabinose ABC transporter permease	NA	NA	NA	NA	NA
AYV41699.1|2490220_2491735_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	7.4e-13
AYV41700.1|2491804_2492794_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYV41701.1|2493590_2494094_+	non-heme ferritin	NA	NA	NA	NA	NA
AYV41702.1|2494172_2494424_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
AYV41703.1|2494538_2494625_-	stress response protein AzuC	NA	NA	NA	NA	NA
AYV41704.1|2494887_2495211_+	hypothetical protein	NA	NA	NA	NA	NA
AYV41705.1|2495381_2495879_+	non-heme ferritin	NA	NA	NA	NA	NA
AYV41706.1|2495916_2496156_-	DUF2492 family protein	NA	NA	NA	NA	NA
AYV41707.1|2496347_2497559_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
AYV41708.1|2497620_2498286_-	YecA family protein	NA	NA	NA	NA	NA
2498399:2498458	attL	GACAAGTTGCAGGCACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTT	NA	NA	NA	NA
AYV41709.1|2498642_2499644_-|integrase	integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
AYV41710.1|2499649_2499997_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
AYV41711.1|2500026_2500677_-	hypothetical protein	NA	NA	NA	NA	NA
AYV41712.1|2500692_2501097_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
AYV44657.1|2501186_2501324_-	hypothetical protein	NA	NA	NA	NA	NA
AYV41713.1|2501395_2501599_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
AYV41714.1|2501620_2501971_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
AYV41715.1|2501981_2502260_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
AYV41716.1|2502271_2502514_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
AYV41717.1|2502510_2502624_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
AYV41718.1|2502716_2503133_+	hypothetical protein	NA	NA	NA	NA	NA
AYV41719.1|2503156_2503360_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
AYV41720.1|2503356_2503623_+	MarR family transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
AYV41721.1|2503619_2503919_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
AYV41722.1|2504241_2504472_+	derepression protein	NA	A0A0A7NV48	Enterobacteria_phage	94.7	5.9e-31
AYV41723.1|2504544_2504910_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
AYV41724.1|2504916_2507739_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
AYV41725.1|2507815_2508775_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
AYV41726.1|2508779_2509094_+	peptide transporter	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
AYV44658.1|2510299_2510716_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	84.7	2.8e-63
AYV44659.1|2510759_2511332_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
AYV41727.1|2511488_2511977_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
AYV44660.1|2514779_2514908_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	97.6	3.0e-16
AYV41728.1|2514943_2515309_-|tail	phage tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
AYV41729.1|2515363_2515876_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
AYV41730.1|2515875_2517060_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
AYV41731.1|2517217_2517541_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
AYV41732.1|2518517_2519730_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	100.0	2.2e-169
2520835:2520987	attR	GACAAGTTGCAGGCACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAATCCCTTGTGTCTACC	NA	NA	NA	NA
>prophage 10
CP033605	Escherichia coli O157:H7 strain TR01 chromosome, complete genome	5569804	2577475	2718500	5569804	tail,head,transposase,holin,protease,terminase,integrase,lysis,capsid,portal	Stx2-converting_phage(34.62%)	170	2600267:2600326	2646125:2647434
AYV41796.1|2577475_2577745_-|tail	phage tail protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
AYV41797.1|2577746_2579060_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	2.8e-77
AYV41798.1|2579124_2579724_-	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
AYV41799.1|2579791_2583271_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.9	0.0e+00
AYV44663.1|2583511_2584141_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.0	7.8e-110
AYV41800.1|2584086_2584830_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
AYV41801.1|2584840_2585539_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
AYV41802.1|2585538_2585868_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
AYV41803.1|2585864_2588444_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
AYV41804.1|2588424_2588838_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
AYV41805.1|2588864_2589296_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
AYV41806.1|2589309_2590050_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
AYV41807.1|2590031_2590298_-|capsid	major capsid protein E	capsid	NA	NA	NA	NA
AYV41808.1|2590355_2590703_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
AYV41809.1|2590739_2592245_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
AYV41810.1|2592234_2593827_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
AYV41811.1|2593823_2594030_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
AYV41812.1|2595914_2596424_-|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
AYV41813.1|2596818_2597043_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
AYV41814.1|2597124_2597439_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AYV41815.1|2597965_2598151_-	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
AYV41816.1|2598378_2598510_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
AYV41817.1|2598522_2598705_-	hypothetical protein	NA	NA	NA	NA	NA
AYV41818.1|2598860_2599394_-	lysozyme	NA	Q08J98	Stx2-converting_phage	92.7	1.1e-96
AYV41819.1|2599445_2599790_-	DUF1327 domain-containing protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
AYV44664.1|2599794_2600010_-|holin	holin	holin	G9L6J5	Escherichia_phage	87.3	8.8e-29
2600267:2600326	attL	TGAACCGCCCCGGAAATCCTGGAGACTAAACTCCCTGAGAAAGAGGTAAACAGGATGACT	NA	NA	NA	NA
AYV41820.1|2600320_2601533_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AYV41821.1|2601615_2603466_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
AYV41822.1|2603943_2604372_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
AYV41823.1|2604852_2604975_-	antiterminator	NA	NA	NA	NA	NA
AYV41824.1|2605005_2605695_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
AYV41825.1|2605691_2606051_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
AYV41826.1|2606063_2607113_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.4e-108
AYV41827.1|2607114_2607393_-	hypothetical protein	NA	NA	NA	NA	NA
AYV44665.1|2607333_2607519_+	hypothetical protein	NA	NA	NA	NA	NA
AYV41828.1|2607560_2607716_-	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AYV41829.1|2607956_2608061_-	hypothetical protein	NA	NA	NA	NA	NA
AYV41830.1|2608170_2608734_-	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
AYV41831.1|2608860_2609172_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
