The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP033510	Shigella flexneri strain 2016AM-0877 chromosome, complete genome	4719160	65015	94008	4719160	transposase	Shigella_phage(50.0%)	27	NA	NA
AYV03283.1|65015_65381_+|transposase	transposase	transposase	NA	NA	NA	NA
AYV03284.1|65380_66568_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AYV03285.1|66838_67504_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
AYV03286.1|67701_68739_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
AYV03287.1|68868_70142_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	6.8e-177
AYV07072.1|70255_70774_+	L-methionine sulfoximine/L-methionine sulfone acetyltransferase	NA	NA	NA	NA	NA
AYV03288.1|70770_71220_+	DMT family transporter	NA	NA	NA	NA	NA
AYV03289.1|71220_71454_-	DUF2526 domain-containing protein	NA	NA	NA	NA	NA
AYV07073.1|71539_71713_-	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
AYV03290.1|71907_72003_+	stress response membrane protein YncL	NA	NA	NA	NA	NA
AYV03291.1|72404_73214_-	antibiotic acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.0	5.9e-17
AYV03292.1|73423_74848_-	aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
AYV03293.1|74869_75664_-	ABC transporter permease	NA	NA	NA	NA	NA
AYV03294.1|76366_76552_+	hypothetical protein	NA	NA	NA	NA	NA
AYV03295.1|76502_77690_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AYV03296.1|79290_79947_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
AYV03297.1|80249_80843_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
AYV03298.1|80839_81832_-	TDT family transporter	NA	NA	NA	NA	NA
AYV03299.1|81955_82936_+	hypothetical protein	NA	NA	NA	NA	NA
AYV03300.1|82930_83467_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
AYV03301.1|83529_83754_-	DUF465 domain-containing protein	NA	NA	NA	NA	NA
AYV03302.1|83893_85549_-	glucan biosynthesis protein D	NA	NA	NA	NA	NA
AYV03303.1|85773_87117_-	VOC family protein	NA	NA	NA	NA	NA
AYV07074.1|87333_88257_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYV03304.1|88294_89935_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
AYV03305.1|91556_92785_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.9e-177
AYV03306.1|92851_94008_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.4e-67
>prophage 2
CP033510	Shigella flexneri strain 2016AM-0877 chromosome, complete genome	4719160	99496	146315	4719160	transposase,tRNA	Acinetobacter_phage(22.22%)	29	NA	NA
AYV03311.1|99496_100664_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
AYV03312.1|101595_105498_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
AYV03313.1|105698_106304_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
AYV03314.1|107066_108222_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	3.0e-67
AYV03315.1|109095_110252_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	2.0e-66
AYV03316.1|110308_111949_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
AYV03317.1|111964_112849_-	hypothetical protein	NA	NA	NA	NA	NA
AYV03318.1|112859_113465_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
AYV03319.1|116998_117988_-	2-hydroxyacid dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	3.3e-70
AYV03320.1|118195_120835_+	YdbH family protein	NA	NA	NA	NA	NA
AYV03321.1|120831_121017_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
AYV03322.1|121024_121351_+	DUF1318 domain-containing protein	NA	NA	NA	NA	NA
AYV03323.1|122632_122899_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
AYV03324.1|123172_126697_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
AYV03325.1|128333_128768_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
AYV03326.1|128943_129879_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	3.2e-144
AYV03327.1|130007_131375_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.2e-51
AYV03328.1|131852_132836_-	zinc transporter ZntB	NA	NA	NA	NA	NA
AYV07075.1|135160_136624_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
AYV03329.1|136623_137076_-	HlyD family secretion protein	NA	NA	NA	NA	NA
AYV03330.1|137131_137320_+	hypothetical protein	NA	NA	NA	NA	NA
AYV03331.1|137329_138527_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AYV03332.1|138691_139339_-	HlyD family secretion protein	NA	NA	NA	NA	NA
AYV03333.1|139435_140251_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYV03334.1|140794_141310_+	methylated-DNA--protein-cysteine methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
AYV03335.1|141504_142257_+	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
AYV03336.1|142408_143359_+	universal stress protein E	NA	NA	NA	NA	NA
AYV03337.1|144762_145128_+|transposase	transposase	transposase	NA	NA	NA	NA
AYV03338.1|145127_146315_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 3
CP033510	Shigella flexneri strain 2016AM-0877 chromosome, complete genome	4719160	180222	229576	4719160	transposase,tail,tRNA	Enterobacteria_phage(50.0%)	49	NA	NA
AYV03366.1|180222_181995_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
AYV03367.1|182304_182559_+	isochorismatase family protein	NA	NA	NA	NA	NA
AYV03368.1|182750_183947_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AYV03369.1|184675_184924_+	DinI family protein	NA	K7PLW4	Enterobacteria_phage	98.8	4.1e-38
AYV03370.1|185522_187274_+	invasion plasmid antigen	NA	NA	NA	NA	NA
AYV03371.1|187274_187454_-	hypothetical protein	NA	NA	NA	NA	NA
AYV03372.1|187453_188077_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	75.9	5.1e-77
AYV03373.1|189502_190102_-	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	93.0	1.8e-103
AYV03374.1|190169_193649_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	87.3	0.0e+00
AYV03375.1|193709_194312_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	8.1e-88
AYV03376.1|194248_194992_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.8e-145
AYV03377.1|194996_195695_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	89.7	8.4e-121
AYV03378.1|195694_196024_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	97.2	2.4e-57
AYV03379.1|196023_199065_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	86.5	0.0e+00
AYV03380.1|199036_199366_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	99.1	1.3e-55
AYV03381.1|199374_199761_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	92.2	1.4e-61
AYV03382.1|199819_200560_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	96.7	1.5e-128
AYV03383.1|200570_200972_-|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	97.7	1.6e-71
AYV03384.1|200968_201559_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	77.7	4.8e-77
AYV03385.1|201545_201917_-|tail	phage tail protein	tail	NA	NA	NA	NA
AYV03386.1|201928_202330_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	66.2	3.3e-37
AYV03387.1|202593_203790_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AYV03388.1|204975_205665_-	antiterminator	NA	I6PDF8	Cronobacter_phage	49.4	2.9e-57
AYV03389.1|205661_206021_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.1	8.3e-40
AYV03390.1|206020_206242_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	97.8	1.3e-16
AYV03391.1|207693_207882_+	hypothetical protein	NA	NA	NA	NA	NA
AYV03392.1|207878_208706_+	SPFH/Band 7/PHB domain protein	NA	Q8W654	Enterobacteria_phage	94.5	2.3e-125
AYV03393.1|208749_209499_+	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	96.0	1.7e-135
AYV03394.1|209495_210065_+	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	39.4	6.8e-28
AYV03395.1|210188_210431_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	85.0	6.2e-31
AYV03396.1|210434_210581_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	95.8	1.4e-22
AYV03397.1|210589_210787_+	excisionase	NA	Q8W657	Enterobacteria_phage	98.2	3.7e-26
AYV03398.1|210761_211930_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
AYV03399.1|212159_212510_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
AYV03400.1|212562_212958_+	hypothetical protein	NA	NA	NA	NA	NA
AYV03401.1|212998_213742_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
AYV03402.1|213738_214710_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
AYV03403.1|214874_217304_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	NA	NA	NA	NA
AYV03404.1|217328_218429_-	cytochrome C	NA	NA	NA	NA	NA
AYV03405.1|218816_219563_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
AYV03406.1|219576_220143_-	VOC family protein	NA	NA	NA	NA	NA
AYV03407.1|220358_222092_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	6.8e-87
AYV03408.1|222268_222757_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
AYV03409.1|224223_224562_-	flagellar protein FlhE	NA	NA	NA	NA	NA
AYV03410.1|224561_225944_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
AYV03411.1|225940_226540_-	hypothetical protein	NA	NA	NA	NA	NA
AYV03412.1|226585_227779_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
AYV03413.1|228014_228473_+	HD domain-containing protein	NA	NA	NA	NA	NA
AYV03414.1|228407_229576_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
>prophage 4
CP033510	Shigella flexneri strain 2016AM-0877 chromosome, complete genome	4719160	299891	357105	4719160	transposase,holin,tail,integrase	Stx2-converting_phage(28.0%)	50	317925:317984	356210:357807
