The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033575	Shewanella algae strain KC-Na-R1 chromosome, complete genome	5036300	936457	961991	5036300	portal,terminase,integrase,tail,protease	Vibrio_phage(29.41%)	27	953458:953472	964665:964679
AYV12357.1|936457_937711_+|integrase	integrase	integrase	A0A2D1GND4	Pseudomonas_phage	33.4	1.3e-47
AYV15653.1|937810_937996_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYV12358.1|937985_938345_+	hypothetical protein	NA	NA	NA	NA	NA
AYV12359.1|938347_939238_+	hypothetical protein	NA	NA	NA	NA	NA
AYV12360.1|939764_940109_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	52.6	5.2e-23
AYV12361.1|940105_940693_+	lysozyme	NA	A0A1S5R1I9	Pseudomonas_phage	55.6	2.7e-40
AYV12362.1|940875_941220_+	hypothetical protein	NA	NA	NA	NA	NA
AYV12363.1|941200_941455_+	hypothetical protein	NA	NA	NA	NA	NA
AYV12364.1|941454_941988_+	DNA packaging protein	NA	O64316	Escherichia_phage	47.2	2.2e-36
AYV12365.1|941962_943936_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	54.5	1.1e-197
AYV12366.1|943932_944139_+	hypothetical protein	NA	K7PMB5	Enterobacterial_phage	55.7	1.0e-10
AYV12367.1|944163_945735_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	49.6	2.2e-129
AYV12368.1|945643_947722_+|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	53.0	2.2e-177
AYV12369.1|947789_948113_+	DUF2190 family protein	NA	NA	NA	NA	NA
AYV12370.1|948105_948480_+	hypothetical protein	NA	NA	NA	NA	NA
AYV12371.1|948479_949043_+	hypothetical protein	NA	NA	NA	NA	NA
AYV12372.1|949051_949477_+	hypothetical protein	NA	NA	NA	NA	NA
AYV12373.1|949473_950193_+	hypothetical protein	NA	A0A1W6JT83	Pseudomonas_phage	30.0	4.9e-15
AYV12374.1|950271_953682_+|tail	phage tail protein	tail	A0A2I7S9D9	Vibrio_phage	41.9	4.8e-36
953458:953472	attL	GCCCAGCAACAGCAG	NA	NA	NA	NA
AYV12375.1|953681_954062_+	hypothetical protein	NA	A0A2I7QS24	Vibrio_phage	49.6	5.3e-29
AYV12376.1|954063_956490_+	hypothetical protein	NA	A0A2I7QRV0	Vibrio_phage	51.2	4.7e-235
AYV12377.1|956533_957526_+	hypothetical protein	NA	A0A088C4T9	Shewanella_sp._phage	31.3	5.5e-33
AYV12378.1|957566_957815_+	hypothetical protein	NA	A0A088C3Y6	Shewanella_sp._phage	42.7	1.3e-07
AYV12379.1|957824_959666_+	hypothetical protein	NA	A0A2I7QS09	Vibrio_phage	41.5	9.9e-121
AYV12380.1|959665_959878_+	hypothetical protein	NA	A0A2I7QRW3	Vibrio_phage	57.4	2.5e-12
AYV12381.1|959862_960930_-	hypothetical protein	NA	NA	NA	NA	NA
AYV12382.1|960926_961991_-|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	58.5	2.9e-117
964665:964679	attR	GCCCAGCAACAGCAG	NA	NA	NA	NA
>prophage 2
CP033575	Shewanella algae strain KC-Na-R1 chromosome, complete genome	5036300	1699917	1724644	5036300	head,tail	Vibrio_phage(27.78%)	28	NA	NA
AYV12971.1|1699917_1700508_+	regulatory protein GemA	NA	R9U1B6	Rhizobium_phage	31.3	2.9e-05
AYV12972.1|1700507_1700969_+	transcriptional regulator	NA	A0A0C4UQZ9	Shigella_phage	37.8	2.0e-14
AYV12973.1|1701129_1701963_+	hypothetical protein	NA	NA	NA	NA	NA
AYV12974.1|1702746_1703094_+	hypothetical protein	NA	NA	NA	NA	NA
AYV12975.1|1703170_1703665_+	lysozyme	NA	H9C148	Vibrio_phage	46.5	1.1e-26
AYV15698.1|1703742_1703979_+	hypothetical protein	NA	NA	NA	NA	NA
AYV12976.1|1703988_1704546_+	hypothetical protein	NA	NA	NA	NA	NA