AYV44666.1|2609168_2609321_-	hypothetical protein	NA	NA	NA	NA	NA
AYV41832.1|2609353_2609710_-	eae-like protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
AYV41833.1|2609706_2609931_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
AYV41834.1|2609952_2610651_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
AYV44667.1|2610685_2611108_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
AYV41835.1|2611139_2612177_-	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
AYV41836.1|2612245_2612671_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
AYV41837.1|2612667_2612895_-	cell division protein	NA	NA	NA	NA	NA
AYV41838.1|2612992_2613637_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
AYV41839.1|2613911_2614064_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
AYV41840.1|2614544_2614733_+	cell division inhibitor	NA	NA	NA	NA	NA
AYV41841.1|2614729_2614918_+	DUF1482 family protein	NA	NA	NA	NA	NA
AYV41842.1|2615013_2617485_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
AYV41843.1|2617543_2617747_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
AYV41844.1|2617746_2618826_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.2e-99
AYV44668.1|2619017_2619815_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
AYV41845.1|2620303_2627677_+	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
AYV41846.1|2629307_2630624_+	shikimate transporter	NA	NA	NA	NA	NA
AYV41847.1|2630725_2632180_+	AMP nucleosidase	NA	NA	NA	NA	NA
AYV41848.1|2632522_2633239_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AYV41849.1|2635625_2636576_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
AYV41850.1|2636677_2637595_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
AYV41851.1|2638051_2638987_-	L,D-transpeptidase	NA	NA	NA	NA	NA
AYV41852.1|2639048_2640128_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
AYV41853.1|2640139_2640883_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
AYV41854.1|2640879_2641425_-	adenosylcobinamide kinase/adenosylcobinamide phosphate guanyltransferase	NA	NA	NA	NA	NA
AYV41855.1|2641786_2642167_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
AYV41856.1|2642163_2642511_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AYV41857.1|2642560_2644099_+|transposase	IS66 family transposase ISEc8	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
AYV41858.1|2644916_2646130_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AYV41859.1|2646570_2646753_+	hypothetical protein	NA	NA	NA	NA	NA
AYV41860.1|2649292_2650147_+	vimentin yjdA	NA	NA	NA	NA	NA
2646125:2647434	attR	AGTCATCCTGTTTACCTCTTTCTCAGGGAGTTTAGTCTCCAGGATTTCCGGGGCGGTTCAGATATATTCTGATATACTCCTTTTGCTAGACATAACCTTTCACCTGCTTGCAAAGCTTCTGTGTTCTGACATTGCCAAATTGTTGCAATTCTGTATCCAGCCTTCTTTCAGTCATAGCTTCGGGCCGCGATAAGACTCACTGATCTGACCCTGATTCCTCTTGCAGACTTTATAGACCAATTAAAATGCAGTTTCTGCAGGTCAACGTCTGACCATCATTGCCATCACTCTGGCCATTAGAGTAACCTTCTGCATTCATCCTTTTGTAAAAAGTTTATATTAGTATCAGCAATTAACCGGACCTGATACTGATATGAGTCTTACCGCATATACGGTCAATTTCAGCAATTAATTACATTATCCACGCCAAAGTATTTGTCATCACAATGATGGTACCTTCTTTCAGACACCATTTTTTCAACTCCGTTTTCCACGGACCGCACTCTTATGTCAAGAGTGCGGTCCGTGGATACAACCAGAGACCGACTGACACGAGTCAGAGGAAACGACGGATATGTTCAGTCGTAAAATATCTATCAAAAAACATGATTAAGGTCAAAAATGTTTGATATTTACAATTTATGAAGATGACAATAATTATAGATATATGAGAACATAAATGAAAATAATTATCATTACAGCAATCATTTGTACTTTGTATTAATGAGGGATGAAATGTTATATAATATACCTTGTCGAATTTATATCCTTTCCACTCTGTCATTATGCATTTCTGGGATAGTTTCTACTGCAACCGCAACTTCTTCAGAAACAAAAATCAGCAACGAAGAGACGCTCGTCGTGACCACGAATCGTGAAGTGGTCAACAAAAACTGGCCACCGAGTTAGAGTTTTGTTATTGACCAACAAACATTGCAGAACTCCACCAATGCCTCCATAGCCGATAATTTGCAGGACATCCCCGGAGTAGAGATAACAGACAACTCCTTGGCAGGCCGTAAACAAATCCGCATTCGTGGCGAAGCATCCTCCCGTGTTTTAATTCTCATTGATGGTCAGGAGGTAACTTATCAGCGCGCCGGAGATAATTATGGTGTGGGACTGTTGATAGATGAGTCTGCGCTGGAGCGTGTTGAGGTAGTGAAAGGTCCATATTCCGTACTGTACGGTTCACAGGCAATTGGCGGTATTGTTAACTTCATCACCAAAAAGGGAGGTGACAAACTTGCATCTGGAGTTGTGAAAGCTGTTTATAATTCCGCAACAGCAGGCTGGGAAGAATCAATCGC	NA	NA	NA	NA
AYV41861.1|2650143_2651049_+	chemotaxis protein	NA	NA	NA	NA	NA
AYV41862.1|2651045_2652116_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
AYV41863.1|2652251_2652935_+	hypothetical protein	NA	NA	NA	NA	NA
AYV41864.1|2652950_2653361_+	hypothetical protein	NA	NA	NA	NA	NA
AYV41865.1|2653581_2654403_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
AYV41866.1|2654484_2654964_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	8.9e-13
AYV41867.1|2654978_2655455_+	DNA repair protein RadC	NA	NA	NA	NA	NA
AYV41868.1|2655517_2655739_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
AYV41869.1|2655818_2656187_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AYV41870.1|2656645_2656840_+	hypothetical protein	NA	NA	NA	NA	NA
AYV41871.1|2656852_2656966_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
AYV41872.1|2657454_2657637_+	ethanolamine utilization protein	NA	NA	NA	NA	NA
AYV41873.1|2657737_2658067_-	DUF496 family protein	NA	NA	NA	NA	NA
AYV41874.1|2658238_2659297_-	FUSC family protein	NA	NA	NA	NA	NA
AYV41875.1|2659495_2659969_-	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
AYV41876.1|2660087_2661254_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.2	1.0e-224
AYV41877.1|2661597_2661729_-	umuD domain protein	NA	O64339	Escherichia_phage	59.5	1.5e-07
AYV41878.1|2661668_2661863_-	hypothetical protein	NA	NA	NA	NA	NA
AYV41879.1|2662308_2662593_+	hypothetical protein	NA	B6ETE2	Enterobacteria_phage	100.0	1.2e-49
AYV41880.1|2662577_2663228_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
AYV41881.1|2663451_2664327_-	secretion protein EspS	NA	A0A0P0ZCT1	Stx2-converting_phage	99.7	3.2e-162
AYV41882.1|2664467_2664737_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
AYV41883.1|2664738_2666052_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	99.5	2.4e-84
AYV41884.1|2666116_2666716_-	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
AYV41885.1|2666783_2670263_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.0	0.0e+00
AYV44670.1|2670501_2671134_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	99.0	3.1e-106
AYV41886.1|2671079_2671817_-|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	98.8	3.8e-148
AYV44669.1|2671871_2672795_-	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	99.3	3.2e-176
AYV41887.1|2672865_2673039_-	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
AYV44671.1|2673146_2673467_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
AYV41888.1|2674209_2674551_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
AYV41889.1|2674543_2677786_-|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	95.6	0.0e+00
AYV44672.1|2677837_2678047_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
AYV41890.1|2678142_2678517_-|tail	phage tail protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
AYV41891.1|2678522_2679239_-|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
AYV41892.1|2679297_2679642_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