AYV03481.1|299891_301039_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.2	1.5e-146
AYV03482.1|301877_303106_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.7	9.8e-173
AYV03483.1|304749_305601_+	protein deglycase HchA	NA	NA	NA	NA	NA
AYV03484.1|305708_307067_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
AYV07081.1|307066_307738_-	DNA-binding response regulator HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
AYV03485.1|307870_308284_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
AYV03486.1|309397_310033_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
AYV03487.1|310290_310941_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
AYV03488.1|311866_312046_-	hypothetical protein	NA	NA	NA	NA	NA
AYV03489.1|312018_312288_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.7	1.2e-19
AYV03490.1|312344_313013_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYV03491.1|313328_314972_+	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
AYV03492.1|314972_315152_-	hypothetical protein	NA	NA	NA	NA	NA
AYV03493.1|315151_315679_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	81.0	1.3e-68
AYV03494.1|317692_317908_+|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
317925:317984	attL	GTAAGCGCCCCATCAGCGACGTCTTGTGAAAATTGTCCTGTCTGGCAACAATCGCGCCCA	NA	NA	NA	NA
AYV03495.1|318006_318681_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.0e-10
AYV03496.1|318677_319028_+|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	67.5	1.8e-26
AYV03497.1|320706_321390_-	antiterminator	NA	I6PDF8	Cronobacter_phage	49.8	2.0e-58
AYV03498.1|321386_321752_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.1	7.1e-39
AYV03499.1|321752_322811_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	2.6e-89
AYV03500.1|322812_323091_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.0	4.5e-09
AYV07082.1|323031_323217_+	hypothetical protein	NA	NA	NA	NA	NA
AYV03501.1|323258_323471_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	6.6e-29
AYV03502.1|323673_323853_-	hypothetical protein	NA	NA	NA	NA	NA
AYV07083.1|324065_324482_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	72.0	1.5e-24
AYV03503.1|324648_325674_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.0e-102
AYV07084.1|325909_326707_+	protein MtfA	NA	NA	NA	NA	NA
AYV03504.1|328413_329582_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.7	8.9e-184
AYV03505.1|329667_330823_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
AYV03506.1|331175_332630_+	AMP nucleosidase	NA	NA	NA	NA	NA
AYV03507.1|332972_333689_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AYV03508.1|336065_337016_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
AYV03509.1|337117_338035_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
AYV03510.1|338493_339429_-	L,D-transpeptidase	NA	NA	NA	NA	NA
AYV03511.1|339490_340570_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
AYV03512.1|340581_341325_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
AYV03513.1|341321_341831_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
AYV03514.1|341842_342999_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
AYV03515.1|343014_343236_+	hypothetical protein	NA	NA	NA	NA	NA
AYV03516.1|345028_345211_+	ethanolamine utilization protein	NA	NA	NA	NA	NA
AYV03517.1|345311_345641_-	DUF496 family protein	NA	NA	NA	NA	NA
AYV03518.1|345812_346112_-	hypothetical protein	NA	NA	NA	NA	NA
AYV03519.1|346181_346856_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.0e-10
AYV03520.1|348508_350110_+|transposase	IS66-like element ISSfl3 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	61.3	3.2e-147
AYV03521.1|351424_352581_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.5e-66
AYV03522.1|352945_354219_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	3.0e-177
AYV03523.1|355165_355516_-|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	67.5	1.8e-26
AYV03524.1|355512_356187_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.0e-10
AYV03525.1|356192_356297_+	general secretion pathway protein GspL	NA	NA	NA	NA	NA
AYV03526.1|356265_357105_-	DUF4102 domain-containing protein	NA	A0A0P0ZDN8	Stx2-converting_phage	99.6	1.3e-160
356210:357807	attR	TGGGCGCGATTGTTGCCAGACAGGACAATTTTCACAAGACGTCGCTGATGGGGCGCTTACATTTGTTCGAAGATTGGACGGCGGATAACATTACCCATCTTGCTATGCTCTTTCGGTACGGTCCATACGTTGTCCAGCAGGTCAAATTCTGTCTTTGTTGCCAGCCTAAGCTCTGAGAGCCTCGCCCCCCACAGCATAAGCATCTGATGAAGGAGCTTATTTGACGTAGACGCACGGCTTCTTTCAATAGCAAGCCAAATCTTAGCCAGTTCGTGATACGACAGTACCCGATCCCCTACCTCAGCGCGGGAGCCGAAGTCCCTTGGCTGGATGCTCATAATTGCGCAACTATCTATCAACTGACGCCGCATGCACCAACTAATTGCTGATCTTAGTTGACTTAGCACCTGCCTTGCTCGGCGTGGATTATCTTTTTCTTCTTCGGTAAGCAGGTCAACCCATTGCTTAACCGTGATAGAAGATGCCGGACGATTAGGGAAGGCGTCATGCATGCGCTTCATAACCGTTGATCGATAAAGTGCCTGGGTCTTTTCTCTGAGAGTTGTAGAGACGTAGTTGTCGAACCAGTAGTCGAGACACTGGGCGACCGTCATGGAGTTCTCCACCTTCTCTTCAAAATAGGTGCGTGGATCCGTTCCTGAGAAATAGAGCTTTCGCAAGTCAGCAGTGATCTGTCTGGCATCCTTCAAAGACAGGGATGGGTATCGACCAAGCCCAAGTCGATTAGGCTTGCCATGCCAGCGATAGCGGTACTGGAACTGGATGACCCCCTTCGGTGAAATTCGTACGCTGAGGCCATCGGCATCAGCCACTTCTTGTGGGCCCGAATATGGTTTACCATAAATAGTACGCAGTTTTGTGTCGCTTATAGCCATAAATAATATTTGGTACGCTCAGAAATAATAGTTTGGCACACATCTGGTACACAATATCACATGGACAACAGCGCACAGTAAACAACTATATTTGACGTTCGTAGACATACTCAGGTGAAAAAAGGGTTGCTTTTCGAGTTATAACAGACAGTTAATTAACTACAGTGGACAATGCTAGACAATGACAGACACAGATAAACAACCTACCTTCCTCTTTCACGATTACGAAACCTTTGGCACGCACCCCGCGTTAGATCGCCCTGCACAGTTCGCAGCCATTCGCACCGATGACGAATTCAATGTCATCGGCGAACCCGAAGTCTTTTACTGCAAGCCCGCGGATGACTATTTACCCCGGCCTGGAGCAGTATTAATTACCGGTATTACCCCGCAGGAGGCACGGGCGAAAGGAGAAAACGAAGCCGCGTTTGCCGCCCGTATTCACTCGCTTTTTACCGTACCGAAGACCTGTATTCTGGGCTACAACAATGTGCGTTTCGACGACGAAGTCACACGCAACGTTTTTTATCGTAATTTCTACGATCCTTACGCCTGGAGCTGGCAGCATGATAACTCGCGCTGGGATTTACTGGATGTTATGCGTGCCTGTTATGCCCTGCGCCCGGAAGGAATAAACTGGCCTGAAAATGATGACGGTCTACCGAGCTTTCGCCTTGAGCATTTAACCAAAGCGAATGGTAT	NA	NA	NA	NA
>prophage 5
CP033510	Shigella flexneri strain 2016AM-0877 chromosome, complete genome	4719160	384129	390436	4719160		Enterobacteria_phage(50.0%)	6	NA	NA
AYV03550.1|384129_384675_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.3	3.5e-50
AYV03551.1|384679_385558_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.9e-106
AYV03552.1|385616_386516_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	4.4e-29
AYV03553.1|386515_387601_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	5.7e-100
AYV03554.1|387973_388867_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.3e-46
AYV03555.1|389041_390436_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	30.9	1.8e-18
>prophage 6
CP033510	Shigella flexneri strain 2016AM-0877 chromosome, complete genome	4719160	883315	950084	4719160	transposase,tail,tRNA	Aeromonas_phage(11.11%)	55	NA	NA
AYV03930.1|883315_884590_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
AYV03931.1|884692_885820_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
AYV03932.1|885846_886860_-	cytoskeleton protein RodZ	NA	NA	NA	NA	NA
AYV03933.1|887144_888299_-|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
AYV03934.1|888448_888880_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
AYV03935.1|889029_891144_-	penicillin-binding protein 1C	NA	NA	NA	NA	NA
AYV03936.1|891145_892342_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AYV03937.1|893872_894649_-	protein SseB	NA	NA	NA	NA	NA
AYV03938.1|894790_896074_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	1.7e-34
AYV03939.1|896132_896333_-	Fe-S assembly protein IscX	NA	NA	NA	NA	NA
AYV03940.1|896344_896680_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
AYV03941.1|896681_898532_-	molecular chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	7.2e-103
AYV03942.1|898548_899064_-	co-chaperone HscB	NA	NA	NA	NA	NA
AYV03943.1|899159_899483_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
AYV03944.1|899499_899886_-	iron-sulfur cluster scaffold-like protein	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
AYV03945.1|899913_901128_-	IscS subfamily cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
AYV03946.1|901239_901728_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
AYV03947.1|901997_902738_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
AYV03948.1|902856_903660_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
AYV03949.1|903804_904659_+	alpha/beta hydrolase	NA	A0A1V0SD13	Indivirus	28.6	2.0e-15
AYV03950.1|904849_906130_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
AYV03951.1|906121_907261_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
AYV03952.1|907420_908311_-	DNA-binding transcriptional regulator HcaR	NA	NA	NA	NA	NA
AYV03953.1|908446_909808_+	3-phenylpropionate/cinnamic acid dioxygenase subunit alpha	NA	NA	NA	NA	NA
AYV03954.1|909804_910323_+	3-phenylpropionate/cinnamic acid dioxygenase subunit beta	NA	NA	NA	NA	NA
AYV03955.1|910322_910643_+	3-phenylpropionate/cinnamic acid dioxygenase ferredoxin subunit	NA	NA	NA	NA	NA
AYV03956.1|910639_911452_+	3-phenylpropionate-dihydrodiol/cinnamic acid-dihydrodiol dehydrogenase	NA	NA	NA	NA	NA
AYV03957.1|911461_912679_+	phenylpropionate dioxygenase ferredoxin reductase subunit	NA	NA	NA	NA	NA
AYV03958.1|912775_913198_+	DoxX family protein	NA	NA	NA	NA	NA
AYV03959.1|913245_914118_-	aldose 1-epimerase	NA	NA	NA	NA	NA