AYV12977.1|1704548_1704770_+	hypothetical protein	NA	NA	NA	NA	NA
AYV15699.1|1704778_1705102_+	DUF2730 family protein	NA	NA	NA	NA	NA
AYV12978.1|1705092_1705389_+	ArsR family transcriptional regulator	NA	A0A2I7S9D8	Vibrio_phage	59.4	4.5e-23
AYV12979.1|1705391_1705955_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	58.9	3.1e-49
AYV12980.1|1705951_1707562_+	hypothetical protein	NA	A0A2I7S9C5	Vibrio_phage	61.6	2.3e-161
AYV12981.1|1707561_1709130_+	DUF935 domain-containing protein	NA	J9SVY0	Pseudomonas_phage	47.6	2.5e-120
AYV12982.1|1709129_1710620_+	F protein	NA	A0A2H4IYU7	uncultured_Caudovirales_phage	49.8	1.2e-60
AYV12983.1|1710635_1710842_+	hypothetical protein	NA	NA	NA	NA	NA
AYV12984.1|1710841_1711303_+	phage virion morphogenesis protein	NA	A0A1B0T6E8	Thiobacimonas_phage	36.4	3.3e-17
AYV15700.1|1711816_1712245_-	ImmA/IrrE family metallo-endopeptidase	NA	L7THB5	Pseudomonas_virus	35.3	1.4e-17
AYV12985.1|1712280_1712640_-	XRE family transcriptional regulator	NA	L7TKV7	Pseudomonas_virus	50.8	4.6e-22
AYV12986.1|1712832_1713987_+	hypothetical protein	NA	C9DGP0	Escherichia_phage	38.9	5.0e-54
AYV12987.1|1713992_1714913_+|head	head protein	head	A0A0C4UQR9	Shigella_phage	49.5	8.6e-81
AYV12988.1|1714972_1715401_+	hypothetical protein	NA	C9DGP3	Escherichia_phage	35.4	6.3e-10
AYV12989.1|1715400_1715826_+	DUF1320 domain-containing protein	NA	C9DGP4	Escherichia_phage	39.7	1.5e-16
AYV12990.1|1715825_1716263_+	hypothetical protein	NA	NA	NA	NA	NA
AYV12991.1|1716275_1717022_+	hypothetical protein	NA	NA	NA	NA	NA
AYV12992.1|1717106_1720811_+|tail	phage tail tape measure protein	tail	A0A2I7S9D9	Vibrio_phage	48.6	1.8e-52
AYV12993.1|1720807_1721173_+	hypothetical protein	NA	NA	NA	NA	NA
AYV12994.1|1721197_1723639_+	hypothetical protein	NA	A0A2I7S8M8	Vibrio_phage	61.8	1.5e-286
AYV12995.1|1723651_1724644_+	hypothetical protein	NA	A0A088C4T9	Shewanella_sp._phage	30.7	2.7e-32
>prophage 3
CP033575	Shewanella algae strain KC-Na-R1 chromosome, complete genome	5036300	1782836	1790154	5036300		Staphylococcus_phage(50.0%)	7	NA	NA
AYV13050.1|1782836_1784504_-	energy-dependent translational throttle protein EttA	NA	A0A1B0RXA0	Streptococcus_phage	28.1	3.0e-39
AYV13051.1|1784732_1785986_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.1	3.2e-102
AYV13052.1|1786095_1786548_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AYV13053.1|1786588_1787713_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	2.8e-49
AYV13054.1|1787713_1788370_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	33.7	6.6e-27
AYV13055.1|1788451_1789558_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	37.8	3.0e-64
AYV13056.1|1789677_1790154_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.3	1.1e-31
>prophage 4
CP033575	Shewanella algae strain KC-Na-R1 chromosome, complete genome	5036300	3046937	3099170	5036300	tRNA,transposase,protease	Catovirus(11.11%)	46	NA	NA
AYV14020.1|3046937_3048968_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	21.2	1.6e-18
AYV14021.1|3049036_3049789_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
AYV15795.1|3050026_3050380_+	hypothetical protein	NA	NA	NA	NA	NA
AYV14022.1|3050456_3050936_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
