The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033576	Bacillus velezensis strain NY12-2 chromosome, complete genome	4074913	10027	22666	4074913	holin	Bacillus_phage(90.91%)	17	NA	NA
AYV15926.1|10027_10453_+	SDR family NAD(P)-dependent oxidoreductase	NA	A0A1V0SAI8	Catovirus	35.6	2.7e-13
AYV15927.1|10486_10663_-	hypothetical protein	NA	O64196	Bacillus_phage	93.1	6.5e-22
AYV15928.1|11030_11384_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
AYV15929.1|11594_11831_+	hypothetical protein	NA	NA	NA	NA	NA
AYV15930.1|11954_12329_+	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	52.0	7.6e-28
AYV15931.1|13387_14524_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	76.1	5.3e-165
AYV15932.1|14513_14696_+	hypothetical protein	NA	NA	NA	NA	NA
AYV15933.1|15023_16043_+	hypothetical protein	NA	NA	NA	NA	NA
AYV15934.1|16104_16464_-	hypothetical protein	NA	O64028	Bacillus_phage	61.4	7.5e-33
AYV15935.1|16469_16937_-	DUF4879 domain-containing protein	NA	O64027	Bacillus_phage	56.5	8.0e-43
AYV15936.1|17161_17251_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
AYV15937.1|17538_18072_-	N-acetyltransferase	NA	O64026	Bacillus_phage	98.9	4.0e-99
AYV15938.1|18107_18686_-	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	93.2	1.4e-100
AYV15939.1|18749_19247_-	SMI1/KNR4 family protein	NA	O64024	Bacillus_phage	98.2	4.8e-94
AYV15940.1|19255_20971_-	hypothetical protein	NA	O64023	Bacillus_phage	73.2	8.4e-239
AYV19600.1|21007_21445_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
AYV15941.1|21700_22666_+	endonuclease	NA	A0A1P8CWK6	Bacillus_phage	77.2	1.2e-80
>prophage 2
CP033576	Bacillus velezensis strain NY12-2 chromosome, complete genome	4074913	159677	165930	4074913		Staphylococcus_phage(66.67%)	10	NA	NA
AYV16091.1|159677_160271_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.6	2.6e-14
AYV16092.1|160260_161016_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.7	2.2e-10
AYV16093.1|161223_161313_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
AYV16094.1|161400_161922_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
AYV16095.1|161866_162082_+	hypothetical protein	NA	NA	NA	NA	NA
AYV16096.1|161987_162362_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYV16097.1|162478_162943_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.2e-43
AYV16098.1|162975_164172_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	2.1e-116
AYV16099.1|164186_164834_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	8.8e-40
AYV16100.1|164814_165930_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.3	5.7e-55
>prophage 3
CP033576	Bacillus velezensis strain NY12-2 chromosome, complete genome	4074913	484948	565568	4074913	protease,tail,capsid,tRNA,head,holin,terminase,integrase,portal	Bacillus_phage(44.19%)	97	506173:506210	547251:547288
AYV16381.1|484948_485431_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
AYV16382.1|485494_486379_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYV16383.1|486503_487712_+	MFS transporter	NA	NA	NA	NA	NA
AYV16384.1|487861_491023_-	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	37.3	2.9e-75
AYV16385.1|491050_491617_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
AYV16386.1|491826_492366_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYV16387.1|492866_493007_-	YrzI family small protein	NA	NA	NA	NA	NA
AYV16388.1|493061_493310_-	hypothetical protein	NA	NA	NA	NA	NA
AYV16389.1|493396_494197_-	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
AYV16390.1|494461_494830_-	DUF2294 domain-containing protein	NA	NA	NA	NA	NA
AYV19622.1|495136_498079_+	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
AYV16391.1|498096_498588_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
AYV16392.1|498626_498857_-	hypothetical protein	NA	NA	NA	NA	NA
AYV16393.1|498940_500083_-	bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase	NA	A0A0B5JD48	Pandoravirus	29.6	1.2e-20
AYV16394.1|500084_501008_-	cysteine synthase family protein	NA	A0A1W6JHY1	Lactococcus_phage	43.4	8.4e-60
AYV16395.1|501055_501751_-	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
AYV16396.1|501771_502413_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYV19623.1|502596_502800_+	DUF2536 family protein	NA	NA	NA	NA	NA
AYV16397.1|502839_503556_-	DUF1510 family protein	NA	NA	NA	NA	NA
AYV16398.1|503619_505374_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
AYV16399.1|505426_505900_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
506173:506210	attL	TCAAGGATCGTTTGAATCTTCGTGACCATCAGATCAAT	NA	NA	NA	NA
AYV16400.1|506513_507173_+	hypothetical protein	NA	NA	NA	NA	NA