AYV07102.1|914129_915191_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
AYV03960.1|915256_916255_-	ABC transporter permease	NA	NA	NA	NA	NA
AYV03961.1|916279_917791_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	8.7e-14
AYV03962.1|918892_921994_-	DUF5107 domain-containing protein	NA	NA	NA	NA	NA
AYV03963.1|922291_923485_+	ROK family protein	NA	NA	NA	NA	NA
AYV03964.1|923682_924936_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
AYV03965.1|925262_926453_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
AYV03966.1|926497_926836_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
AYV03967.1|926896_928231_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
AYV03968.1|928220_928934_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
AYV03969.1|929098_930526_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	2.3e-16
AYV03970.1|931083_934971_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.6	2.2e-130
AYV03971.1|935229_936786_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
AYV03972.1|936782_937319_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
AYV03973.1|937343_937979_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
AYV07103.1|938187_939036_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
AYV03974.1|939140_939323_-	hypothetical protein	NA	NA	NA	NA	NA
AYV03975.1|940430_942257_+	invasion protein	NA	NA	NA	NA	NA
AYV03976.1|942257_942437_-	hypothetical protein	NA	NA	NA	NA	NA
AYV03977.1|942990_944280_-|tail	phage tail protein	tail	Q8W611	Enterobacteria_phage	42.6	6.4e-74
AYV03978.1|944303_944849_-|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	73.1	2.5e-72
AYV03979.1|944851_945325_-|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	50.9	1.6e-35
AYV03980.1|945388_946661_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	3.0e-177
AYV03981.1|947559_948165_-	DUF2612 domain-containing protein	NA	H9C0Y0	Aeromonas_phage	43.8	1.2e-30
AYV03982.1|948928_950084_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	5.2e-67
>prophage 7
CP033510	Shigella flexneri strain 2016AM-0877 chromosome, complete genome	4719160	1085332	1093126	4719160	transposase	Pseudomonas_phage(50.0%)	6	NA	NA
AYV04096.1|1085332_1086100_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	4.8e-69
AYV04097.1|1087485_1088596_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.9	8.0e-65
AYV04098.1|1088658_1089814_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	2.0e-66
AYV04099.1|1090048_1092145_-|transposase	transposase	transposase	A0A2D1GNK9	Pseudomonas_phage	48.7	1.2e-173
AYV04100.1|1092146_1092398_-	DNA-binding protein	NA	A0A2D1GNH1	Pseudomonas_phage	53.0	1.1e-17
AYV04101.1|1092562_1093126_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	55.8	1.1e-35
>prophage 8
CP033510	Shigella flexneri strain 2016AM-0877 chromosome, complete genome	4719160	1143675	1224942	4719160	transposase,protease,integrase,tRNA	Bacillus_phage(10.53%)	60	1206925:1206941	1218062:1218078
AYV04147.1|1143675_1145004_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AYV04148.1|1145567_1146857_+	serine transporter	NA	NA	NA	NA	NA
AYV04149.1|1146914_1148282_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AYV04150.1|1148392_1149148_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
AYV04151.1|1149200_1150349_-	lactaldehyde reductase	NA	NA	NA	NA	NA
AYV04152.1|1150376_1151024_-	L-fuculose-phosphate aldolase	NA	NA	NA	NA	NA
AYV04153.1|1151570_1152887_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
AYV04154.1|1152919_1154695_+	L-fucose isomerase	NA	NA	NA	NA	NA
AYV04155.1|1156224_1156647_+	L-fucose mutarotase	NA	NA	NA	NA	NA
AYV04156.1|1156704_1157436_+	l-fucose operon activator	NA	NA	NA	NA	NA
AYV04157.1|1157479_1158580_-	23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM	NA	NA	NA	NA	NA
AYV04158.1|1158572_1158968_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
AYV04159.1|1158986_1159904_-	transcriptional regulator GcvA	NA	NA	NA	NA	NA
AYV04160.1|1160254_1160482_-	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
AYV04161.1|1160673_1161879_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.0	6.6e-73
AYV04162.1|1161878_1162322_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
AYV04163.1|1162372_1163179_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	1.7e-16
AYV04164.1|1163416_1164514_-	murein transglycosylase A	NA	NA	NA	NA	NA
AYV04165.1|1164983_1166237_-	N-acetylmuramoyl-L-alanine amidase	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
AYV04166.1|1166468_1167800_+	N-acetylglutamate synthase	NA	NA	NA	NA	NA
AYV04167.1|1167861_1169688_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	27.5	2.3e-24
AYV04168.1|1169687_1173230_-	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.8	1.2e-08
AYV04169.1|1173222_1176111_-|protease	protease 3	protease	A0A1V0SJA4	Klosneuvirus	26.0	2.4e-68
AYV04170.1|1176286_1179655_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
AYV04171.1|1179667_1180018_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
AYV04172.1|1180002_1180410_-	DUF2509 family protein	NA	NA	NA	NA	NA
AYV04173.1|1180406_1180970_-	prepilin-type cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
AYV04174.1|1181614_1182409_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.5	9.9e-118
AYV04175.1|1182415_1183291_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
AYV04176.1|1183441_1185688_-	phosphoenolpyruvate-protein phosphotransferase PtsP	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
AYV04177.1|1185700_1186231_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
AYV04178.1|1186542_1186737_+	hypothetical protein	NA	NA	NA	NA	NA
AYV04179.1|1186915_1187605_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
AYV04180.1|1187673_1188387_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.0e-45
AYV04181.1|1188524_1188743_+	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
AYV04182.1|1188850_1189891_+	protein tas	NA	NA	NA	NA	NA
AYV04183.1|1189923_1191114_-	lysophospholipid transporter LplT	NA	NA	NA	NA	NA
AYV04184.1|1191106_1193266_-	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	NA	NA	NA	NA
AYV04185.1|1193851_1194883_+	HTH-type transcriptional regulator GalR	NA	NA	NA	NA	NA
AYV04186.1|1194889_1196152_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
AYV04187.1|1196273_1197209_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYV04188.1|1197195_1197888_-	aspartate/glutamate racemase	NA	NA	NA	NA	NA
AYV04189.1|1198016_1199435_-	MFS transporter	NA	O13311	Aichi_virus	26.9	1.3e-24
AYV04190.1|1199749_1200511_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	5.9e-19
AYV04191.1|1200540_1201377_-	5-keto-4-deoxyuronate isomerase	NA	NA	NA	NA	NA
AYV04192.1|1201663_1202845_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
AYV04193.1|1203210_1204329_+	transporter	NA	NA	NA	NA	NA
AYV04194.1|1204963_1206125_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	6.8e-51
1206925:1206941	attL	TGGAGCGGGCGAAGGGA	NA	NA	NA	NA
AYV07110.1|1207364_1208348_-	hypothetical protein	NA	NA	NA	NA	NA
AYV04195.1|1208437_1208800_-	ATPase	NA	NA	NA	NA	NA
AYV07111.1|1209365_1210874_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
AYV04196.1|1212748_1213495_-	Rha family transcriptional regulator	NA	B5AX29	Iodobacteriophage	38.9	4.7e-13
AYV07112.1|1214613_1214946_-	hypothetical protein	NA	NA	NA	NA	NA
AYV04197.1|1215046_1216215_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
AYV04198.1|1216316_1217927_-|integrase	site-specific integrase	integrase	A0A059XK29	uncultured_phage	28.4	2.3e-12
AYV04199.1|1218213_1218969_-	LysM peptidoglycan-binding domain-containing protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
1218062:1218078	attR	TGGAGCGGGCGAAGGGA	NA	NA	NA	NA
AYV04200.1|1218965_1219157_-	hypothetical protein	NA	NA	NA	NA	NA
AYV04201.1|1221691_1222570_+	xanthine dehydrogenase FAD-binding subunit XdhB	NA	NA	NA	NA	NA
AYV04202.1|1222566_1223046_+	xanthine dehydrogenase iron sulfur-binding subunit XdhC	NA	NA	NA	NA	NA
AYV04203.1|1223668_1224942_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	6.8e-177
>prophage 9
CP033510	Shigella flexneri strain 2016AM-0877 chromosome, complete genome	4719160	1279470	1342695	4719160	transposase,protease,tRNA	Shigella_phage(33.33%)	49	NA	NA
AYV04251.1|1279470_1280229_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYV04252.1|1280434_1281355_-	agmatinase	NA	NA	NA	NA	NA
AYV04253.1|1282734_1284711_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYV07119.1|1284719_1284851_-	virulence promoting factor	NA	NA	NA	NA	NA
AYV04254.1|1284986_1285202_+	hypothetical protein	NA	NA	NA	NA	NA
AYV04255.1|1285198_1285450_-	DUF2684 family protein	NA	NA	NA	NA	NA
AYV04256.1|1285505_1286660_+	S-adenosylmethionine synthase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
AYV04257.1|1287096_1288491_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
AYV04258.1|1288567_1289065_+	SprT family protein	NA	NA	NA	NA	NA
AYV04259.1|1289159_1289867_+	deoxyribonuclease I	NA	NA	NA	NA	NA
AYV04260.1|1289946_1290678_+	ribosomal RNA small subunit methyltransferase E	NA	NA	NA	NA	NA
AYV04261.1|1290690_1291641_+	glutathione synthase	NA	NA	NA	NA	NA
AYV04262.1|1291749_1292313_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