AYV14023.1|3050989_3051700_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AYV14024.1|3051689_3052400_+	arginyltransferase	NA	NA	NA	NA	NA
AYV14025.1|3052480_3052699_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
AYV14026.1|3052890_3055149_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.0	1.3e-167
AYV14027.1|3055183_3055492_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	41.3	3.3e-13
AYV14028.1|3055888_3056095_+	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.7	1.3e-16
AYV14029.1|3056194_3058420_-	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
AYV14030.1|3058744_3059587_+	pseudouridine synthase	NA	NA	NA	NA	NA
AYV14031.1|3059579_3060032_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AYV14032.1|3060199_3061315_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
AYV14033.1|3061318_3061936_+	lysogenization regulator HflD	NA	NA	NA	NA	NA
AYV14034.1|3061964_3063335_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.7	4.5e-110
AYV14035.1|3063458_3064601_+	cupin domain-containing protein	NA	NA	NA	NA	NA
AYV14036.1|3064729_3065164_-	DUF4826 family protein	NA	NA	NA	NA	NA
AYV14037.1|3065464_3066499_+	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
AYV14038.1|3066675_3067011_+	hypothetical protein	NA	NA	NA	NA	NA
AYV14039.1|3067039_3067462_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
AYV14040.1|3067910_3068360_-	DUF1285 domain-containing protein	NA	NA	NA	NA	NA
AYV14041.1|3068428_3071473_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
AYV14042.1|3071570_3073940_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.2	5.3e-175
AYV14043.1|3074064_3074877_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
AYV14044.1|3075119_3076184_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B5IW14	Pandoravirus	46.8	1.1e-84
AYV14045.1|3076380_3076812_+	acyl-CoA thioesterase	NA	A0A292GK23	Xanthomonas_phage	39.4	2.6e-08
AYV14046.1|3077048_3077714_+	DNA-binding response regulator	NA	NA	NA	NA	NA
AYV14047.1|3077737_3078199_-	hypothetical protein	NA	NA	NA	NA	NA
AYV14048.1|3078362_3079199_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
AYV14049.1|3079209_3080334_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.9	7.4e-34
AYV14050.1|3080466_3081360_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYV14051.1|3081549_3082086_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
AYV14052.1|3082201_3082987_-	hypothetical protein	NA	NA	NA	NA	NA
AYV14053.1|3083001_3083481_-	hypothetical protein	NA	NA	NA	NA	NA
AYV14054.1|3083568_3084144_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
AYV14055.1|3085463_3086195_+|transposase	transposase	transposase	NA	NA	NA	NA
AYV14056.1|3086259_3087234_+|transposase	transposase	transposase	NA	NA	NA	NA
AYV14057.1|3087746_3088478_+	hypothetical protein	NA	NA	NA	NA	NA
AYV14058.1|3088544_3089726_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
AYV14059.1|3090080_3090362_+	hypothetical protein	NA	NA	NA	NA	NA
AYV14060.1|3090362_3090935_-	hypothetical protein	NA	NA	NA	NA	NA
AYV14061.1|3091390_3092380_-|transposase	transposase	transposase	NA	NA	NA	NA
AYV14062.1|3092642_3094715_-	hypothetical protein	NA	NA	NA	NA	NA
AYV14063.1|3094855_3095413_-	hypothetical protein	NA	NA	NA	NA	NA