AYV16401.1|507429_507939_+	hypothetical protein	NA	NA	NA	NA	NA
AYV16402.1|507956_508151_+	hypothetical protein	NA	NA	NA	NA	NA
AYV16403.1|508207_509218_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A1J0MS59	Bacillus_phage	98.5	2.9e-191
AYV16404.1|509266_509689_-|holin	holin	holin	D6R405	Bacillus_phage	87.1	8.0e-58
AYV16405.1|509734_509923_-	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	96.8	3.1e-30
AYV16406.1|509919_510282_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	91.7	4.9e-56
AYV16407.1|510278_511556_-	DUF2479 domain-containing protein	NA	D6R402	Bacillus_phage	85.2	8.9e-153
AYV16408.1|511572_514137_-	peptidase G2	NA	D6R401	Bacillus_phage	91.2	0.0e+00
AYV16409.1|514185_515889_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	57.2	9.3e-182
AYV16410.1|515903_516752_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	56.2	4.3e-87
AYV16411.1|516745_521233_-|tail	phage tail tape measure protein	tail	A0A1Q1PVX7	Staphylococcus_phage	42.8	3.8e-65
AYV16412.1|521439_521808_-	hypothetical protein	NA	NA	NA	NA	NA
AYV16413.1|521866_522481_-|tail	phage tail protein	tail	A0A2H4J8F3	uncultured_Caudovirales_phage	34.4	2.9e-24
AYV16414.1|522495_522879_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
AYV16415.1|522875_523274_-	hypothetical protein	NA	NA	NA	NA	NA
AYV16416.1|523273_523588_-|head,tail	head-tail adaptor protein	head,tail	A0A2H4JCB1	uncultured_Caudovirales_phage	36.3	8.4e-12
AYV16417.1|523577_523880_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	40.5	1.2e-10
AYV16418.1|523897_524314_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	46.7	9.4e-11
AYV16419.1|524341_525634_-|capsid	phage major capsid protein	capsid	A0A0A7RTL2	Clostridium_phage	47.4	3.2e-89
AYV16420.1|525671_526298_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	79.1	1.5e-84
AYV16421.1|526260_527541_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	63.3	2.6e-152
AYV16422.1|527729_529439_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	62.6	2.1e-205
AYV16423.1|529435_529951_-|terminase	phage terminase small subunit P27 family	terminase	A6M947	Geobacillus_virus	44.6	9.8e-34
AYV16424.1|529960_530158_-	hypothetical protein	NA	NA	NA	NA	NA
AYV16425.1|530179_530545_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	55.0	2.1e-30
AYV16426.1|530534_530903_-	hypothetical protein	NA	NA	NA	NA	NA
AYV16427.1|530950_531265_-	hypothetical protein	NA	NA	NA	NA	NA
AYV16428.1|531261_531543_-	hypothetical protein	NA	NA	NA	NA	NA
AYV16429.1|532037_532235_-	hypothetical protein	NA	NA	NA	NA	NA
AYV16430.1|532301_532514_-	cell division protein FtsK	NA	A0A0K2CPG8	Brevibacillus_phage	54.1	5.1e-05
AYV16431.1|533002_533545_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	65.6	1.2e-61
AYV16432.1|533541_533994_-	DUF1492 domain-containing protein	NA	S6AVV9	Thermus_phage	57.4	1.5e-38
AYV16433.1|534005_534518_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4J6J3	uncultured_Caudovirales_phage	38.8	1.7e-30
AYV16434.1|534790_535066_-	hypothetical protein	NA	NA	NA	NA	NA
AYV16435.1|535448_535883_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	71.4	1.1e-49
AYV16436.1|535882_536194_-	hypothetical protein	NA	NA	NA	NA	NA
AYV16437.1|536198_536381_-	hypothetical protein	NA	A0A1P8CWX9	Bacillus_phage	52.2	5.0e-09
AYV16438.1|536396_536624_-	hypothetical protein	NA	A0A217EQZ3	Bacillus_phage	63.5	2.0e-23
AYV16439.1|536620_536923_-	hypothetical protein	NA	NA	NA	NA	NA
AYV16440.1|536924_537602_-	dUTPase	NA	R9TQ23	Paenibacillus_phage	46.7	4.3e-37
AYV16441.1|537598_537922_-	hypothetical protein	NA	NA	NA	NA	NA
AYV16442.1|538031_539042_-	DNA (cytosine-5-)-methyltransferase	NA	A0A2I7SDI7	Paenibacillus_phage	40.5	6.1e-64
AYV16443.1|539046_539301_-	hypothetical protein	NA	F8WQ54	Bacillus_phage	40.3	1.9e-06
AYV16444.1|539297_539519_-	hypothetical protein	NA	NA	NA	NA	NA
AYV16445.1|539515_539845_-	VWA domain-containing protein	NA	NA	NA	NA	NA
AYV16446.1|539876_540080_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	56.7	2.6e-14
AYV16447.1|540327_540468_-	BH0509 family protein	NA	NA	NA	NA	NA
AYV16448.1|540576_541125_-	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	36.5	2.0e-05
AYV19624.1|541440_542271_-	ATP-binding protein	NA	A0A0U3U1U1	Bacillus_phage	35.1	2.4e-34
AYV16449.1|542254_543133_-	DNA replication protein DnaD	NA	A0A0U3TZZ4	Bacillus_phage	48.7	1.2e-60
AYV16450.1|543146_543464_-	hypothetical protein	NA	NA	NA	NA	NA
AYV16451.1|543506_543713_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYV16452.1|543857_544247_+	XRE family transcriptional regulator	NA	A0A0B5CYL9	Listeria_phage	32.2	9.1e-08