AYV04263.1|1292312_1292729_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
AYV04264.1|1292904_1293885_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
AYV04265.1|1293902_1294607_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
AYV04266.1|1294624_1295191_+	YggT family protein	NA	NA	NA	NA	NA
AYV04267.1|1295187_1295478_+	YggU family protein	NA	NA	NA	NA	NA
AYV04268.1|1295485_1296079_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
AYV04269.1|1296071_1297208_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
AYV04270.1|1298529_1299033_+	TRAP transporter small permease	NA	NA	NA	NA	NA
AYV04271.1|1299796_1301098_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
AYV04272.1|1301198_1302161_-	DUF1202 family protein	NA	NA	NA	NA	NA
AYV04273.1|1302277_1303324_-	L-asparaginase 2	NA	NA	NA	NA	NA
AYV04274.1|1303499_1304219_-	DUF2884 family protein	NA	NA	NA	NA	NA
AYV04275.1|1304402_1304729_-	DUF469 domain-containing protein	NA	NA	NA	NA	NA
AYV04276.1|1304728_1305448_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
AYV04277.1|1305608_1306661_+	adenine DNA glycosylase	NA	NA	NA	NA	NA
AYV04278.1|1306688_1306964_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYV04279.1|1307028_1308108_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
AYV04280.1|1308309_1309566_+	nucleoside permease NupG	NA	NA	NA	NA	NA
AYV04281.1|1309614_1311750_-	ornithine decarboxylase	NA	NA	NA	NA	NA
AYV04282.1|1312147_1312855_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
AYV04283.1|1314236_1315565_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AYV04284.1|1316034_1316298_-	hypothetical protein	NA	NA	NA	NA	NA
AYV04285.1|1316386_1319902_+	DNA helicase	NA	NA	NA	NA	NA
AYV04286.1|1320974_1322012_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
AYV04287.1|1322001_1322193_-	hypothetical protein	NA	NA	NA	NA	NA
AYV04288.1|1322372_1326230_+|protease	serine protease autotransporter toxin SigA	protease	Q9LA58	Enterobacterial_phage	38.3	2.4e-225
AYV04289.1|1326276_1326858_+	hypothetical protein	NA	NA	NA	NA	NA
AYV04290.1|1327035_1327227_+	hypothetical protein	NA	NA	NA	NA	NA
AYV04291.1|1329672_1333791_-|protease	serine protease autotransporter toxin Pic	protease	Q9LA54	Enterobacteria_phage	45.8	0.0e+00
AYV07120.1|1334518_1336027_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
AYV04292.1|1336335_1336707_+	hypothetical protein	NA	NA	NA	NA	NA
AYV04293.1|1337721_1338147_-	hypothetical protein	NA	NA	NA	NA	NA
AYV04294.1|1338143_1338527_-	hypothetical protein	NA	NA	NA	NA	NA
AYV04295.1|1338638_1339806_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
AYV04296.1|1340151_1340751_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AYV04297.1|1341422_1342695_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	2.6e-176
>prophage 10
CP033510	Shigella flexneri strain 2016AM-0877 chromosome, complete genome	4719160	2159728	2182530	4719160	transposase	Shigella_phage(40.0%)	17	NA	NA
AYV04981.1|2159728_2160884_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	5.2e-67
AYV04982.1|2163015_2164288_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	3.0e-177
AYV04983.1|2165054_2165627_-	fimbrial protein	NA	NA	NA	NA	NA
AYV04984.1|2165918_2167247_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AYV04985.1|2167854_2168094_+	DUF1819 family protein	NA	NA	NA	NA	NA
AYV04986.1|2169590_2170064_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
AYV04987.1|2170158_2170683_+	streptothricin N-acetyltransferase Sat2	NA	E4ZFP7	Streptococcus_phage	38.9	4.2e-16
AYV04988.1|2170740_2171529_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AYV04989.1|2171604_2172102_+	hypothetical protein	NA	NA	NA	NA	NA
AYV04990.1|2172162_2172534_+	hypothetical protein	NA	NA	NA	NA	NA
AYV04991.1|2172566_2172890_+	hypothetical protein	NA	NA	NA	NA	NA
AYV04992.1|2172943_2173321_+	hypothetical protein	NA	NA	NA	NA	NA
AYV04993.1|2174359_2175528_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
AYV04994.1|2176420_2177947_-	transcriptional antiterminator	NA	NA	NA	NA	NA
AYV04995.1|2177949_2179617_-	AAA family ATPase	NA	NA	NA	NA	NA
AYV04996.1|2179613_2181722_-|transposase	transposase	transposase	NA	NA	NA	NA
AYV04997.1|2181708_2182530_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	NA	NA	NA	NA
>prophage 11
CP033510	Shigella flexneri strain 2016AM-0877 chromosome, complete genome	4719160	3046752	3169397	4719160	protease,plate,terminase,portal,transposase,coat,tRNA	Escherichia_phage(19.35%)	104	NA	NA
AYV05675.1|3046752_3048177_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.2	6.5e-27
AYV05676.1|3049576_3049963_-	DUF3461 family protein	NA	NA	NA	NA	NA
AYV05677.1|3050276_3051101_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
AYV05678.1|3051131_3053804_-	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
AYV05679.1|3053865_3054660_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
AYV05680.1|3055027_3055753_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
AYV05681.1|3056010_3056862_+	elongation factor Ts	NA	NA	NA	NA	NA
AYV05682.1|3057008_3057734_+	UMP kinase	NA	NA	NA	NA	NA
AYV05683.1|3058025_3058583_+	ribosome recycling factor	NA	NA	NA	NA	NA
AYV05684.1|3058674_3059871_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
AYV05685.1|3060059_3060818_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
AYV05686.1|3060830_3061688_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
AYV05687.1|3061699_3063052_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
AYV05688.1|3063081_3065514_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
AYV05689.1|3065635_3066121_+	chaperone protein Skp	NA	NA	NA	NA	NA
AYV05690.1|3066124_3067150_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
AYV05691.1|3067254_3067710_+	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
AYV05692.1|3067713_3068502_+	acyl-[acyl-carrier-protein]--UDP-N- acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
AYV05693.1|3068501_3069650_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
AYV05694.1|3069646_3070243_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.8e-26
AYV05695.1|3070279_3073762_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
AYV05696.1|3073774_3074734_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
AYV05697.1|3074832_3076974_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
AYV05698.1|3077030_3077420_+	VOC family protein	NA	NA	NA	NA	NA
AYV05699.1|3077484_3078783_+|tRNA	tRNA(Ile)-lysidine synthetase	tRNA	NA	NA	NA	NA
AYV05700.1|3078831_3079092_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
AYV05701.1|3079078_3079279_-	YaeP family protein	NA	NA	NA	NA	NA
AYV05702.1|3079444_3079990_+	YaeQ family protein	NA	NA	NA	NA	NA
AYV05703.1|3079986_3080409_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
AYV05704.1|3080422_3081133_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
AYV05705.1|3081287_3082112_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
AYV05706.1|3082164_3083883_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
AYV05707.1|3083993_3084701_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
AYV05708.1|3084697_3085102_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
AYV05709.1|3085219_3086035_-	methionine ABC transporter substrate-binding protein MetQ	NA	NA	NA	NA	NA
AYV05710.1|3086074_3086728_-	D-methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
AYV05711.1|3086720_3087752_-	methionine import ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
AYV05712.1|3087939_3088515_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
AYV05713.1|3094273_3095077_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	9.2e-39
AYV05714.1|3095115_3096444_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AYV05715.1|3096511_3097426_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYV05716.1|3097666_3098467_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
AYV05717.1|3098544_3099315_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYV05718.1|3099362_3100709_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	35.1	3.7e-08
AYV05719.1|3100780_3101536_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
AYV05720.1|3101569_3102292_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
AYV05721.1|3102288_3102756_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
AYV07179.1|3102820_3103552_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
AYV05722.1|3103891_3104938_-	cytoplasmic protein	NA	NA	NA	NA	NA
AYV05723.1|3105507_3107391_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
AYV05724.1|3107406_3107901_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
AYV05725.1|3109681_3110954_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
AYV07180.1|3111011_3111299_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	60.0	1.8e-29
AYV05726.1|3111376_3112544_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
AYV05727.1|3112538_3113594_+|terminase	terminase	terminase	I1TEI5	Salmonella_phage	99.7	1.2e-211
AYV05728.1|3113594_3115760_+|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.2	0.0e+00
AYV05729.1|3115773_3116685_+	scaffolding protein	NA	A0A2D1GLN7	Escherichia_phage	99.0	2.0e-159
AYV05730.1|3116684_3117980_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	98.4	1.5e-240