AYV41893.1|2679638_2680085_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
AYV41894.1|2680081_2680432_-|head,tail	head-tail adaptor protein	head,tail	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
AYV41895.1|2680441_2680768_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
AYV41896.1|2680847_2683349_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	97.2	0.0e+00
AYV41897.1|2683294_2683516_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
AYV41898.1|2683560_2685498_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
AYV41899.1|2685561_2687223_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
AYV41900.1|2687219_2687783_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
AYV41901.1|2687898_2688078_-	hypothetical protein	NA	H6WZK7	Escherichia_phage	92.9	1.0e-22
AYV41902.1|2688074_2688440_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
AYV41903.1|2688481_2688709_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
AYV41904.1|2689171_2689429_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
AYV41905.1|2689425_2689923_-	DNA-binding protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
AYV41906.1|2690125_2690563_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	97.9	1.7e-71
AYV41907.1|2690559_2691057_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
AYV41908.1|2691056_2691272_-|holin	holin	holin	A5LH82	Enterobacteria_phage	91.5	3.2e-31
AYV41909.1|2691348_2691621_-	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
AYV41910.1|2691661_2691841_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
AYV41911.1|2691977_2693915_-	DUF1737 domain-containing protein	NA	A0A0P0ZBP4	Stx2-converting_phage	99.4	0.0e+00
AYV41912.1|2694158_2694482_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
AYV41913.1|2694778_2695048_-	Shiga toxin Stx2 subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
AYV41914.1|2695059_2696019_-	Shiga toxin Stx2 subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
AYV41915.1|2696668_2697157_-	antiterminator	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
AYV41916.1|2697147_2697819_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
AYV41917.1|2697815_2698421_-	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
AYV41918.1|2698420_2699143_-	DNA-binding protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
AYV41919.1|2699217_2699898_-	phage antirepressor Ant	NA	Q8HA19	Enterobacteria_phage	100.0	1.1e-128
AYV41920.1|2700053_2700248_+	hypothetical protein	NA	A0A0N7KZV5	Escherichia_phage	95.3	1.2e-29
AYV41921.1|2700153_2700912_-	ORF6N domain-containing protein	NA	B6ETC2	Enterobacteria_phage	100.0	2.0e-115
AYV41922.1|2700934_2701069_-	hypothetical protein	NA	Q8SBF3	Shigella_phage	65.7	5.5e-05
AYV41923.1|2701190_2701373_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
AYV41924.1|2701369_2701897_-	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
AYV41925.1|2701893_2702340_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
AYV41926.1|2702296_2702533_-	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
AYV41927.1|2702543_2702759_-	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
AYV41928.1|2702891_2703170_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
AYV41929.1|2703240_2704617_-	replicative DNA helicase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
AYV41930.1|2704613_2705435_-	replication of DNA	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
AYV41931.1|2705615_2705912_-	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
AYV41932.1|2706053_2706269_-	XRE family transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
AYV41933.1|2706344_2707040_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
AYV41934.1|2707541_2708063_+	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
AYV41935.1|2708631_2708814_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
AYV41936.1|2708791_2709064_+	antitermination protein N	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
AYV41937.1|2709122_2709374_+	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
AYV41938.1|2709556_2709925_+	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
AYV41939.1|2709997_2710162_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
AYV41940.1|2710130_2710274_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
AYV41941.1|2710348_2710645_+	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
AYV41942.1|2710650_2711436_+	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	99.6	2.4e-148
AYV41943.1|2711730_2712944_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AYV41944.1|2713422_2713605_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
AYV41945.1|2713577_2713769_+	DUF1382 family protein	NA	B6ETA2	Enterobacteria_phage	100.0	3.3e-27
AYV41946.1|2713779_2714061_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
AYV41947.1|2714159_2714381_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
AYV41948.1|2714377_2715325_+	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
AYV41949.1|2715326_2715503_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
AYV41950.1|2715472_2715760_+	hypothetical protein	NA	NA	NA	NA	NA
AYV41951.1|2715836_2716193_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
AYV41952.1|2716189_2716540_+	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
AYV41953.1|2716727_2717072_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
AYV41954.1|2717149_2717341_+	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
AYV41955.1|2717321_2718500_-	DUF4102 domain-containing protein	NA	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
>prophage 11
CP033605	Escherichia coli O157:H7 strain TR01 chromosome, complete genome	5569804	2801909	2839932	5569804	tail,head,holin,terminase,lysis,integrase,capsid,portal,plate	Escherichia_phage(68.89%)	50	2806240:2806254	2838184:2838198
AYV42022.1|2801909_2803313_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
AYV42023.1|2803309_2804032_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
AYV42024.1|2804177_2804510_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
AYV42025.1|2804658_2806020_+	U32 family peptidase	NA	Q6DW11	Phage_TP	98.9	2.3e-215
2806240:2806254	attL	CATTGACCACATCGA	NA	NA	NA	NA
AYV42026.1|2806293_2806548_-	DNA-binding transcriptional regulator	NA	M1SNR2	Escherichia_phage	100.0	1.3e-44
AYV42027.1|2806593_2807757_-	phage late control D family protein	NA	M1SV93	Escherichia_phage	98.7	3.5e-204
AYV42028.1|2807756_2808236_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	100.0	6.6e-85
AYV42029.1|2808250_2810698_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.6	0.0e+00
AYV44680.1|2810690_2810810_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
AYV42030.1|2810842_2811118_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
AYV42031.1|2811174_2811693_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
AYV42032.1|2811705_2812896_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	4.8e-225