AYV16453.1|544608_545706_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYV16454.1|546010_547171_+|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	36.3	4.9e-65
AYV16455.1|547234_547867_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.2	3.2e-34
547251:547288	attR	TCAAGGATCGTTTGAATCTTCGTGACCATCAGATCAAT	NA	NA	NA	NA
AYV16456.1|547873_549142_-|protease	collagenase-like protease	protease	Q6DW11	Phage_TP	31.2	2.1e-37
AYV16457.1|549159_550089_-	U32 family peptidase	NA	NA	NA	NA	NA
AYV16458.1|550095_550749_-	O-methyltransferase	NA	NA	NA	NA	NA
AYV16459.1|550900_551992_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
AYV16460.1|552101_552383_-	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
AYV16461.1|552395_552812_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
AYV16462.1|552820_553087_-	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
AYV16463.1|553171_555808_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	34.1	9.1e-67
AYV16464.1|556139_557201_-	AI-2E family transporter	NA	NA	NA	NA	NA
AYV16465.1|557419_558148_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.4	4.3e-35
AYV16466.1|558168_558996_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYV16467.1|559052_559703_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AYV16468.1|559721_560378_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AYV16469.1|560413_560545_-	DUF3918 domain-containing protein	NA	NA	NA	NA	NA
AYV16470.1|560566_560758_-	hypothetical protein	NA	NA	NA	NA	NA
AYV16471.1|560770_561229_-	hypothetical protein	NA	NA	NA	NA	NA
AYV16472.1|561347_563726_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.6	1.5e-81
AYV19625.1|563744_564365_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
AYV16473.1|564452_565568_-|tRNA	tRNA(5-methylaminomethyl-2-thiouridine)- methyltransferase	tRNA	NA	NA	NA	NA
>prophage 4
CP033576	Bacillus velezensis strain NY12-2 chromosome, complete genome	4074913	1547966	1606191	4074913	coat,protease,tRNA	Bacillus_phage(23.08%)	60	NA	NA
AYV17380.1|1547966_1549637_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
AYV17381.1|1549633_1550062_-	DUF1934 family protein	NA	NA	NA	NA	NA
AYV17382.1|1550353_1551499_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	42.9	3.2e-77
AYV17383.1|1551482_1551602_+	phosphatase	NA	NA	NA	NA	NA
AYV17384.1|1551724_1552597_-	agmatinase	NA	NA	NA	NA	NA
AYV17385.1|1552656_1553487_-	spermidine synthase	NA	NA	NA	NA	NA
AYV17386.1|1553686_1555759_+	penicillin-binding protein	NA	NA	NA	NA	NA
AYV17387.1|1555783_1556215_-	hypothetical protein	NA	NA	NA	NA	NA
AYV17388.1|1556358_1556877_-	hypothetical protein	NA	NA	NA	NA	NA
AYV17389.1|1556889_1557549_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
AYV17390.1|1557654_1557843_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
AYV17391.1|1557880_1558300_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYV17392.1|1558683_1560063_+	amino acid permease	NA	NA	NA	NA	NA
AYV17393.1|1560127_1560628_-	YwgA family protein	NA	NA	NA	NA	NA
AYV17394.1|1560667_1561969_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.5	1.0e-23
AYV17395.1|1562129_1562354_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
AYV17396.1|1562556_1563330_+	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
AYV17397.1|1563629_1563905_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
AYV17398.1|1563905_1564460_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
AYV17399.1|1564557_1565478_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.6	1.3e-36
AYV17400.1|1565474_1566428_+	ABC transporter permease	NA	NA	NA	NA	NA
AYV17401.1|1566417_1567254_-	hypothetical protein	NA	NA	NA	NA	NA
AYV17402.1|1567244_1568042_-	hypothetical protein	NA	NA	NA	NA	NA
AYV17403.1|1568010_1568934_-	hypothetical protein	NA	NA	NA	NA	NA
AYV17404.1|1568982_1569162_-	hypothetical protein	NA	NA	NA	NA	NA
AYV17405.1|1569315_1570179_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
AYV17406.1|1570225_1571125_-	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	40.2	2.7e-07
AYV17407.1|1571240_1572218_+	putative sulfate exporter family transporter	NA	NA	NA	NA	NA
AYV17408.1|1572254_1573226_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
AYV17409.1|1573488_1574253_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
AYV17410.1|1574372_1575152_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
AYV17411.1|1575168_1576368_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
AYV17412.1|1576380_1577562_-	MFS transporter	NA	NA	NA	NA	NA
AYV17413.1|1577558_1578977_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
AYV17414.1|1578994_1579756_-	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	6.3e-21