AYV05731.1|3118024_3118255_+	hypothetical protein	NA	A0A2D1GLK1	Escherichia_phage	69.3	1.2e-23
AYV05732.1|3118232_3118733_+	recombinase RmuC	NA	G8EYJ2	Enterobacteria_phage	99.4	6.5e-91
AYV05733.1|3118732_3120151_+	hypothetical protein	NA	Q9AYZ4	Salmonella_phage	98.7	1.2e-272
AYV05734.1|3120150_3120999_+	hypothetical protein	NA	Q716G6	Shigella_phage	98.6	2.1e-102
AYV05735.1|3120998_3121454_+	DUF2824 family protein	NA	A0A2D1GLX4	Escherichia_phage	99.3	8.8e-87
AYV05736.1|3121456_3122149_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	99.6	2.1e-111
AYV05737.1|3122158_3123490_+	acyltransferase	NA	A0A2D1GLX5	Escherichia_phage	99.8	3.1e-217
AYV05738.1|3123490_3125221_+	lytic transglycosylase domain-containing protein	NA	A0A088CQ71	Enterobacteria_phage	97.9	6.8e-281
AYV05739.1|3126606_3126927_-	phosphate starvation-inducible protein PsiF	NA	NA	NA	NA	NA
AYV05740.1|3127045_3128461_-	alkaline phosphatase	NA	NA	NA	NA	NA
AYV05741.1|3128561_3128822_-	anti-adapter protein IraP	NA	NA	NA	NA	NA
AYV05742.1|3129003_3129204_-	hypothetical protein	NA	NA	NA	NA	NA
AYV05743.1|3129284_3130379_+	D-alanine--D-alanine ligase A	NA	NA	NA	NA	NA
AYV05744.1|3130402_3130615_-	DUF2754 family protein	NA	NA	NA	NA	NA
AYV05745.1|3130874_3131183_+	DUF2755 family protein	NA	NA	NA	NA	NA
AYV05746.1|3131241_3132336_-	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
AYV05747.1|3132348_3133569_-	peptide antibiotic transporter SbmA	NA	NA	NA	NA	NA
AYV05748.1|3133920_3135078_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
AYV05749.1|3135078_3135582_-	transcriptional regulator	NA	NA	NA	NA	NA
AYV05750.1|3137302_3138459_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
AYV05751.1|3139235_3140509_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	3.0e-177
AYV05752.1|3142224_3143199_+	porphobilinogen synthase	NA	NA	NA	NA	NA
AYV05753.1|3143304_3144156_-	taurine dioxygenase	NA	NA	NA	NA	NA
AYV05754.1|3144152_3144980_-	taurine ABC transporter permease TauC	NA	NA	NA	NA	NA
AYV05755.1|3144976_3145744_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.8	4.3e-25
AYV05756.1|3145756_3146683_-	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYV07181.1|3146949_3147144_-	regulator	NA	NA	NA	NA	NA
AYV05757.1|3148052_3148721_+	hypothetical protein	NA	NA	NA	NA	NA
AYV05758.1|3148963_3149659_-	lactate utilization protein C	NA	NA	NA	NA	NA
AYV05759.1|3149651_3151079_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
AYV05760.1|3151089_3151809_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
AYV05761.1|3153109_3153595_+	hypothetical protein	NA	NA	NA	NA	NA
AYV05762.1|3153591_3153978_+	hypothetical protein	NA	NA	NA	NA	NA
AYV05763.1|3154002_3156216_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
AYV05764.1|3156705_3157113_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
AYV05765.1|3157109_3159398_+	RHS repeat protein	NA	NA	NA	NA	NA
AYV05766.1|3159394_3160384_+	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	52.7	6.5e-26
AYV05767.1|3160704_3161025_+	hypothetical protein	NA	NA	NA	NA	NA
AYV05768.1|3161432_3162203_-	amidohydrolase	NA	NA	NA	NA	NA
AYV05769.1|3162356_3162830_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
AYV05770.1|3162872_3165317_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
AYV05771.1|3165556_3166135_+	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
AYV05772.1|3166340_3167108_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
AYV05773.1|3167078_3167819_-	transpeptidase	NA	NA	NA	NA	NA
AYV05774.1|3168169_3168724_+	peptidoglycan endopeptidase	NA	A0A0A8WIF2	Clostridium_phage	36.1	1.4e-14
AYV05775.1|3168899_3169397_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 12
CP033510	Shigella flexneri strain 2016AM-0877 chromosome, complete genome	4719160	3191028	3320872	4719160	transposase,integrase,tail,tRNA	Shigella_phage(28.26%)	103	3263789:3263804	3274481:3274496
AYV05794.1|3191028_3192302_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
AYV05795.1|3192991_3193555_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AYV05796.1|3194867_3195059_-	hypothetical protein	NA	NA	NA	NA	NA
AYV05797.1|3195112_3195772_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
AYV05798.1|3195972_3196350_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYV05799.1|3196416_3199383_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AYV05800.1|3199385_3199946_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AYV07183.1|3200071_3200422_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AYV05801.1|3200624_3201638_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYV05802.1|3202035_3203577_+	fluoroquinolone efflux MFS transporter QepA8	NA	A0A0M3UL24	Mycobacterium_phage	33.3	7.7e-42
AYV05803.1|3203604_3203973_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
AYV05804.1|3204229_3205762_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AYV07184.1|3206851_3207682_+	OXA-1 family class D beta-lactamase	NA	NA	NA	NA	NA
AYV05805.1|3207794_3208586_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AYV05806.1|3209489_3209666_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AYV05807.1|3209696_3210029_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AYV07185.1|3210359_3210623_+	hypothetical protein	NA	NA	NA	NA	NA
AYV05808.1|3211275_3212286_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.3	5.1e-18
AYV05809.1|3212379_3214506_+	alpha-galactosidase	NA	NA	NA	NA	NA
AYV05810.1|3214560_3215838_+	MFS transporter	NA	NA	NA	NA	NA
AYV05811.1|3215834_3217265_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
AYV05812.1|3217328_3217844_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
AYV05813.1|3218826_3219198_-	hypothetical protein	NA	NA	NA	NA	NA
AYV05814.1|3221728_3227464_-	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
AYV05815.1|3228626_3229649_+|transposase	IS21 family transposase IS100	transposase	A0A2L1IVA1	Escherichia_phage	100.0	1.9e-201
AYV05816.1|3229645_3230428_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	2.0e-139
AYV05817.1|3230922_3232965_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AYV05818.1|3232957_3234409_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
AYV05819.1|3237035_3240152_-	HsdR family type I site-specific deoxyribonuclease	NA	NA	NA	NA	NA
AYV05820.1|3240273_3241500_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
AYV05821.1|3241496_3243053_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	2.2e-105
AYV05822.1|3243316_3244189_+	GTPase family protein	NA	NA	NA	NA	NA
AYV05823.1|3244561_3247408_+	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
AYV05824.1|3247478_3247637_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AYV05825.1|3247636_3247771_+	cytoplasmic protein	NA	NA	NA	NA	NA
AYV05826.1|3247791_3248610_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.0	1.8e-45
AYV05827.1|3248609_3248855_+	antirestriction protein	NA	NA	NA	NA	NA
AYV05828.1|3248948_3249428_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	2.6e-12
AYV05829.1|3249441_3249918_+	DNA repair protein RadC	NA	NA	NA	NA	NA
AYV05830.1|3249986_3250208_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
AYV05831.1|3250916_3251285_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AYV05832.1|3251374_3251752_+	toxin	NA	NA	NA	NA	NA
AYV05833.1|3251916_3252663_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
AYV05834.1|3252677_3254219_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
AYV05835.1|3254834_3255032_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
AYV07186.1|3255116_3255965_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AYV05836.1|3256057_3257377_-|integrase	site-specific integrase	integrase	A0A2H4J5F8	uncultured_Caudovirales_phage	23.2	5.6e-17
AYV05837.1|3257602_3258067_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	96.1	3.5e-83
AYV05838.1|3258093_3259250_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
AYV05839.1|3259908_3260343_-	DNA-binding protein	NA	U5P4J3	Shigella_phage	99.3	3.2e-78
AYV05840.1|3260258_3260564_-	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
AYV05841.1|3260563_3260941_-	hypothetical protein	NA	U5P092	Shigella_phage	99.0	1.8e-53
AYV05842.1|3262278_3263434_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	1.4e-67
3263789:3263804	attL	CACAAATACGGCACAA	NA	NA	NA	NA
AYV05843.1|3264098_3264461_+	GtrA family protein	NA	U5P0S6	Shigella_phage	99.2	2.3e-58
AYV05844.1|3264457_3265387_+	glycosyltransferase	NA	S5FKN0	Shigella_phage	99.7	2.3e-174
AYV05845.1|3265383_3266844_+	glucosyl transferase	NA	O21944	Shigella_phage	99.4	6.6e-269
AYV05846.1|3267233_3268424_-|transposase	IS4-like element ISSfl9 family transposase	transposase	S5FM71	Shigella_phage	99.5	3.7e-225
AYV05847.1|3268874_3269924_+	acyltransferase	NA	S5FNR8	Shigella_phage	99.4	4.1e-196
AYV05848.1|3270696_3271194_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	92.2	3.0e-80
AYV05849.1|3271102_3271753_-	hypothetical protein	NA	S5FKM2	Shigella_phage	100.0	1.2e-116
AYV05850.1|3271805_3272962_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
AYV05851.1|3273147_3274311_+|integrase	integrase	integrase	U5P434	Shigella_phage	99.5	4.5e-228