AYV14064.1|3095945_3099170_-|protease	protease	protease	NA	NA	NA	NA
>prophage 5
CP033575	Shewanella algae strain KC-Na-R1 chromosome, complete genome	5036300	3406283	3441701	5036300	head,tail	Vibrio_phage(28.0%)	44	NA	NA
AYV14320.1|3406283_3411170_-	hypothetical protein	NA	Q7Y3Z3	Yersinia_phage	32.0	4.0e-76
AYV14321.1|3411169_3411553_-	hypothetical protein	NA	A0A2L0V149	Salmonella_phage	33.9	6.6e-11
AYV14322.1|3411561_3412197_-	hypothetical protein	NA	A0A2I6PFX9	Plesiomonas_phage	28.7	2.5e-15
AYV14323.1|3412193_3412784_-	hypothetical protein	NA	NA	NA	NA	NA
AYV14324.1|3412877_3413381_-	hypothetical protein	NA	NA	NA	NA	NA
AYV14325.1|3413750_3416648_-|tail	phage tail protein	tail	A4JX10	Burkholderia_virus	22.0	7.5e-06
AYV14326.1|3416864_3417194_-	hypothetical protein	NA	NA	NA	NA	NA
AYV14327.1|3417202_3417541_-	hypothetical protein	NA	NA	NA	NA	NA
AYV14328.1|3417573_3418479_-	hypothetical protein	NA	A0A1B0T6E1	Thiobacimonas_phage	34.6	1.7e-33
AYV14329.1|3418502_3418925_-	hypothetical protein	NA	NA	NA	NA	NA
AYV14330.1|3418924_3419350_-	DUF1320 domain-containing protein	NA	B7SDP4	Haemophilus_phage	38.6	1.1e-14
AYV14331.1|3419349_3419826_-	termination factor Rho	NA	NA	NA	NA	NA
AYV14332.1|3419936_3420830_-	hypothetical protein	NA	A0A0A1IWZ9	Pseudomonas_phage	53.0	3.2e-80
AYV14333.1|3420882_3421281_-	hypothetical protein	NA	A0A0U5KRP3	unidentified_phage	49.2	4.6e-23
AYV14334.1|3421350_3422541_-	phage scaffold protein	NA	A0A0M5N0Q6	Ralstonia_phage	37.9	6.8e-46
AYV14335.1|3422581_3423715_-	hypothetical protein	NA	NA	NA	NA	NA
AYV14336.1|3423888_3424368_-	phage virion morphogenesis protein	NA	A0A1B0T6E8	Thiobacimonas_phage	31.6	2.2e-11
AYV14337.1|3424529_3425768_-|head	head morphogenesis protein	head	A0A2H4IYU7	uncultured_Caudovirales_phage	37.3	7.3e-59
AYV14338.1|3425770_3427399_-	DUF935 domain-containing protein	NA	J9SVY0	Pseudomonas_phage	51.1	2.5e-131
AYV15810.1|3427398_3428907_-	hypothetical protein	NA	M1NVQ0	Vibrio_phage	61.8	2.3e-163
AYV14339.1|3429029_3429599_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.1	4.5e-48
AYV14340.1|3429588_3429861_-	hypothetical protein	NA	NA	NA	NA	NA
AYV14341.1|3429862_3430159_-	ArsR family transcriptional regulator	NA	A0A2I7S9D8	Vibrio_phage	55.2	2.9e-22
AYV14342.1|3430159_3430495_-	DUF2730 family protein	NA	NA	NA	NA	NA
AYV14343.1|3430484_3430718_-	hypothetical protein	NA	NA	NA	NA	NA
AYV14344.1|3430838_3431390_-	hypothetical protein	NA	NA	NA	NA	NA
AYV14345.1|3431377_3431938_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	41.6	2.5e-22
AYV15811.1|3431930_3432248_-	hypothetical protein	NA	NA	NA	NA	NA
AYV14346.1|3432329_3432920_-	hypothetical protein	NA	NA	NA	NA	NA
AYV14347.1|3433039_3433477_-	transcriptional regulator	NA	A0A0C4UQZ9	Shigella_phage	39.0	2.1e-13
AYV14348.1|3433479_3433995_-	hypothetical protein	NA	A0A2P9JZH6	Alteromonadaceae_phage	54.1	5.2e-27
AYV14349.1|3433991_3434591_-	regulatory protein GemA	NA	A0A219VHC6	Ochrobactrum_phage	40.8	2.0e-14
AYV14350.1|3434587_3434788_-	hypothetical protein	NA	NA	NA	NA	NA
AYV14351.1|3434868_3435093_-	hypothetical protein	NA	NA	NA	NA	NA
AYV14352.1|3435092_3435332_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