AYV17415.1|1579752_1580463_-	cupin domain-containing protein	NA	NA	NA	NA	NA
AYV17416.1|1580452_1581067_-	bacilysin biosynthesis protein BacA	NA	NA	NA	NA	NA
AYV17417.1|1581228_1582467_-	MFS transporter	NA	NA	NA	NA	NA
AYV17418.1|1582689_1583892_+	Bcr/CflA family efflux MFS transporter	NA	S4TR35	Salmonella_phage	26.1	1.4e-27
AYV17419.1|1583924_1585343_-	amino acid permease	NA	NA	NA	NA	NA
AYV17420.1|1585367_1587050_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
AYV17421.1|1587121_1588669_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
AYV17422.1|1588876_1590163_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
AYV17423.1|1590394_1591330_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	28.9	3.4e-24
AYV17424.1|1591331_1592030_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	35.8	3.2e-35
AYV17425.1|1592221_1593088_-	protein liaG	NA	NA	NA	NA	NA
AYV17426.1|1593108_1593813_-	ABC transporter permease	NA	NA	NA	NA	NA
AYV19676.1|1593877_1594804_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	45.9	1.1e-43
AYV17427.1|1595162_1595618_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYV17428.1|1595614_1596463_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.3	7.0e-37
AYV17429.1|1596483_1597431_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	42.6	2.3e-68
AYV17430.1|1597433_1598171_-	glucose-1-phosphate thymidylyltransferase	NA	G3MA50	Bacillus_virus	42.7	5.0e-47
AYV17431.1|1598198_1599203_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYV17432.1|1599204_1599948_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYV17433.1|1599937_1601059_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYV17434.1|1601058_1601922_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYV17435.1|1601922_1603092_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
AYV17436.1|1603114_1604539_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
AYV17437.1|1604543_1605314_-	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	26.3	4.4e-06
AYV17438.1|1605594_1606191_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
>prophage 5
CP033576	Bacillus velezensis strain NY12-2 chromosome, complete genome	4074913	2579885	2589778	4074913		Synechococcus_phage(50.0%)	9	NA	NA
AYV18284.1|2579885_2581181_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	4.5e-19
AYV18285.1|2581255_2581975_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.5	4.4e-48
AYV18286.1|2581974_2582229_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	34.6	2.1e-05
AYV18287.1|2582225_2582909_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
AYV18288.1|2582892_2585121_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.7	7.2e-158
AYV18289.1|2585096_2586527_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	6.2e-54
AYV18290.1|2586618_2587659_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.1	1.4e-63
AYV18291.1|2587655_2588243_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.8	1.3e-26
AYV18292.1|2588239_2589778_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.5	4.3e-77
>prophage 6
CP033576	Bacillus velezensis strain NY12-2 chromosome, complete genome	4074913	3044655	3078239	4074913	coat,tRNA	Planktothrix_phage(16.67%)	37	NA	NA
AYV18709.1|3044655_3045648_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
AYV18710.1|3046391_3048026_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYV18711.1|3048132_3049068_+	ABC transporter permease	NA	NA	NA	NA	NA
AYV18712.1|3049071_3049989_+	ABC transporter permease	NA	NA	NA	NA	NA
AYV18713.1|3050001_3051078_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	1.7e-16
AYV18714.1|3051070_3051988_+	ATP-binding cassette domain-containing protein	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.5e-05
AYV18715.1|3052094_3053282_+	GTP-binding protein	NA	NA	NA	NA	NA
AYV18716.1|3053399_3053978_+	N-acetyltransferase	NA	NA	NA	NA	NA
AYV18717.1|3054156_3054552_+	transcriptional regulator Spx	NA	NA	NA	NA	NA
AYV18718.1|3054606_3055263_-	TerC family protein	NA	W8EBD0	Pseudomonas_phage	41.9	2.2e-30
AYV18719.1|3055538_3056180_+	adaptor protein MecA	NA	NA	NA	NA	NA
AYV18720.1|3056330_3057491_+	competence protein CoiA	NA	NA	NA	NA	NA
AYV19736.1|3057718_3059548_+	oligoendopeptidase F	NA	NA	NA	NA	NA
AYV18721.1|3060038_3060941_-	DsbA family protein	NA	NA	NA	NA	NA
AYV18722.1|3060937_3061336_-	thiol management oxidoreductase	NA	NA	NA	NA	NA
AYV18723.1|3061564_3062251_-	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	70.3	1.8e-38
AYV18724.1|3062255_3062828_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
AYV18725.1|3062952_3063318_+	hypothetical protein	NA	NA	NA	NA	NA