AYV05852.1|3274665_3275832_+	acyltransferase	NA	A0A088CPR9	Enterobacteria_phage	99.5	3.6e-209
3274481:3274496	attR	CACAAATACGGCACAA	NA	NA	NA	NA
AYV05853.1|3275885_3276509_-|tail	phage tail protein	tail	A0A088CQ58	Enterobacteria_phage	75.8	1.1e-71
AYV05854.1|3276635_3277852_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	5.5e-67
AYV07187.1|3278380_3279889_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
AYV05855.1|3280197_3280569_+	hypothetical protein	NA	NA	NA	NA	NA
AYV05856.1|3281447_3282563_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.5e-18
AYV05857.1|3282579_3283389_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
AYV05858.1|3283508_3283967_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
AYV05859.1|3284149_3284674_+	shikimate kinase	NA	NA	NA	NA	NA
AYV05860.1|3284723_3284915_+	protein YaiA	NA	NA	NA	NA	NA
AYV05861.1|3285172_3285850_+	protein AroM	NA	NA	NA	NA	NA
AYV05862.1|3285921_3286206_+	pyrimidine/purine nucleoside phosphorylase	NA	NA	NA	NA	NA
AYV07188.1|3287225_3288137_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.3	4.6e-103
AYV05863.1|3288261_3289170_+	fructokinase	NA	NA	NA	NA	NA
AYV07189.1|3289312_3290494_-	MFS transporter AraJ	NA	NA	NA	NA	NA
AYV05864.1|3290619_3293763_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
AYV05865.1|3293759_3294962_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	31.5	2.4e-06
AYV05866.1|3295151_3295841_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	38.5	1.5e-37
AYV05867.1|3295898_3297194_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.7e-26
AYV05868.1|3297600_3298920_+	branched-chain amino acid transporter carrier protein BrnQ	NA	NA	NA	NA	NA
AYV05869.1|3298995_3300369_+	proline-specific permease ProY	NA	NA	NA	NA	NA
AYV05870.1|3300524_3302342_+	maltodextrin glucosidase	NA	NA	NA	NA	NA
AYV05871.1|3303012_3304083_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
AYV05872.1|3304137_3305265_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.3	1.6e-89
AYV05873.1|3305287_3305620_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
AYV05874.1|3305647_3307495_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
AYV05875.1|3307505_3308477_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	8.0e-45
AYV05876.1|3308605_3308953_+	HNH endonuclease	NA	NA	NA	NA	NA
AYV05877.1|3309129_3310014_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
AYV05878.1|3310311_3310851_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
AYV05879.1|3311001_3311451_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
AYV05880.1|3311454_3312558_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	9.1e-53
AYV05881.1|3312646_3313117_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
AYV05882.1|3313136_3313556_+	N utilization substance protein B	NA	NA	NA	NA	NA
AYV05883.1|3313633_3314611_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
AYV05884.1|3314588_3315107_+	phosphatidylglycerophosphatase A	NA	NA	NA	NA	NA
AYV05885.1|3315217_3316135_-	aldo/keto reductase	NA	NA	NA	NA	NA
AYV05886.1|3316189_3318052_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
AYV05887.1|3318076_3318976_-	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
AYV05888.1|3318975_3319218_-	exodeoxyribonuclease 7 small subunit	NA	NA	NA	NA	NA
AYV05889.1|3319423_3320872_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
>prophage 13
CP033510	Shigella flexneri strain 2016AM-0877 chromosome, complete genome	4719160	3604271	3693918	4719160	head,tail,terminase,capsid,transposase,holin,tRNA	Enterobacteria_phage(33.96%)	89	NA	NA
AYV06110.1|3604271_3605696_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
AYV06111.1|3605809_3606889_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
AYV06112.1|3606885_3607353_+	endoribonuclease YbeY	NA	NA	NA	NA	NA
AYV06113.1|3607442_3608321_+	magnesium and cobalt efflux protein CorC	NA	NA	NA	NA	NA
AYV06114.1|3608345_3609884_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
AYV06115.1|3610280_3611189_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYV06116.1|3611358_3612099_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
AYV06117.1|3612098_3612773_+	glutamate/aspartate ABC transporter permease GltK	NA	NA	NA	NA	NA
AYV06118.1|3612772_3613498_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	1.7e-31
AYV06119.1|3613615_3614551_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
AYV06120.1|3616364_3617816_-	J domain-containing protein	NA	NA	NA	NA	NA
AYV06121.1|3617812_3618520_-	DUF1266 domain-containing protein	NA	NA	NA	NA	NA
AYV06122.1|3618621_3619176_+	sel1 repeat family protein	NA	NA	NA	NA	NA
AYV06123.1|3619185_3620613_-	J domain-containing protein	NA	NA	NA	NA	NA
AYV06124.1|3620609_3621335_-	DUF1266 domain-containing protein	NA	NA	NA	NA	NA
AYV06125.1|3621479_3622457_+	Sel1 family TPR-like repeat protein YbeQ	NA	NA	NA	NA	NA
AYV06126.1|3622526_3623009_-	zinc ribbon-containing protein	NA	NA	NA	NA	NA
AYV06127.1|3623243_3625826_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	1.4e-184
AYV06128.1|3625840_3626422_+	LPS assembly lipoprotein LptE	NA	NA	NA	NA	NA
AYV06129.1|3626421_3627453_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
AYV06130.1|3627454_3628096_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
AYV06131.1|3628119_3628731_+	adenosylcobalamin/alpha-ribazole phosphatase	NA	NA	NA	NA	NA
AYV06132.1|3628990_3629308_+	ribosome silencing factor RsfS	NA	NA	NA	NA	NA
AYV06133.1|3629311_3629779_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
AYV06134.1|3629809_3631711_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
AYV06135.1|3631713_3632826_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
AYV06136.1|3632836_3633925_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
AYV06137.1|3634063_3635275_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	47.2	7.5e-101
AYV06138.1|3635385_3635649_+	DUF493 family protein	NA	NA	NA	NA	NA
AYV06139.1|3635749_3636391_+	octanoyltransferase	NA	NA	NA	NA	NA
AYV06140.1|3636649_3637603_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
AYV06141.1|3637811_3638777_+	lipoyl synthase	NA	NA	NA	NA	NA
AYV06142.1|3638877_3639081_-	twin-arginine translocase subunit TatE	NA	NA	NA	NA	NA
AYV06143.1|3639209_3639998_-	deaminated glutathione amidase	NA	NA	NA	NA	NA
AYV06144.1|3640090_3640474_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
AYV06145.1|3640527_3640737_-	cold-shock protein CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
AYV06146.1|3640911_3641472_-	phospholipid:lipid A palmitoyltransferase	NA	NA	NA	NA	NA
AYV06147.1|3642060_3643446_+	anaerobic C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
AYV06148.1|3644165_3644675_-	DNA-binding protein	NA	NA	NA	NA	NA
AYV07199.1|3644837_3645083_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	63.2	6.1e-18
AYV06149.1|3646753_3647909_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
AYV06150.1|3647906_3648152_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	68.6	1.1e-11
AYV06151.1|3648193_3649135_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	85.6	2.3e-153
AYV06152.1|3649279_3649636_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	87.4	4.7e-51
AYV06153.1|3649639_3650860_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	85.6	2.5e-192
AYV06154.1|3650863_3651607_-|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	84.4	5.3e-89
AYV06155.1|3651497_3652964_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	90.8	1.6e-259
AYV06156.1|3653708_3654937_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	2.5e-176
AYV06157.1|3655012_3655720_-|terminase	PBSX family phage terminase large subunit	terminase	K4NXU1	Acinetobacter_phage	73.4	9.5e-96
AYV06158.1|3655646_3656411_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	55.4	7.0e-12
AYV06159.1|3656608_3657118_+	DedA family protein	NA	NA	NA	NA	NA
AYV06160.1|3657250_3657442_-	hypothetical protein	NA	Q76H62	Enterobacteria_phage	98.4	1.3e-28
AYV06161.1|3657524_3658692_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
AYV06162.1|3658721_3659144_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	63.4	9.4e-43
AYV07200.1|3659976_3660165_+	hypothetical protein	NA	NA	NA	NA	NA
AYV06163.1|3660455_3661585_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	4.6e-60
AYV06164.1|3661860_3663720_+	hypothetical protein	NA	B0FEC9	Escherichia_phage	98.0	0.0e+00
AYV06165.1|3663694_3664863_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
AYV06166.1|3664955_3665834_+	AAA family ATPase	NA	Q8W641	Enterobacteria_phage	95.6	3.0e-139
AYV06167.1|3665830_3667222_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	95.7	3.6e-256
AYV07201.1|3667233_3667476_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	93.8	7.8e-34
AYV06168.1|3667570_3667771_+	protein ninH	NA	A0A088CC23	Shigella_phage	74.2	1.1e-20
AYV06169.1|3667763_3668144_+	antitermination protein	NA	A0A088CD47	Shigella_phage	87.9	8.2e-62
AYV06170.1|3668946_3669162_+|holin	holin	holin	M1FN85	Enterobacteria_phage	94.4	2.2e-32
AYV07202.1|3669180_3669795_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	57.6	4.6e-30
AYV06171.1|3669860_3670394_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	98.3	1.6e-100
AYV06172.1|3670610_3670805_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	100.0	2.5e-27