AYV44681.1|2812955_2813549_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	94.9	2.2e-101
AYV42033.1|2813573_2814110_+|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	90.8	7.7e-90
AYV42034.1|2814109_2814712_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.0	4.4e-94
AYV42035.1|2814683_2815127_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.3	8.3e-82
AYV42036.1|2815147_2816347_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	98.0	3.2e-213
AYV42037.1|2816343_2816955_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	98.0	2.7e-115
AYV42038.1|2816947_2817856_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
AYV42039.1|2817860_2818208_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
AYV42040.1|2818204_2818840_-|plate	phage baseplate assembly protein V	plate	A0A0F7LBP2	Escherichia_phage	97.6	2.7e-110
AYV42041.1|2818906_2819359_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	99.3	1.8e-76
AYV42042.1|2819351_2819819_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	8.7e-82
AYV42043.1|2819781_2819955_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	94.7	6.8e-24
AYV42044.1|2819926_2820352_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	96.4	3.0e-65
AYV42045.1|2820339_2820765_-	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	95.7	6.1e-58
AYV42046.1|2820779_2821277_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
AYV42047.1|2821276_2821558_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
AYV42048.1|2821561_2821765_-|tail	phage tail protein	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
AYV42049.1|2821764_2822274_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
AYV42050.1|2822373_2823117_-|terminase	terminase	terminase	Q94MJ2	Enterobacteria_phage	94.3	1.8e-121
AYV42051.1|2823120_2824194_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.7	1.5e-201
AYV42052.1|2824252_2825107_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	100.0	1.3e-139
AYV42053.1|2825280_2827053_+	oxidoreductase	NA	A0A0F7LCM8	Escherichia_phage	99.7	0.0e+00
AYV42054.1|2827052_2828087_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.4	5.5e-201
AYV42055.1|2828404_2830372_-	exonuclease SbcC	NA	NA	NA	NA	NA
AYV44682.1|2830371_2830824_-	hypothetical protein	NA	NA	NA	NA	NA
AYV42056.1|2830870_2832094_-	hypothetical protein	NA	NA	NA	NA	NA
AYV42057.1|2832183_2834466_-	replication endonuclease	NA	M1SV59	Escherichia_phage	91.6	0.0e+00
AYV42058.1|2834455_2834731_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
AYV42059.1|2834727_2834952_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	97.3	5.5e-34
AYV42060.1|2834951_2835254_-	hypothetical protein	NA	A0A0F7LDT6	Escherichia_phage	96.0	1.6e-44
AYV42061.1|2835253_2835478_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
AYV44683.1|2835541_2836042_-	replication protein B	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
AYV42062.1|2836038_2836236_-	hypothetical protein	NA	A0A0F7LDS9	Escherichia_phage	100.0	2.8e-29
AYV42063.1|2836219_2836495_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	2.8e-40
AYV42064.1|2836616_2836916_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
AYV42065.1|2837031_2838045_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
AYV44684.1|2838309_2838627_-	hypothetical protein	NA	NA	NA	NA	NA
2838184:2838198	attR	CATTGACCACATCGA	NA	NA	NA	NA
AYV42066.1|2839032_2839932_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 12
CP033605	Escherichia coli O157:H7 strain TR01 chromosome, complete genome	5569804	2865587	2986388	5569804	tail,transposase,holin,protease,terminase,tRNA,integrase,portal	Enterobacteria_phage(44.44%)	144	2930473:2930487	2949463:2949477
AYV42093.1|2865587_2867621_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
AYV42094.1|2867761_2871571_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
AYV42095.1|2871583_2872864_+	WGR domain-containing protein	NA	NA	NA	NA	NA
AYV44685.1|2873027_2874569_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
AYV42096.1|2874578_2878208_+	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
AYV42097.1|2878269_2878587_+	hypothetical protein	NA	NA	NA	NA	NA
AYV42098.1|2879827_2880916_+	MoxR family ATPase	NA	NA	NA	NA	NA
AYV42099.1|2880926_2882456_+	hypothetical protein	NA	NA	NA	NA	NA
AYV42100.1|2882474_2883206_+	hypothetical protein	NA	NA	NA	NA	NA
AYV42101.1|2883198_2884335_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
AYV42102.1|2884331_2886335_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
AYV42103.1|2886459_2886921_+	DUF1307 domain-containing protein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
AYV42104.1|2886962_2887433_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
AYV42105.1|2887479_2888199_-	DNA-binding response regulator	NA	NA	NA	NA	NA
AYV42106.1|2888195_2889881_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
AYV42107.1|2890395_2890644_+	DNA damage-inducible protein DinI	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
AYV42108.1|2891011_2891281_-|tail	phage tail protein	tail	Q687E5	Enterobacteria_phage	96.6	1.0e-42
AYV42109.1|2891282_2892596_-|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	99.5	2.2e-77
AYV42110.1|2892660_2893260_-	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	99.5	1.3e-109
AYV42111.1|2893327_2896801_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
AYV44686.1|2897041_2897671_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
AYV42112.1|2897616_2898360_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
AYV42113.1|2898370_2899069_-|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
AYV42114.1|2899068_2899398_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AYV42115.1|2899394_2902040_-|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
AYV42116.1|2902083_2902392_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	99.0	1.5e-53
AYV42117.1|2902418_2902841_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
AYV42118.1|2902854_2903607_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
AYV42119.1|2903614_2904013_-|tail	phage tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
AYV42120.1|2904025_2904649_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
AYV42121.1|2904651_2904933_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
AYV42122.1|2904925_2905252_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
AYV42123.1|2905339_2907364_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
AYV42124.1|2908809_2909022_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
AYV42125.1|2909018_2911142_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
AYV42126.1|2911138_2911615_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
AYV42127.1|2912132_2912318_-	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
AYV42128.1|2912545_2912692_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