AYV14353.1|3435368_3435986_-	DUF3164 family protein	NA	M4MHH7	Vibrio_phage	71.9	3.6e-75
AYV14354.1|3436004_3436283_-	hypothetical protein	NA	NA	NA	NA	NA
AYV14355.1|3436288_3436504_-	hypothetical protein	NA	NA	NA	NA	NA
AYV14356.1|3436500_3437448_-	DNA transposition protein	NA	M4M9P4	Vibrio_phage	56.9	1.3e-92
AYV14357.1|3437460_3439464_-	DDE endonuclease	NA	M4M9R2	Vibrio_phage	53.8	4.7e-201
AYV14358.1|3439456_3439942_-	hypothetical protein	NA	A4JWN5	Burkholderia_virus	54.2	3.9e-48
AYV14359.1|3440052_3440505_+	hypothetical protein	NA	NA	NA	NA	NA
AYV14360.1|3440514_3440790_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	56.7	4.1e-15
AYV14361.1|3440987_3441701_+	phage repressor protein	NA	A0A2I7S9A5	Vibrio_phage	46.1	2.1e-55
>prophage 6
CP033575	Shewanella algae strain KC-Na-R1 chromosome, complete genome	5036300	3463903	3474007	5036300		Acinetobacter_phage(14.29%)	10	NA	NA
AYV14380.1|3463903_3466573_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	29.7	2.7e-82
AYV14381.1|3466961_3467393_-	nucleoside-diphosphate kinase	NA	L7Y4C4	Megavirus	40.2	4.8e-18
AYV14382.1|3467792_3467990_-	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AYV14383.1|3468082_3468982_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	33.3	3.2e-40
AYV14384.1|3469200_3469536_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AYV14385.1|3469544_3471407_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	40.2	1.3e-104
AYV14386.1|3471490_3472015_-	co-chaperone HscB	NA	NA	NA	NA	NA
AYV14387.1|3472038_3472362_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	43.0	1.2e-21
AYV14388.1|3472376_3472760_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.4	5.4e-53
AYV14389.1|3472792_3474007_-	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	32.6	2.3e-33
>prophage 1
CP033574	Shewanella algae strain KC-Na-R1 plasmid pKC-Na-R1, complete sequence	167144	0	9426	167144		Aurantimonas_phage(33.33%)	9	NA	NA
AYV11392.1|622_1321_+	hypothetical protein	NA	NA	NA	NA	NA
AYV11393.1|1335_2259_+	hypothetical protein	NA	NA	NA	NA	NA
AYV11394.1|2260_3196_+	hypothetical protein	NA	NA	NA	NA	NA
AYV11395.1|3269_4364_+	hypothetical protein	NA	A0A0A8IL17	Aurantimonas_phage	26.3	6.3e-14
AYV11396.1|4519_4906_-	hypothetical protein	NA	NA	NA	NA	NA
AYV11397.1|4942_5860_-	hypothetical protein	NA	NA	NA	NA	NA
AYV11398.1|5873_6689_-	hypothetical protein	NA	A0A222YXS3	Escherichia_phage	29.1	2.7e-14
AYV11399.1|7083_7311_+	hypothetical protein	NA	NA	NA	NA	NA
AYV11400.1|7722_9426_+	PRTRC system ParB family protein	NA	S5VSZ7	Leptospira_phage	32.4	4.4e-06
>prophage 2
CP033574	Shewanella algae strain KC-Na-R1 plasmid pKC-Na-R1, complete sequence	167144	15408	20418	167144		Klebsiella_phage(100.0%)	1	NA	NA
AYV11409.1|15408_20418_+	hypothetical protein	NA	A0A248SL14	Klebsiella_phage	31.9	1.4e-214
>prophage 3
CP033574	Shewanella algae strain KC-Na-R1 plasmid pKC-Na-R1, complete sequence	167144	62539	83319	167144	integrase,transposase	Salmonella_phage(22.22%)	26	76292:76351	90308:90459
AYV11452.1|62539_65506_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	98.9	0.0e+00
AYV11563.1|65509_66070_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	97.6	2.8e-58
AYV11453.1|66180_66462_-|transposase	transposase	transposase	NA	NA	NA	NA