AYV18726.1|3063345_3063981_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
AYV18727.1|3063998_3064799_+	NAD kinase	NA	NA	NA	NA	NA
AYV18728.1|3064813_3065707_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.3	1.4e-06
AYV18729.1|3065739_3066489_-	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	A0A1V0SJW2	Klosneuvirus	26.8	5.8e-11
AYV18730.1|3066716_3068561_+	sodium:proton antiporter	NA	NA	NA	NA	NA
AYV19737.1|3068810_3069518_+	thiaminase II	NA	NA	NA	NA	NA
AYV19738.1|3069495_3070113_+	thiazole tautomerase TenI	NA	NA	NA	NA	NA
AYV18731.1|3070096_3071206_+	glycine oxidase ThiO	NA	NA	NA	NA	NA
AYV18732.1|3071202_3071406_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
AYV18733.1|3071402_3072173_+	thiazole synthase	NA	NA	NA	NA	NA
AYV18734.1|3072169_3073180_+	thiazole biosynthesis adenylyltransferase ThiF	NA	NA	NA	NA	NA
AYV18735.1|3073202_3074015_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
AYV18736.1|3074145_3074922_+	enoyl-[acyl-carrier-protein] reductase FabI	NA	NA	NA	NA	NA
AYV18737.1|3075019_3075628_+|coat	spore coat protein	coat	NA	NA	NA	NA
AYV18738.1|3075685_3076129_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYV18739.1|3076274_3076757_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYV18740.1|3076907_3077408_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYV18741.1|3077500_3077815_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYV18742.1|3077852_3078239_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 7
CP033576	Bacillus velezensis strain NY12-2 chromosome, complete genome	4074913	3135071	3205206	4074913	tail,capsid,plate,holin,terminase,portal,coat	Bacillus_phage(37.84%)	73	NA	NA
AYV18808.1|3135071_3135254_-|coat	spore coat protein	coat	NA	NA	NA	NA
AYV18809.1|3135367_3135541_-	putative motility protein	NA	NA	NA	NA	NA
AYV18810.1|3135584_3135986_-	DUF2809 domain-containing protein	NA	NA	NA	NA	NA
AYV18811.1|3136084_3136654_-	DUF4309 domain-containing protein	NA	NA	NA	NA	NA
AYV18812.1|3136776_3139734_+	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
AYV18813.1|3139726_3140269_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
AYV18814.1|3140476_3141697_+	cytochrome P450	NA	NA	NA	NA	NA
AYV18815.1|3141693_3142878_+	UDP-glucosyltransferase	NA	Q0IKX4	Leucania_separata_nucleopolyhedrovirus	30.9	2.5e-08
AYV18816.1|3142920_3143106_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	77.6	5.2e-22
AYV18817.1|3143281_3144100_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
AYV18818.1|3144124_3144886_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
AYV18819.1|3144887_3145625_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	34.9	3.7e-18
AYV18820.1|3145651_3146635_-	multidrug resistance efflux transporter family protein	NA	NA	NA	NA	NA
AYV18821.1|3146764_3147262_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AYV18822.1|3147649_3148066_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
AYV18823.1|3148105_3149284_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AYV18824.1|3149469_3150867_+	glucuronate isomerase	NA	NA	NA	NA	NA
AYV18825.1|3152339_3153338_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
AYV18826.1|3153413_3154859_+	tagaturonate reductase	NA	NA	NA	NA	NA
AYV18827.1|3154855_3156349_+	altronate dehydratase	NA	NA	NA	NA	NA
AYV18828.1|3156532_3157204_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	31.1	2.4e-24
AYV18829.1|3157200_3158559_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	25.6	3.5e-14
AYV18830.1|3158678_3159614_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.4	1.8e-41
AYV18831.1|3159594_3160326_+	ABC transporter permease	NA	NA	NA	NA	NA
AYV18832.1|3160343_3160535_+	Mas-related G-protein coupled receptor member D	NA	NA	NA	NA	NA
AYV18833.1|3160600_3161851_+	sensor histidine kinase	NA	NA	NA	NA	NA
AYV18834.1|3161862_3162528_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AYV18835.1|3162720_3162903_+	plantaricin C family lantibiotic	NA	NA	NA	NA	NA
AYV18836.1|3162989_3166172_+	type 2 lantipeptide synthetase LanM	NA	NA	NA	NA	NA
AYV18837.1|3166161_3168309_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.6	2.4e-33
AYV18838.1|3168993_3171879_+	type 2 lantipeptide synthetase LanM	NA	NA	NA	NA	NA
AYV18839.1|3171925_3172690_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
AYV18840.1|3172838_3173306_-	hypothetical protein	NA	NA	NA	NA	NA
AYV18841.1|3173510_3174647_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	47.9	1.3e-94
AYV18842.1|3174913_3175867_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A218KC88	Bacillus_phage	69.3	2.4e-62
AYV18843.1|3175904_3176282_-	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	41.4	2.0e-15