AYV42129.1|2912691_2913261_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
AYV42130.1|2913531_2914065_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
AYV42131.1|2914069_2914285_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
AYV42132.1|2914362_2914608_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
AYV42133.1|2914648_2914828_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
AYV42134.1|2914964_2916911_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.8	0.0e+00
AYV42135.1|2917505_2918564_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	2.6e-206
AYV42136.1|2918714_2918912_-	TrmB family transcriptional regulator	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
AYV42137.1|2919138_2919960_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
AYV42138.1|2919956_2920331_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	4.2e-34
AYV42139.1|2920343_2921393_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.2	2.7e-107
AYV42140.1|2921394_2921673_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	4.8e-11
AYV42141.1|2921742_2922000_-	hypothetical protein	NA	NA	NA	NA	NA
AYV42142.1|2922220_2922433_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
AYV42143.1|2922621_2922726_-	hypothetical protein	NA	NA	NA	NA	NA
AYV42144.1|2922841_2923204_-	DUF551 domain-containing protein	NA	A0A0P0ZCX1	Stx2-converting_phage	97.5	2.8e-67
AYV42145.1|2923200_2923572_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.0	1.3e-48
AYV42146.1|2923607_2923820_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
AYV44688.1|2923868_2924225_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	3.7e-56
AYV42147.1|2924281_2924677_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
AYV42148.1|2924692_2925463_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	65.6	7.2e-81
AYV44687.1|2925497_2925920_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	97.1	2.2e-76
AYV42149.1|2925951_2926992_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.7	1.8e-90
AYV42150.1|2926963_2927515_-	hypothetical protein	NA	NA	NA	NA	NA
AYV42151.1|2927498_2927726_-	transcriptional regulator	NA	NA	NA	NA	NA
AYV42152.1|2927803_2928211_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
AYV42153.1|2928400_2928556_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
AYV42154.1|2928715_2928934_+	hypothetical protein	NA	NA	NA	NA	NA
AYV44689.1|2928937_2929102_-	hypothetical protein	NA	NA	NA	NA	NA
AYV42155.1|2929499_2929688_+	cell division inhibitor	NA	NA	NA	NA	NA
AYV42156.1|2929684_2929873_+	DUF1482 family protein	NA	NA	NA	NA	NA
AYV42157.1|2929965_2932410_+	exonuclease	NA	V5UQJ3	Shigella_phage	58.2	3.2e-175
2930473:2930487	attL	GAACTGCCTGCTGTT	NA	NA	NA	NA
AYV42158.1|2932474_2932723_+	excisionase	NA	NA	NA	NA	NA
AYV42159.1|2932700_2933831_+|integrase	integrase	integrase	O21940	Phage_21	51.1	1.7e-102
AYV42160.1|2934854_2935445_-	protein kinase	NA	NA	NA	NA	NA
AYV42161.1|2936577_2936847_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	98.9	2.4e-44
AYV42162.1|2936848_2938162_-|tail	phage tail protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.3	3.9e-79
AYV42163.1|2938226_2938826_-	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	4.1e-108
AYV42164.1|2938893_2942370_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.6	0.0e+00
AYV44690.1|2942610_2943240_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.1	1.7e-101
AYV42165.1|2943185_2943929_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	2.4e-150
AYV42166.1|2943939_2944638_-|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	98.3	5.2e-131
AYV42167.1|2944637_2944967_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
AYV42168.1|2944963_2947609_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	94.4	0.0e+00
AYV42169.1|2947652_2947961_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
AYV42170.1|2947987_2948410_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
AYV42171.1|2948423_2949176_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
AYV42172.1|2949183_2949582_-|tail	phage tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
2949463:2949477	attR	AACAGCAGGCAGTTC	NA	NA	NA	NA
AYV42173.1|2949594_2950218_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	99.5	2.5e-100
AYV42174.1|2950220_2950502_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
AYV42175.1|2950494_2950821_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
AYV42176.1|2950908_2952933_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
AYV42177.1|2952877_2954380_-|portal	phage portal protein	portal	S5MW34	Escherichia_phage	99.8	3.1e-290
AYV42178.1|2954379_2954592_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
AYV42179.1|2954588_2956712_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	99.7	0.0e+00
AYV42180.1|2956708_2957185_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
AYV42181.1|2957659_2957845_-	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
AYV42182.1|2958363_2958897_-	lysozyme	NA	A0A2R2Z343	Escherichia_phage	96.6	3.6e-100
AYV44691.1|2958933_2959491_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	80.9	1.5e-48
AYV42183.1|2959494_2959710_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	100.0	1.2e-33
AYV42184.1|2959787_2960033_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
AYV42185.1|2960073_2960253_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
AYV42186.1|2960387_2962334_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.5	0.0e+00
AYV42187.1|2963137_2963290_-	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
AYV42188.1|2963304_2963553_+	hypothetical protein	NA	A0A0P0ZGS0	Escherichia_phage	98.8	1.2e-34
AYV42189.1|2963541_2963976_-	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
AYV42190.1|2964061_2964202_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
AYV42191.1|2964198_2964561_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
AYV42192.1|2964557_2964848_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
AYV42193.1|2964840_2965011_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
AYV42194.1|2965010_2965466_-	hypothetical protein	NA	I6PD71	Cronobacter_phage	67.5	1.1e-60
AYV42195.1|2965462_2965564_-	hypothetical protein	NA	NA	NA	NA	NA
AYV42196.1|2965680_2966478_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYV42197.1|2966487_2967039_-	kinase inhibitor	NA	NA	NA	NA	NA
AYV42198.1|2967503_2969030_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
AYV42199.1|2969087_2969195_-	hypothetical protein	NA	NA	NA	NA	NA
AYV42200.1|2969286_2969619_-	multidrug SMR transporter	NA	NA	NA	NA	NA
AYV42201.1|2969686_2969989_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
AYV42202.1|2970476_2971689_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AYV44692.1|2971995_2972925_-	Replication protein O	NA	A0A0M5M7Y1	Salmonella_phage	64.4	3.6e-111
AYV42203.1|2973011_2973551_-	regulator	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