AYV11454.1|66430_67444_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYV11455.1|67616_68069_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
AYV11456.1|68201_68675_+	trimethoprim-resistant dihydrofolate reductase DfrA27	NA	G3MBI7	Bacillus_virus	29.1	1.4e-15
AYV11457.1|68855_69701_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA16	NA	NA	NA	NA	NA
AYV11458.1|69817_70165_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AYV11459.1|70158_70998_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AYV11460.1|70927_71107_-	hypothetical protein	NA	NA	NA	NA	NA
AYV11461.1|71125_71626_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYV11564.1|71801_72584_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
AYV11462.1|72573_74097_-|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	9.4e-16
AYV11463.1|74167_74620_-	ATP-binding protein	NA	NA	NA	NA	NA
AYV11464.1|74622_76338_-|transposase	transposase	transposase	NA	NA	NA	NA
AYV11565.1|76269_76464_+	resolvase	NA	NA	NA	NA	NA
76292:76351	attL	TCCGTCGCCATGCTCACCTCGCTTTGGTGCACACGAGTATTGAGCATAGTCGAGATTGGT	NA	NA	NA	NA
AYV11465.1|76483_77473_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AYV11466.1|77469_77706_-	mercury resistance protein	NA	NA	NA	NA	NA
AYV11467.1|77702_78068_-	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
AYV11468.1|78179_78818_-	organomercurial lyase MerB	NA	NA	NA	NA	NA
AYV11469.1|78832_80518_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.9	1.1e-38
AYV11470.1|80589_80865_-	mercuric transporter periplasmic component	NA	NA	NA	NA	NA
AYV11471.1|80880_81231_-	mercuric transporter	NA	NA	NA	NA	NA
AYV11472.1|81302_81737_+	mercuric resistance operon regulatory protein	NA	NA	NA	NA	NA
AYV11473.1|81764_82139_-	DUF2913 family protein	NA	NA	NA	NA	NA
AYV11474.1|82212_83319_-|integrase	integrase	integrase	A0A2I7R1N2	Vibrio_phage	29.1	1.0e-24
90308:90459	attR	ACCAATCTCGACTATGCTCAATACTCGTGTGCACCAAAGCGAGGTGAGCATGGCGACGGAGGCTCTGTTGCAAAGATTGGCGGCAGTCAGAGGTAGGCTGTCGCTCTGCGCCGATCAGGCGGCTGCTGCGAAATGGTGGTTGAGCATGCCCA	NA	NA	NA	NA
>prophage 4
CP033574	Shewanella algae strain KC-Na-R1 plasmid pKC-Na-R1, complete sequence	167144	87498	93160	167144	transposase	uncultured_Caudovirales_phage(50.0%)	7	NA	NA
AYV11480.1|87498_88350_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	62.9	1.5e-95
AYV11481.1|88364_89852_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	87.9	1.9e-239
AYV11482.1|90421_91186_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
AYV11483.1|91273_91387_+	NTP-binding protein	NA	NA	NA	NA	NA
AYV11484.1|91692_92193_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYV11485.1|92211_92391_+	hypothetical protein	NA	NA	NA	NA	NA
AYV11486.1|92320_93160_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
>prophage 5
CP033574	Shewanella algae strain KC-Na-R1 plasmid pKC-Na-R1, complete sequence	167144	96560	110324	167144	integrase,transposase	Salmonella_phage(50.0%)	13	99557:99570	109939:109952
AYV11489.1|96560_97400_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
AYV11490.1|97393_97741_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
AYV11491.1|97939_99163_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	33.0	4.4e-32
99557:99570	attL	TCATTTTGGATTGG	NA	NA	NA	NA