AYV18844.1|3176391_3176997_+	hypothetical protein	NA	A0A0Y0AJU6	Bacillus_phage	48.3	6.1e-43
AYV18845.1|3177119_3177710_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	3.0e-39
AYV18846.1|3177858_3178197_-	XRE family transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	8.4e-18
AYV18847.1|3178387_3178567_+	hypothetical protein	NA	NA	NA	NA	NA
AYV18848.1|3178556_3179384_+|portal	phage portal protein	portal	S6BFM4	Thermus_phage	49.5	2.9e-19
AYV18849.1|3179283_3180084_+	ATP-binding protein	NA	A6XMI1	Bacillus_virus	45.1	1.8e-58
AYV18850.1|3180348_3180690_+|portal	phage portal protein	portal	NA	NA	NA	NA
AYV18851.1|3180679_3180883_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	48.5	5.4e-12
AYV18852.1|3180989_3181502_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	43.9	2.9e-22
AYV18853.1|3181614_3182412_+|terminase	terminase	terminase	A0A0S2MVB6	Bacillus_phage	49.4	3.6e-59
AYV18854.1|3182408_3183707_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	59.8	4.7e-149
AYV19742.1|3183755_3185135_+|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.8	1.8e-138
AYV18855.1|3185166_3186012_+|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	58.1	2.5e-55
AYV18856.1|3186038_3186974_+|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	62.8	3.3e-104
AYV18857.1|3186990_3187374_+	DUF3199 family protein	NA	NA	NA	NA	NA
AYV18858.1|3187370_3187727_+	DUF3599 family protein	NA	NA	NA	NA	NA
AYV18859.1|3187723_3188227_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
AYV19743.1|3188309_3188372_-	hypothetical protein	NA	NA	NA	NA	NA
AYV18860.1|3188666_3188876_+	hypothetical protein	NA	NA	NA	NA	NA
AYV18861.1|3188875_3190273_+|tail	phage tail sheath protein	tail	A0A0A7RTT5	Clostridium_phage	40.4	9.0e-82
AYV18862.1|3190274_3190718_+|portal	phage portal protein	portal	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
AYV18863.1|3190792_3191239_+|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.0e-10
AYV18864.1|3191280_3191433_+	hypothetical protein	NA	NA	NA	NA	NA
AYV18865.1|3191420_3196385_+|portal	phage portal protein	portal	A0A1L2JY60	Aeribacillus_phage	46.6	3.2e-41
AYV18866.1|3196377_3197037_+	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	45.3	1.8e-08
AYV18867.1|3197050_3198028_+|portal	phage portal protein	portal	A0A1L6BY20	Clostridium_phage	30.9	1.3e-34
AYV18868.1|3198027_3198294_+	DUF2577 domain-containing protein	NA	S6C459	Thermus_phage	39.8	1.5e-06
AYV18869.1|3198397_3198823_+	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.9	2.5e-11
AYV18870.1|3198815_3199862_+|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.1	1.0e-69
AYV18871.1|3199845_3200424_+	DUF2313 domain-containing protein	NA	A0A2H4J717	uncultured_Caudovirales_phage	31.0	3.1e-12
AYV18872.1|3200420_3200693_+	hypothetical protein	NA	NA	NA	NA	NA
AYV18873.1|3200695_3202318_+	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	39.7	1.1e-41
AYV18874.1|3202330_3202702_+	hypothetical protein	NA	NA	NA	NA	NA
AYV18875.1|3202706_3202904_+	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	61.8	7.3e-14
AYV18876.1|3203773_3204037_+	protein xhlA	NA	A0A2H4JD40	uncultured_Caudovirales_phage	65.5	2.1e-24
AYV18877.1|3204050_3204314_+|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
AYV18878.1|3204327_3205206_+	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXD7	Bacillus_phage	60.5	3.7e-81
>prophage 8
CP033576	Bacillus velezensis strain NY12-2 chromosome, complete genome	4074913	3766967	3773181	4074913		Bacillus_phage(50.0%)	7	NA	NA
AYV19324.1|3766967_3767360_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	59.1	3.8e-30
AYV19325.1|3767319_3769422_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	86.0	0.0e+00
AYV19326.1|3769439_3770429_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.0	1.1e-155
AYV19327.1|3770477_3771095_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	47.9	2.1e-46
AYV19328.1|3771147_3771906_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.4	1.1e-52
AYV19329.1|3771939_3772164_-	hypothetical protein	NA	NA	NA	NA	NA
AYV19330.1|3772212_3773181_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.9	8.0e-53
>prophage 9
CP033576	Bacillus velezensis strain NY12-2 chromosome, complete genome	4074913	3854740	4000863	4074913	protease,tail,capsid,transposase,tRNA,head,holin,terminase,integrase,portal	Bacillus_phage(64.41%)	109	3980695:3980710	3982666:3982681
AYV19408.1|3854740_3855877_-|holin	choline esterase	holin	NA	NA	NA	NA
AYV19409.1|3856121_3857621_-	endoglucanase	NA	NA	NA	NA	NA
AYV19410.1|3858084_3858396_+	DUF4870 domain-containing protein	NA	A0A2H4J741	uncultured_Caudovirales_phage	41.7	4.5e-10