AYV42204.1|2973620_2973851_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	69.3	3.8e-22
AYV42205.1|2973955_2974645_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
AYV42206.1|2974725_2975787_+	N-acetyltransferase	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
AYV42207.1|2975764_2976142_+	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
AYV42208.1|2976622_2976829_+	cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
AYV42209.1|2976904_2977201_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
AYV42210.1|2977206_2977992_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
AYV42211.1|2977988_2978666_+	exonuclease	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
AYV44693.1|2978665_2978848_+	DUF1317 family protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
AYV42212.1|2978820_2979012_+	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
AYV42213.1|2979022_2979304_+	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
AYV42214.1|2979402_2979624_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
AYV42215.1|2979620_2980568_+	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
AYV42216.1|2980569_2980746_+	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
AYV42217.1|2980715_2981003_+	hypothetical protein	NA	NA	NA	NA	NA
AYV42218.1|2981079_2981436_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
AYV42219.1|2981432_2981795_+	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
AYV42220.1|2981882_2982125_+	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
AYV42221.1|2982128_2982263_+	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	97.7	1.4e-21
AYV42222.1|2982281_2982536_+	excisionase	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
AYV42223.1|2982569_2983856_+	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
AYV42224.1|2983876_2984578_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.9	8.8e-102
AYV42225.1|2984637_2984745_+	protein YohO	NA	NA	NA	NA	NA
AYV42226.1|2984725_2985457_-	ABC transporter permease	NA	NA	NA	NA	NA
AYV42227.1|2985461_2986388_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 13
CP033605	Escherichia coli O157:H7 strain TR01 chromosome, complete genome	5569804	3201416	3300183	5569804	tail,transposase,holin,protease,terminase,tRNA,lysis,capsid,portal,bacteriocin	Escherichia_phage(45.92%)	124	NA	NA
AYV42405.1|3201416_3202229_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
AYV42406.1|3202228_3203242_-	USG-1 protein	NA	NA	NA	NA	NA
AYV42407.1|3203307_3204444_-	erythronate-4-phosphate dehydrogenase	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.8	4.1e-24
AYV42408.1|3204542_3205538_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
AYV42409.1|3205534_3206713_-	arabinose transporter	NA	NA	NA	NA	NA
AYV42410.1|3206987_3208208_-	3-oxoacyl-ACP synthase I	NA	NA	NA	NA	NA
AYV42411.1|3208366_3210373_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
AYV42412.1|3210493_3210772_-	YfcL family protein	NA	NA	NA	NA	NA
AYV42413.1|3210805_3211354_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
AYV42414.1|3211353_3212163_-	hypothetical protein	NA	NA	NA	NA	NA
AYV42415.1|3212162_3212987_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
AYV42416.1|3212990_3214076_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
AYV42417.1|3214110_3215043_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
AYV42418.1|3215208_3215760_+	endonuclease SmrB	NA	NA	NA	NA	NA
AYV42419.1|3215928_3216771_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
AYV42420.1|3216772_3217294_-	fimbrial protein	NA	NA	NA	NA	NA
AYV42421.1|3217526_3217700_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AYV44700.1|3217696_3218125_-	fimbrial protein	NA	NA	NA	NA	NA
AYV42422.1|3218163_3218664_-	fimbrial protein	NA	NA	NA	NA	NA
AYV42423.1|3218680_3219430_-	fimbrial protein	NA	NA	NA	NA	NA
AYV42424.1|3222172_3222736_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
AYV42425.1|3223381_3223867_-	phosphohistidine phosphatase	NA	NA	NA	NA	NA
AYV42426.1|3224069_3226214_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
AYV42427.1|3226213_3227524_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
AYV42428.1|3227704_3227989_-	DUF406 family protein	NA	NA	NA	NA	NA
AYV42429.1|3228360_3229701_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
AYV42430.1|3230066_3231098_+	hypothetical protein	NA	NA	NA	NA	NA
AYV42431.1|3231489_3232245_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
AYV42432.1|3232538_3233471_+	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	99.7	7.9e-167
AYV42433.1|3233692_3242068_-	hypothetical protein	NA	A0A0P0ZCC7	Stx2-converting_phage	100.0	0.0e+00
AYV42434.1|3242136_3243402_-	hypothetical protein	NA	A0A0P0ZD72	Stx2-converting_phage	100.0	4.4e-229
AYV42435.1|3243412_3243706_-|bacteriocin	bacteriocin	bacteriocin	A0A0P0ZDW9	Stx2-converting_phage	100.0	4.1e-13
AYV42436.1|3243715_3244162_-	hypothetical protein	NA	V5UT82	Shigella_phage	100.0	1.1e-76
AYV42437.1|3244164_3244821_-	hypothetical protein	NA	A0A0P0ZCM5	Stx2-converting_phage	100.0	5.1e-104
AYV42438.1|3244915_3245317_-	hypothetical protein	NA	A0A088CC37	Shigella_phage	100.0	1.2e-71
AYV42439.1|3245373_3245514_-	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
AYV42440.1|3245744_3246479_-	porin family protein	NA	A0A0P0ZH34	Escherichia_phage	100.0	9.7e-136
AYV42441.1|3246569_3247187_-	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
AYV42442.1|3247192_3247471_-	hypothetical protein	NA	A0A088CD71	Shigella_phage	100.0	1.1e-50
AYV42443.1|3247485_3248754_-	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
AYV42444.1|3248750_3250376_-	hypothetical protein	NA	A0A0P0ZDC2	Stx2-converting_phage	100.0	0.0e+00
AYV42445.1|3250670_3250859_-	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
AYV42446.1|3250997_3251267_-|tail	phage tail protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
AYV42447.1|3251268_3253206_-|tail	phage tail protein	tail	A0A0P0ZCY7	Stx2-converting_phage	100.0	1.1e-64
AYV42448.1|3253202_3253853_-	hypothetical protein	NA	A0A2R2X2B3	Escherichia_phage	100.0	7.8e-121
AYV42449.1|3253852_3254416_-	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
AYV42450.1|3254399_3254861_-	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
AYV42451.1|3254910_3255300_-	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
AYV42452.1|3255355_3256570_-|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
AYV42453.1|3256593_3257010_-	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.6e-69
AYV42454.1|3257140_3258353_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	99.7	1.7e-169
AYV42455.1|3259071_3261216_-|portal	portal protein	portal	A0A0P0ZBZ2	Stx2-converting_phage	100.0	0.0e+00
AYV42456.1|3261215_3262922_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
AYV42457.1|3262902_3263709_-|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
AYV42458.1|3263764_3263968_-	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