AYV11566.1|99742_100534_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AYV11492.1|100550_101351_-	oxacillin-hydrolyzing class D beta-lactamase OXA-10	NA	NA	NA	NA	NA
AYV11493.1|101615_102875_-	chloramphenicol efflux MFS transporter CmlA5	NA	S4TR35	Salmonella_phage	31.7	1.7e-26
AYV11494.1|103195_103648_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-2	NA	NA	NA	NA	NA
AYV11495.1|103732_104266_-	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
AYV11496.1|104410_105310_-	class A extended-spectrum beta-lactamase VEB-1	NA	NA	NA	NA	NA
AYV11497.1|105481_106495_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYV11498.1|106463_106754_+|transposase	transposase	transposase	NA	NA	NA	NA
AYV11499.1|106791_107349_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
AYV11500.1|107351_110324_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.0	0.0e+00
109939:109952	attR	TCATTTTGGATTGG	NA	NA	NA	NA
>prophage 6
CP033574	Shewanella algae strain KC-Na-R1 plasmid pKC-Na-R1, complete sequence	167144	117532	119472	167144		Pseudomonas_phage(100.0%)	2	NA	NA
AYV11510.1|117532_117736_-	hypothetical protein	NA	G9IAA2	Pseudomonas_phage	56.4	3.6e-08
AYV11511.1|118359_119472_-	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	25.7	3.0e-11
>prophage 7
CP033574	Shewanella algae strain KC-Na-R1 plasmid pKC-Na-R1, complete sequence	167144	123561	124629	167144		Sinorhizobium_phage(100.0%)	1	NA	NA
AYV11515.1|123561_124629_-	AAA family ATPase	NA	A0A1Y0SVK5	Sinorhizobium_phage	31.2	3.9e-08
>prophage 8
CP033574	Shewanella algae strain KC-Na-R1 plasmid pKC-Na-R1, complete sequence	167144	127668	128703	167144		Wolbachia_phage(100.0%)	1	NA	NA
AYV11519.1|127668_128703_+	patatin	NA	A0A1B2LRS3	Wolbachia_phage	28.7	9.5e-20
>prophage 9
CP033574	Shewanella algae strain KC-Na-R1 plasmid pKC-Na-R1, complete sequence	167144	132851	137747	167144		Salmonella_phage(33.33%)	11	NA	NA
AYV11523.1|132851_134123_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	39.6	5.0e-79
AYV11524.1|134134_134536_-	S24 family peptidase	NA	A0A1W6JNS2	Morganella_phage	38.5	1.3e-17
AYV11525.1|134748_134958_-	hypothetical protein	NA	NA	NA	NA	NA
AYV11526.1|134974_135250_-	hypothetical protein	NA	NA	NA	NA	NA
AYV11527.1|135266_135713_-	hypothetical protein	NA	NA	NA	NA	NA
AYV11528.1|135716_136013_-	hypothetical protein	NA	NA	NA	NA	NA
AYV11529.1|136033_136294_-	hypothetical protein	NA	NA	NA	NA	NA
AYV11530.1|136278_136509_-	hypothetical protein	NA	NA	NA	NA	NA
AYV11531.1|136533_136872_-	hypothetical protein	NA	NA	NA	NA	NA
AYV11532.1|136922_137480_-	hypothetical protein	NA	NA	NA	NA	NA
AYV11533.1|137498_137747_-	DUF3850 domain-containing protein	NA	A0A059T7N3	Listeria_phage	39.7	1.2e-05
>prophage 10
CP033574	Shewanella algae strain KC-Na-R1 plasmid pKC-Na-R1, complete sequence	167144	143402	145280	167144		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
AYV11546.1|143402_145280_-	ATP-dependent helicase	NA	E3T5J8	Cafeteria_roenbergensis_virus	26.4	3.8e-27
>prophage 11
CP033574	Shewanella algae strain KC-Na-R1 plasmid pKC-Na-R1, complete sequence	167144	163697	164159	167144		Bacillus_phage(100.0%)	1	NA	NA
AYV11558.1|163697_164159_-	hypothetical protein	NA	A7KV06	Bacillus_phage	30.2	9.1e-07