AYV19411.1|3858447_3859848_-	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	29.5	2.3e-29
AYV19412.1|3859850_3860558_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.5	3.1e-38
AYV19413.1|3860701_3861973_-	glucuronoxylanase	NA	NA	NA	NA	NA
AYV19414.1|3862034_3863570_-	carbohydrate-binding protein	NA	NA	NA	NA	NA
AYV19415.1|3863743_3871603_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	28.0	7.1e-91
AYV19416.1|3871686_3887778_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	28.1	5.9e-92
AYV19417.1|3887822_3899771_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	28.2	3.9e-117
AYV19418.1|3899790_3900993_-	[acyl-carrier-protein] S-malonyltransferase	NA	NA	NA	NA	NA
AYV19419.1|3901552_3902338_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
AYV19420.1|3902350_3903013_-	CoA transferase subunit B	NA	NA	NA	NA	NA
AYV19421.1|3903030_3903732_-	CoA transferase subunit A	NA	NA	NA	NA	NA
AYV19422.1|3903756_3905202_-	GntP family permease	NA	NA	NA	NA	NA
AYV19423.1|3905506_3906703_-	cytochrome P450	NA	NA	NA	NA	NA
AYV19424.1|3906704_3907724_-	biotin synthase BioB	NA	NA	NA	NA	NA
AYV19425.1|3907726_3908428_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
AYV19426.1|3908424_3909585_-	8-amino-7-oxononanoate synthase	NA	D2TEZ5	Emiliania_huxleyi_virus	27.4	7.1e-32
AYV19427.1|3909574_3910921_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	23.4	1.7e-13
AYV19428.1|3910920_3911688_-	6-carboxyhexanoate--CoA ligase	NA	NA	NA	NA	NA
AYV19429.1|3911965_3912373_+	GtrA family protein	NA	NA	NA	NA	NA
AYV19430.1|3912379_3913273_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	56.0	3.1e-83
AYV19431.1|3913347_3913938_+	DedA family protein	NA	NA	NA	NA	NA
AYV19432.1|3913993_3915523_-	acyl-CoA carboxylase subunit beta	NA	NA	NA	NA	NA
AYV19433.1|3915540_3916320_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
AYV19434.1|3916333_3917233_-	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
AYV19435.1|3917248_3917461_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
AYV19436.1|3917457_3918807_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
AYV19437.1|3918828_3920469_-	AMP-binding protein	NA	Q75ZG1	Hepacivirus	26.3	2.7e-45
AYV19438.1|3920513_3921656_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AYV19439.1|3921796_3923335_-	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
AYV19440.1|3923455_3923836_-	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
AYV19441.1|3923909_3927713_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	26.8	9.6e-86
AYV19442.1|3935887_3937363_-	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
AYV19762.1|3937381_3938350_-	aldose 1-epimerase	NA	NA	NA	NA	NA
AYV19443.1|3938464_3939853_-	MATE family efflux transporter	NA	NA	NA	NA	NA
AYV19444.1|3940081_3940624_+	hypothetical protein	NA	NA	NA	NA	NA
AYV19445.1|3940966_3942793_+	hypothetical protein	NA	A0A1P8CWI7	Bacillus_phage	41.1	5.8e-105
AYV19446.1|3942808_3943249_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
AYV19447.1|3943441_3944167_+	hypothetical protein	NA	NA	NA	NA	NA
AYV19448.1|3944206_3945217_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A1J0MS59	Bacillus_phage	96.1	1.0e-183
AYV19449.1|3945265_3945688_-|holin	holin family protein	holin	D6R405	Bacillus_phage	97.0	1.7e-63
AYV19450.1|3945739_3945928_-	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	98.4	8.2e-31
AYV19451.1|3945924_3946287_-	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	91.7	4.9e-56
AYV19452.1|3946283_3947561_-	DUF2479 domain-containing protein	NA	D6R402	Bacillus_phage	85.2	8.9e-153
AYV19453.1|3947577_3950139_-	peptidase G2	NA	D6R401	Bacillus_phage	94.8	0.0e+00
AYV19454.1|3950178_3951882_-	alkaline phosphatase	NA	D6R400	Bacillus_phage	98.9	4.7e-311
AYV19455.1|3951893_3952733_-|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	93.5	1.7e-152
AYV19456.1|3952732_3956608_-|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	97.6	0.0e+00
AYV19457.1|3956808_3957147_-	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	94.6	1.2e-53
AYV19458.1|3957198_3957807_-|tail	phage tail protein	tail	Q9ZXE9	Bacillus_phage	82.2	8.4e-93
AYV19459.1|3957807_3958296_-	DUF3168 domain-containing protein	NA	Q9ZXF0	Bacillus_phage	94.4	1.9e-79
AYV19460.1|3958184_3958568_-	HK97 gp10 family phage protein	NA	Q9ZXF1	Bacillus_phage	96.9	2.7e-65
AYV19461.1|3958560_3958920_-|head,tail	head-tail adaptor protein	head,tail	Q9ZXF2	Bacillus_phage	96.6	8.0e-59
AYV19462.1|3958852_3959200_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	97.4	1.1e-57
AYV19463.1|3959214_3959625_-	collagen-like protein	NA	D6R3Z0	Bacillus_phage	67.4	6.8e-38