AYV42459.1|3264117_3264411_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
AYV42460.1|3264442_3264907_-|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
AYV42461.1|3264914_3265064_-	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
AYV42462.1|3265063_3265633_-	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
AYV42463.1|3265906_3266440_-	lysozyme	NA	V5USG4	Shigella_phage	96.0	1.5e-98
AYV42464.1|3266444_3266660_-|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
AYV42465.1|3266736_3267009_-	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
AYV42466.1|3267049_3267229_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
AYV42467.1|3267363_3269301_-	DUF1737 domain-containing protein	NA	A0A1I9LJQ8	Stx_converting_phage	100.0	0.0e+00
AYV42468.1|3269787_3270057_-	Shiga toxin Stx2 subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
AYV42469.1|3270068_3271028_-	Shiga toxin Stx2 subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
AYV42470.1|3271408_3271561_-	DNA methylase	NA	A0A0N7C2V5	Escherichia_phage	100.0	5.2e-20
AYV42471.1|3271575_3271821_+	hypothetical protein	NA	Q7Y2J1	Escherichia_phage	100.0	2.7e-34
AYV42472.1|3271809_3272244_-	antitermination protein	NA	G9L695	Escherichia_phage	100.0	2.8e-82
AYV42473.1|3272236_3272431_-	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
AYV42474.1|3272427_3273033_-	recombination protein NinG	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
AYV42475.1|3273032_3273755_-	DNA-binding protein	NA	A0A0P0ZCJ8	Stx2-converting_phage	100.0	5.4e-131
AYV42476.1|3273747_3273957_-	protein ninF	NA	G9L691	Escherichia_phage	100.0	1.4e-31
AYV42477.1|3273916_3274318_-	hypothetical protein	NA	G9L690	Escherichia_phage	100.0	1.4e-72
AYV42478.1|3274392_3275067_-	phage antirepressor Ant	NA	G9L689	Escherichia_phage	100.0	1.6e-129
AYV42479.1|3275323_3275518_-	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	2.9e-31
AYV42480.1|3275514_3276042_-	phage N-6-adenine-methyltransferase	NA	A0A0N7KZD1	Stx2-converting_phage	100.0	7.3e-101
AYV42481.1|3276038_3276641_-	endonuclease	NA	G9L687	Escherichia_phage	100.0	1.7e-114
AYV42482.1|3276633_3277050_-	NinB protein	NA	G9L686	Escherichia_phage	100.0	3.9e-73
AYV42483.1|3277030_3277213_-	hypothetical protein	NA	G9L685	Escherichia_phage	100.0	1.6e-28
AYV42484.1|3277223_3277439_-	hypothetical protein	NA	G9L684	Escherichia_phage	100.0	2.2e-32
AYV42485.1|3277571_3277850_-	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
AYV42486.1|3277920_3278211_-	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
AYV42487.1|3278207_3278909_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	100.0	3.4e-130
AYV42488.1|3278905_3279844_-	Replication protein O	NA	C1JJ53	Enterobacteria_phage	100.0	2.8e-172
AYV42489.1|3279876_3280173_-	hypothetical protein	NA	A0A0N7KZD0	Stx2-converting_phage	100.0	5.2e-48
AYV42490.1|3280311_3280539_-	DNA-binding protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
AYV42491.1|3280617_3281325_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
AYV42492.1|3281385_3281727_+	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	100.0	5.1e-63
AYV42493.1|3281794_3282256_+	hypothetical protein	NA	A0A0P0ZD85	Stx2-converting_phage	100.0	1.7e-77
AYV42494.1|3282249_3283296_+	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
AYV42495.1|3283951_3284335_+	antitermination protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
AYV42496.1|3284393_3284864_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
AYV42497.1|3285014_3285383_+	DUF2528 family protein	NA	A0A0P0ZCC3	Stx2-converting_phage	100.0	4.5e-65
AYV42498.1|3285455_3285620_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
AYV42499.1|3285588_3285753_+	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	100.0	1.9e-23
AYV42500.1|3285686_3285839_+	host-nuclease inhibitor protein Gam	NA	Q08J51	Stx2-converting_phage	96.0	1.8e-20
AYV42501.1|3285807_3286104_+	host-nuclease inhibitor protein Gam	NA	A0A0P0ZCL3	Stx2-converting_phage	100.0	2.1e-49
AYV42502.1|3286109_3286895_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
AYV42503.1|3286891_3287572_+	exonuclease	NA	A0A0P0ZBV6	Stx2-converting_phage	100.0	2.1e-132
AYV42504.1|3287568_3287751_+	DUF1317 family protein	NA	Q6H9Z1	Enterobacteria_phage	100.0	9.7e-29
AYV42505.1|3287723_3287915_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
AYV42506.1|3287925_3288207_+	cell division protein ZapA	NA	Q6H9Z3	Enterobacteria_phage	100.0	3.2e-47
AYV42507.1|3288305_3288527_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	100.0	3.8e-35
AYV42508.1|3288523_3289471_+	ead/Ea22-like family protein	NA	A0A0P0ZDS3	Stx2-converting_phage	100.0	2.1e-183
AYV42509.1|3289472_3289979_+	hypothetical protein	NA	A0A0N7C063	Escherichia_phage	100.0	4.2e-90
AYV42510.1|3289938_3290154_+	hypothetical protein	NA	A0A0N7C076	Escherichia_phage	100.0	7.9e-38
AYV42511.1|3290155_3290374_+	DUF4014 domain-containing protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
AYV42512.1|3290375_3290663_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
AYV42513.1|3290666_3291284_+	DUF551 domain-containing protein	NA	A0A1I9LJM0	Stx_converting_phage	100.0	7.7e-118
AYV42514.1|3291283_3291568_+	DUF4752 family protein	NA	A0A0N7KZC7	Stx2-converting_phage	100.0	4.5e-49
AYV42515.1|3291923_3292547_+	phage antirepressor Ant	NA	A0A0P0ZAZ7	Stx2-converting_phage	100.0	1.7e-112
AYV42516.1|3292589_3292757_+	hypothetical protein	NA	A0A0P0ZCR2	Stx2-converting_phage	100.0	2.9e-27
AYV42517.1|3292756_3292987_+	hypothetical protein	NA	Q08J65	Stx2-converting_phage	100.0	1.9e-37
AYV42518.1|3292983_3293610_+	adenine methylase	NA	A0A2R2Z304	Escherichia_phage	100.0	1.0e-122
AYV42519.1|3293569_3293782_+	DUF1382 family protein	NA	A0A2R2X2A7	Escherichia_phage	100.0	7.1e-31
AYV42520.1|3293817_3294195_+	DUF1627 domain-containing protein	NA	A0A2R2Z2X7	Escherichia_phage	100.0	2.0e-52
AYV42521.1|3294273_3294456_+	DNA-binding protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
AYV42522.1|3294439_3295609_-	DUF4102 domain-containing protein	NA	A0A2R2Z2Y0	Escherichia_phage	100.0	1.7e-230
AYV42523.1|3296040_3297198_+	DUF4102 domain-containing protein	NA	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
AYV42524.1|3297372_3298509_-	acyltransferase	NA	Q716G3	Shigella_phage	72.8	1.4e-80
AYV42525.1|3298518_3299199_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
AYV42526.1|3299185_3299653_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
AYV42527.1|3299652_3300183_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	5.7e-69
>prophage 14
CP033605	Escherichia coli O157:H7 strain TR01 chromosome, complete genome	5569804	3540681	3594298	5569804	tail,transposase,holin,tRNA,capsid	Enterobacteria_phage(34.78%)	60	NA	NA
AYV42732.1|3540681_3541719_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