AYV06173.1|3670856_3672012_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
AYV07203.1|3672079_3672364_+	DNA packaging protein	NA	NA	NA	NA	NA
AYV06174.1|3672335_3674246_+|terminase	phage terminase large subunit family protein	terminase	K7P6G6	Enterobacteria_phage	63.9	4.9e-248
AYV06175.1|3674246_3674450_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	57.4	8.6e-10
AYV06176.1|3676029_3677535_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.0	4.3e-98
AYV06177.1|3677571_3677919_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	8.3e-21
AYV06178.1|3677976_3679005_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.8	1.8e-116
AYV06179.1|3679056_3679443_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
AYV06180.1|3679454_3679832_+|tail	phage tail protein	tail	A0A2R9YJJ5	Escherichia_phage	57.3	2.5e-31
AYV06181.1|3679818_3680403_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	87.6	6.0e-88
AYV06182.1|3680399_3680801_+|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	94.0	1.1e-69
AYV06183.1|3680811_3681552_+|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	96.7	1.5e-128
AYV06184.1|3681610_3681997_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	92.2	1.4e-61
AYV06185.1|3682005_3682335_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	99.1	1.3e-55
AYV06186.1|3682306_3685348_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	86.5	0.0e+00
AYV06187.1|3685347_3685677_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	97.2	2.4e-57
AYV06188.1|3685676_3686375_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	89.7	8.4e-121
AYV06189.1|3686379_3687123_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.8e-145
AYV06190.1|3687059_3687662_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	8.1e-88
AYV06191.1|3687722_3691202_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	87.3	0.0e+00
AYV06192.1|3691269_3691869_+	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	93.0	1.8e-103
AYV06193.1|3693294_3693918_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	75.9	5.1e-77
>prophage 14
CP033510	Shigella flexneri strain 2016AM-0877 chromosome, complete genome	4719160	3809090	3923511	4719160	transposase,protease,integrase,tRNA	Escherichia_phage(13.95%)	86	3811786:3811845	3926915:3927388
AYV06295.1|3809090_3810364_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	3.0e-177
AYV06296.1|3810759_3811455_-	aquaporin	NA	NA	NA	NA	NA
3811786:3811845	attL	GAAGACGTGCGCCACAACCGTCCTCCGTATCCTGTCATACGCGTAAAACAGCCAGCGCTG	NA	NA	NA	NA
AYV06297.1|3812655_3814314_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
AYV06298.1|3814310_3815303_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
AYV06299.1|3815417_3816533_+	MacA family efflux pump subunit	NA	NA	NA	NA	NA
AYV06300.1|3816529_3818476_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	39.6	5.5e-37
AYV06301.1|3818548_3818773_-	cold-shock protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
AYV06302.1|3819095_3819416_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
AYV06303.1|3819446_3821723_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	4.3e-166
AYV06304.1|3822466_3822685_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
AYV06305.1|3822969_3823674_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
AYV06306.1|3823715_3825437_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	9.9e-22
AYV06307.1|3825437_3827204_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.0	4.6e-22
AYV06308.1|3827326_3828292_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.3	3.2e-62
AYV06309.1|3828835_3829330_+	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
AYV06310.1|3829464_3833493_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
AYV06311.1|3833647_3834259_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
AYV06312.1|3834269_3835613_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.0	4.3e-81
AYV06313.1|3835703_3836996_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
AYV06314.1|3839689_3840307_+	dimethyl sulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
AYV06315.1|3840308_3841100_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
AYV06316.1|3841135_3841762_-	hydrolase	NA	NA	NA	NA	NA
AYV06317.1|3842076_3843225_+	MFS transporter	NA	NA	NA	NA	NA
AYV06318.1|3843537_3844212_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.1	3.4e-10
AYV06319.1|3844208_3844559_+|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	68.7	3.5e-27
AYV06320.1|3844555_3846157_+|transposase	IS66-like element ISSfl3 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	61.3	5.0e-145
AYV06321.1|3846696_3847865_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
AYV06322.1|3848147_3848360_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	90.0	4.0e-26
AYV06323.1|3848530_3849196_-	hypothetical protein	NA	NA	NA	NA	NA
AYV06324.1|3849364_3849778_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	4.6e-58
AYV06325.1|3849778_3850201_-	DUF977 family protein	NA	A0A2I6TCA7	Escherichia_phage	76.6	5.9e-53
AYV06326.1|3852210_3852438_-	transcriptional regulator	NA	NA	NA	NA	NA
AYV06327.1|3852514_3852922_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	1.7e-28
AYV06328.1|3853124_3853280_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	5.2e-07
AYV06329.1|3853281_3853485_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	82.5	1.0e-10
AYV06330.1|3853461_3853752_-	hypothetical protein	NA	NA	NA	NA	NA
AYV06331.1|3853726_3855000_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	3.0e-177
AYV06332.1|3855502_3856351_+	transcriptional regulator	NA	A0A0P0ZE80	Stx2-converting_phage	57.0	9.7e-55
AYV06333.1|3856864_3857993_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	3.5e-60
AYV06334.1|3858018_3858663_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	96.2	7.3e-111
AYV06335.1|3858791_3858995_-	racC domain protein	NA	A0A0U2QW85	Escherichia_phage	84.9	2.3e-18
AYV06336.1|3859006_3860163_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
AYV06337.1|3860228_3860846_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	76.5	5.7e-81
AYV06338.1|3860845_3861025_+	hypothetical protein	NA	NA	NA	NA	NA
AYV06339.1|3861025_3862852_-	invasion protein	NA	NA	NA	NA	NA
AYV06340.1|3863342_3863474_+	DNA invertase	NA	A0A0C4UR34	Shigella_phage	86.7	2.6e-07
AYV06341.1|3863733_3864729_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
AYV06342.1|3865906_3866959_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
AYV06343.1|3867034_3868468_+	anion permease	NA	NA	NA	NA	NA
AYV06344.1|3868650_3870831_+	hydratase	NA	NA	NA	NA	NA
AYV06345.1|3870971_3872255_-	putative acyl-CoA thioester hydrolase	NA	NA	NA	NA	NA
AYV06346.1|3872389_3873271_-|integrase	integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	7.2e-162
AYV06347.1|3873371_3874528_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	2.0e-66
AYV06348.1|3874936_3875677_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
AYV06349.1|3875868_3878151_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.2	4.9e-162
AYV06350.1|3878205_3879063_-	formate transporter FocA	NA	NA	NA	NA	NA
AYV06351.1|3879469_3881230_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
AYV06352.1|3882184_3883273_+	3-phosphoserine/phosphohydroxythreonine aminotransferase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
AYV06353.1|3883343_3884627_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
AYV06354.1|3884770_3886099_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AYV06355.1|3886234_3886999_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYV06356.1|3887171_3887855_+	(d)CMP kinase	NA	NA	NA	NA	NA
AYV06357.1|3887965_3889639_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
AYV06358.1|3889798_3890083_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
AYV06359.1|3892585_3894334_+	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
AYV06360.1|3894330_3895317_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
AYV06361.1|3895353_3896586_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
AYV06362.1|3896637_3896820_+	protein YcaR	NA	NA	NA	NA	NA
AYV06363.1|3896816_3897563_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
AYV06364.1|3897716_3898610_+	hypothetical protein	NA	NA	NA	NA	NA
AYV06365.1|3898586_3899366_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
AYV06366.1|3899501_3900287_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
AYV06367.1|3900283_3901606_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
AYV06368.1|3901586_3902291_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
AYV06369.1|3902290_3906751_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
AYV06370.1|3906913_3908242_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AYV06371.1|3908449_3910297_+	L,D-transpeptidase	NA	NA	NA	NA	NA
AYV07210.1|3910477_3911026_+	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
AYV06372.1|3911052_3911700_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
AYV06373.1|3911922_3913113_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
AYV06374.1|3913297_3914386_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