AYV19464.1|3959652_3959964_-	hypothetical protein	NA	Q9ZXF5	Bacillus_phage	96.2	2.3e-46
AYV19465.1|3959975_3961169_-|capsid	phage major capsid protein	capsid	Q9ZXF6	Bacillus_phage	99.7	5.5e-221
AYV19466.1|3961208_3961835_-|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	100.0	6.8e-114
AYV19467.1|3961824_3963075_-|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	98.6	3.5e-242
AYV19468.1|3963080_3963311_-	hypothetical protein	NA	Q9ZXF9	Bacillus_phage	80.3	1.5e-21
AYV19469.1|3963322_3965032_-|terminase	terminase large subunit	terminase	D6R3Y4	Bacillus_phage	96.7	0.0e+00
AYV19470.1|3965031_3965538_-|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	95.8	3.1e-85
AYV19471.1|3965624_3965951_-	transglycosylase	NA	Q9T203	Bacillus_phage	97.2	1.1e-54
AYV19472.1|3965919_3966294_-	HNH endonuclease	NA	Q38456	Bacillus_phage	93.5	1.7e-67
AYV19473.1|3966290_3966713_-	hypothetical protein	NA	NA	NA	NA	NA
AYV19474.1|3966712_3966940_-	hypothetical protein	NA	NA	NA	NA	NA
AYV19475.1|3967505_3968048_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	59.4	1.8e-54
AYV19476.1|3968044_3968497_-	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	55.9	3.7e-37
AYV19477.1|3968797_3969232_-	hypothetical protein	NA	A0A2H4J8A0	uncultured_Caudovirales_phage	70.7	4.1e-49
AYV19478.1|3969234_3969480_-	hypothetical protein	NA	A0A217ERB6	Bacillus_phage	46.2	9.4e-11
AYV19479.1|3969476_3969785_-	hypothetical protein	NA	NA	NA	NA	NA
AYV19480.1|3969781_3969970_-	hypothetical protein	NA	NA	NA	NA	NA
AYV19481.1|3969974_3970157_-	hypothetical protein	NA	A0A1P8CWX9	Bacillus_phage	52.2	1.0e-09
AYV19482.1|3970172_3970400_-	hypothetical protein	NA	A0A217EQZ3	Bacillus_phage	63.5	2.0e-23
AYV19483.1|3970396_3970699_-	hypothetical protein	NA	NA	NA	NA	NA
AYV19484.1|3970700_3971378_-	dUTPase	NA	R9TQ23	Paenibacillus_phage	46.7	4.3e-37
AYV19485.1|3971374_3971698_-	hypothetical protein	NA	NA	NA	NA	NA
AYV19486.1|3971807_3972818_-	DNA (cytosine-5-)-methyltransferase	NA	A8YQM6	Lactobacillus_phage	43.2	6.1e-64
AYV19487.1|3972822_3973077_-	hypothetical protein	NA	F8WQ54	Bacillus_phage	40.3	1.9e-06
AYV19488.1|3973073_3973481_-	hypothetical protein	NA	W8CYU3	Bacillus_phage	44.3	7.2e-24
AYV19489.1|3973477_3973858_-	hypothetical protein	NA	NA	NA	NA	NA
AYV19490.1|3973998_3974202_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	55.4	7.5e-14
AYV19491.1|3974449_3974590_-	BH0509 family protein	NA	NA	NA	NA	NA
AYV19492.1|3974698_3975247_-	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	36.5	2.0e-05
AYV19763.1|3975562_3976396_-	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	34.1	7.9e-33
AYV19493.1|3976379_3977252_-	replication protein	NA	V9QKF6	Oenococcus_phage	41.7	2.2e-49
AYV19494.1|3977244_3977463_-	hypothetical protein	NA	NA	NA	NA	NA
AYV19495.1|3977480_3977804_-	DUF771 domain-containing protein	NA	Q9MC19	Lactococcus_phage	39.8	7.8e-13
AYV19496.1|3977805_3978045_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYV19497.1|3978219_3978633_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYV19498.1|3979040_3980141_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYV19499.1|3980383_3981490_+|integrase	site-specific integrase	integrase	Q5YAA6	Bacillus_phage	58.0	1.7e-112
3980695:3980710	attL	TCAAGAGTTTTTAAAT	NA	NA	NA	NA
AYV19500.1|3981763_3982309_-|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	48.6	2.1e-42
AYV19501.1|3982623_3982854_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
3982666:3982681	attR	ATTTAAAAACTCTTGA	NA	NA	NA	NA
AYV19502.1|3983097_3984873_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
AYV19503.1|3984802_3986095_-	MFS transporter	NA	NA	NA	NA	NA
AYV19504.1|3986238_3986541_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AYV19505.1|3986572_3986854_-|tRNA	threonyl-tRNA synthetase	tRNA	NA	NA	NA	NA
AYV19506.1|3986869_3987736_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	29.7	4.2e-05
AYV19507.1|3987854_3988835_+	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
AYV19508.1|3989690_3991172_-	glutamate synthase small subunit	NA	NA	NA	NA	NA
AYV19509.1|3991188_3995748_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
AYV19510.1|3995893_3996796_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYV19511.1|3996856_3997975_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.2	3.1e-69
AYV19512.1|3997999_3998848_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	30.2	1.2e-23
AYV19764.1|3999033_3999402_-	Replication termination protein	NA	A0A0K2CP62	Brevibacillus_phage	41.0	9.2e-18
AYV19513.1|3999712_4000863_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	59.7	1.1e-37