AYV42733.1|3541925_3542345_+	thiol disulfide reductase thioredoxin	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
AYV42734.1|3542413_3543112_+	DTW domain-containing protein	NA	NA	NA	NA	NA
AYV42735.1|3543143_3545804_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
AYV42736.1|3545917_3547273_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AYV42737.1|3547318_3547642_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
AYV42738.1|3547638_3548937_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.9	3.7e-45
AYV42739.1|3554698_3557272_-	chaperone protein ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
AYV42740.1|3557401_3558133_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
AYV42741.1|3558129_3559110_-	ribosomal large subunit pseudouridine synthase D	NA	NA	NA	NA	NA
AYV42742.1|3559244_3559982_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
AYV42743.1|3560252_3560594_+	ribosome-associated inhibitor A	NA	NA	NA	NA	NA
AYV44709.1|3560697_3560745_+	hypothetical protein	NA	NA	NA	NA	NA
AYV42744.1|3560843_3562004_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
AYV42745.1|3562046_3563168_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AYV42746.1|3563178_3564249_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	6.9e-90
AYV42747.1|3564458_3564824_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
AYV42748.1|3564973_3565492_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
AYV42749.1|3565481_3566708_+	diguanylate cyclase	NA	NA	NA	NA	NA
AYV42750.1|3566723_3567206_+	OmpA family protein	NA	NA	NA	NA	NA
AYV42751.1|3567282_3567630_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
AYV42752.1|3567671_3568439_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
AYV42753.1|3568469_3569018_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
AYV42754.1|3569036_3569285_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
AYV42755.1|3569421_3570783_-	signal recognition particle protein	NA	NA	NA	NA	NA
AYV44710.1|3570949_3571741_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
AYV44711.1|3571806_3573048_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
AYV42756.1|3573102_3573696_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
AYV42757.1|3573692_3573887_-	molecular chaperone GrpE	NA	NA	NA	NA	NA
AYV42758.1|3573818_3574697_+	NAD(+) kinase	NA	NA	NA	NA	NA
AYV42759.1|3574782_3576444_+	DNA repair protein RecN	NA	NA	NA	NA	NA
AYV42760.1|3576592_3576934_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
AYV42761.1|3576995_3577286_-	RnfH family protein	NA	NA	NA	NA	NA
AYV42762.1|3577275_3577752_-	ubiquinone-binding protein	NA	NA	NA	NA	NA
AYV42763.1|3577883_3578366_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
AYV42764.1|3579211_3579460_+	DNA damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
AYV42765.1|3579456_3579546_-|capsid	capsid protein	capsid	NA	NA	NA	NA
AYV42766.1|3579584_3579743_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	93.6	1.1e-17
AYV42767.1|3579855_3579975_+	ferredoxin	NA	NA	NA	NA	NA
AYV42768.1|3579961_3580552_-	bfpT-regulated chaperone	NA	NA	NA	NA	NA
AYV42769.1|3580734_3581385_+	DUF1076 domain-containing protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
AYV42770.1|3581463_3582522_+	type III effector	NA	NA	NA	NA	NA
AYV42771.1|3582651_3583074_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
AYV42772.1|3583234_3583504_-|tail	phage tail protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
AYV42773.1|3583721_3584048_+	hypothetical protein	NA	A0A0N7BVE9	Escherichia_phage	100.0	1.3e-55
AYV42774.1|3584044_3584935_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	5.6e-170
AYV42775.1|3584741_3585386_-	hypothetical protein	NA	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.8e-69
AYV42776.1|3585435_3585783_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
AYV42777.1|3585779_3586160_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
AYV42778.1|3586235_3586466_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	97.3	2.8e-33
AYV42779.1|3586516_3586861_-	DUF1327 domain-containing protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
AYV42780.1|3586865_3587081_-|holin	holin	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
AYV42781.1|3587230_3589084_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
AYV42782.1|3589529_3589697_-	DUF3927 domain-containing protein	NA	NA	NA	NA	NA
AYV42783.1|3589782_3590526_-	hypothetical protein	NA	NA	NA	NA	NA
AYV42784.1|3590778_3591402_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
AYV42785.1|3591398_3592064_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
AYV42786.1|3592060_3592672_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
AYV42787.1|3592646_3593213_-	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
AYV42788.1|3593542_3594298_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 15
CP033605	Escherichia coli O157:H7 strain TR01 chromosome, complete genome	5569804	5177052	5191717	5569804	tail,tRNA,integrase	Enterobacteria_phage(43.75%)	19	5178333:5178348	5195869:5195884
AYV44188.1|5177052_5177586_+	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
AYV44189.1|5178003_5178285_-	pyocin activator protein PrtN	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5178333:5178348	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
AYV44190.1|5178629_5178827_-	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
AYV44191.1|5178973_5179153_-	methyltransferase	NA	H9C170	Pectobacterium_phage	76.3	1.2e-20
AYV44192.1|5179162_5179447_-	class I SAM-dependent methyltransferase	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
AYV44193.1|5179565_5179793_-	hypothetical protein	NA	K7PH61	Enterobacteria_phage	93.9	6.0e-20
AYV44194.1|5179783_5180320_-	HD family hydrolase	NA	U5P0T3	Shigella_phage	97.2	7.7e-98
AYV44195.1|5181642_5182242_+	Ail/Lom family protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
AYV44196.1|5182306_5183620_+|tail	phage tail protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
AYV44197.1|5183621_5183891_+|tail	phage tail protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
AYV44198.1|5184002_5184575_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
AYV44199.1|5184647_5185277_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
AYV44200.1|5185358_5186000_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
AYV44201.1|5186160_5186409_-	damage-inducible protein DinI	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
AYV44202.1|5186470_5187568_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
AYV44203.1|5187656_5188694_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
AYV44204.1|5188827_5189070_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
AYV44205.1|5189235_5190219_-	quinone oxidoreductase	NA	NA	NA	NA	NA
AYV44206.1|5190301_5191717_+	replicative DNA helicase DnaB	NA	O80281	Escherichia_phage	78.3	4.8e-200
5195869:5195884	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