AYV06375.1|3914986_3916387_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
AYV06376.1|3916555_3917758_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AYV06377.1|3918023_3920639_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	4.1e-19
AYV06378.1|3920845_3921613_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.6	4.1e-28
AYV06379.1|3922237_3923511_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
3926915:3927388	attR	CAGCGCTGGCTGTTTTACGCGTATGACAGGATACGGAGGACGGTTGTGGCGCACGTCTTCTGAGCCTGCTGTCGGCCTTTGAGGTCGTGGTATGGATGACGGATGGCTGGCCGCTGTATGAATCACGCCTGAAGGGAAAGCTGCACGTTATCAGCAAGCGTTACACTCAGCGCATTGAGCGACATAATCTGAATCTGAGACAACATCTGGCAAGGCTGGTACGGAAGTCACTGTCGTTCTCAAAATCGGTGGAGCTGCATGACAAGGCCATCGGGCATTATCTGAACATAAAACACTATCAGTAAGTTGGAGTCATTACCTTAATGGTAAAGTTATTGCTCCAGCTTGTACCCTGGTAGCTGCGACGAAAGATTCAGTAGTCACATTGCCAAATGTCAGCGCCACCAAGTTGCAAACTAATGGAGCAGTCTCTGGCGTTAAAACTGATGTACCAATTGCCTTAGAAGGCTGTGA	NA	NA	NA	NA
>prophage 15
CP033510	Shigella flexneri strain 2016AM-0877 chromosome, complete genome	4719160	3965828	4087815	4719160	tail,protease,integrase,transposase,holin	Acinetobacter_phage(14.29%)	113	4036556:4036615	4055057:4059049
AYV06415.1|3965828_3966416_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
AYV06416.1|3966412_3966811_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
AYV06417.1|3966807_3967665_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
AYV06418.1|3967798_3969343_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
AYV06419.1|3969354_3970491_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
AYV06420.1|3970502_3970595_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
AYV07213.1|3970674_3971973_+	phytase AppA	NA	NA	NA	NA	NA
AYV06421.1|3974273_3974720_-	protein tyrosine phosphatase	NA	NA	NA	NA	NA
AYV06422.1|3974707_3975847_-	polysaccharide export protein	NA	NA	NA	NA	NA
AYV06423.1|3975892_3977989_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
AYV06424.1|3977988_3978735_-	hypothetical protein	NA	NA	NA	NA	NA
AYV06425.1|3978731_3979376_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
AYV06426.1|3979482_3979788_-	hypothetical protein	NA	NA	NA	NA	NA
AYV06427.1|3980229_3980442_-	cold-shock protein CspH	NA	NA	NA	NA	NA
AYV06428.1|3981503_3981716_+	cold-shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	70.0	1.7e-21
AYV07214.1|3981726_3981915_+	cold-shock protein	NA	NA	NA	NA	NA
AYV06429.1|3981889_3982120_+	protein YmcE	NA	NA	NA	NA	NA
AYV06430.1|3982109_3982283_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
AYV06431.1|3982331_3983405_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
AYV06432.1|3986300_3987329_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
AYV06433.1|3987301_3987994_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	1.0e-17
AYV06434.1|3988080_3989253_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
AYV06435.1|3993258_3993564_-	chaperone modulatory protein CbpM	NA	NA	NA	NA	NA
AYV06436.1|3993563_3994484_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
AYV06437.1|3994744_3996001_+	YccE family protein	NA	NA	NA	NA	NA
AYV06438.1|3996293_3997535_+	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
AYV06439.1|3997572_3997800_-	hypothetical protein	NA	NA	NA	NA	NA
AYV06440.1|3997820_3998417_-	NAD(P)H dehydrogenase (quinone)	NA	NA	NA	NA	NA
AYV06441.1|3998789_3998897_+	hypothetical protein	NA	Q9KX95	Enterobacteria_phage	100.0	3.4e-10
AYV06442.1|3998978_4000307_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	3.4e-232
AYV06443.1|4000327_4000822_-	FMN reductase	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
AYV06444.1|4000832_4001423_-	nitroreductase family protein	NA	NA	NA	NA	NA
AYV06445.1|4001432_4002233_-	pyrimidine utilization protein D	NA	NA	NA	NA	NA
AYV06446.1|4002240_4002627_-	pyrimidine utilization protein C	NA	NA	NA	NA	NA
AYV07215.1|4002638_4003331_-	pyrimidine utilization protein B	NA	NA	NA	NA	NA
AYV07216.1|4003330_4004422_-	pyrimidine utilization protein A	NA	NA	NA	NA	NA
AYV07217.1|4004351_4004531_+	hypothetical protein	NA	NA	NA	NA	NA
AYV06447.1|4004709_4005348_+	transcriptional regulator	NA	NA	NA	NA	NA
AYV06448.1|4005641_4006829_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AYV06449.1|4006828_4007194_-|transposase	transposase	transposase	NA	NA	NA	NA
AYV06450.1|4008014_4009142_+	iron uptake system component EfeO	NA	NA	NA	NA	NA
AYV06451.1|4009147_4010413_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
AYV06452.1|4010884_4011808_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	75.7	1.0e-89
AYV06453.1|4011917_4013080_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
AYV06454.1|4013671_4014658_+	hypothetical protein	NA	NA	NA	NA	NA
AYV06455.1|4015024_4016242_+	DUF4102 domain-containing protein	NA	A0A1B0VMI6	Pseudomonas_phage	34.4	1.7e-44
AYV06456.1|4016411_4017941_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
AYV06457.1|4017912_4018200_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
AYV06458.1|4018300_4020136_+	hypothetical protein	NA	NA	NA	NA	NA
AYV06459.1|4021510_4022074_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
AYV06460.1|4022180_4022387_+	helicase	NA	NA	NA	NA	NA
AYV07218.1|4024124_4025633_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
AYV06461.1|4025941_4026313_+	hypothetical protein	NA	NA	NA	NA	NA
AYV06462.1|4027123_4027513_+|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	99.2	1.9e-61
AYV06463.1|4027563_4027782_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AYV06464.1|4027848_4029010_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	2.0e-50
AYV06465.1|4029290_4030568_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
AYV06466.1|4030527_4030686_-|holin	choline transporter	holin	NA	NA	NA	NA
AYV06467.1|4030630_4032628_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
AYV06468.1|4032781_4033921_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.5e-68
AYV06469.1|4034101_4035046_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
AYV06470.1|4035110_4036061_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
AYV06471.1|4036065_4036548_-	glycosyltransferase	NA	NA	NA	NA	NA
4036556:4036615	attL	GGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTC	NA	NA	NA	NA
AYV06472.1|4037755_4038424_+	putative tetracyline resistance transcriptional regulator TetC	NA	NA	NA	NA	NA
AYV06473.1|4038536_4039742_-	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
AYV06474.1|4039820_4040447_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AYV06475.1|4041294_4041486_-	hypothetical protein	NA	NA	NA	NA	NA
AYV06476.1|4041539_4042199_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
AYV06477.1|4042399_4042777_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYV06478.1|4042843_4045810_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AYV06479.1|4045812_4046373_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AYV07219.1|4046498_4046849_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
AYV06480.1|4047051_4048065_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYV07220.1|4048274_4049105_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
AYV06481.1|4049217_4050009_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
AYV06482.1|4050851_4051247_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
AYV06483.1|4051224_4051851_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
AYV06484.1|4051929_4053135_+	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
AYV06485.1|4053247_4053916_-	putative tetracyline resistance transcriptional regulator TetC	NA	NA	NA	NA	NA
AYV06486.1|4055097_4055547_+	hypothetical protein	NA	NA	NA	NA	NA
AYV06487.1|4055666_4055840_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
AYV06488.1|4055939_4056761_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.3	7.2e-47
AYV06489.1|4057102_4057576_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.5	1.9e-12
AYV06490.1|4057591_4058068_+	DNA repair protein RadC	NA	NA	NA	NA	NA
AYV06491.1|4058130_4058352_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	3.2e-10
AYV06492.1|4058514_4058889_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
AYV06493.1|4058935_4059310_+	toxin	NA	NA	NA	NA	NA
4055057:4059049	attR	GACAAAGTCATCGGGCATTATCTGAACATAAAACACTATCAATAAGTTGGAGTCATTACCTAAGTCCTGACACAAACGCCGCCACTGTAAATCAGACACTTAAATGCGACTCAAAAGCCCGGGCTGACCAGCCTGGTGCATGTCCAACAACGTACGAGTTATACGAAGGTGACGCTACCTACAGAGCTGCTATCGACAAAGCATTAAACCCTGTTGGGTTAAACGGAATGTTTGGGGAAGACGGCTATATGGATGGTCCTGATGGTGGTGCGTATCCTGTAAACATTAACGGAACGACCTGGGTAGAAGGTGGCGGTTGTAAAGCCCACGCCTGCGGCTGGGACTATATCGTAACACTCTATAACCCAAAAACGCATAAAGTCGTTGGTTACTATTACAACATCGACCCTGGTTACCTGATTTGGTTTGGTGAAACTGGCGTTCACGAATTCGCGTACCTGGTCAGGGACTACGTAAACAAAACAAATTAAAGGCGTAAGTTATGCGGTTCATCTTCGCGTTATTAATTTATTGATATCAAAAGTAAATACGGCTCTGCCATGATGACAGGGACTTATATTTTCAGGGAACCAAATACAGGTCTGGTTGTATGTCACGTTTATTGCCCGAAGTCCCTTTCTCACGCGAGCAGGCTGTTGTCATCACAACAGCTTACCGCAATGTGTTTATCGACGATGACCAGGGAACTCATTTCCGTCGGGTTATCCGCAACGCAGAGACTGACGCCGGAAGGTTCGCCAGTGACGGTCTTCTCAGACAATAAACCTCATTAATTTCGTCCATCAGGCCGCGTCTTCTCCGGGAGACGTGGCTTTTTCATTTATTACACCAGTAAATCTTAACCACCGATAAGGAGCAAATTATGCGACTAGCCAGTCGTTTTGGTTATGCTGCAAACCAGATACGCCGTGACCGTCCGCTGACACACGAAGAACTGATGCACTATGTTCCCAGTATTTTCGGTGAAGACCGGCATACTTCCCGCAGTAAACGCTATGCGTACACTCCCACCATCACCGTACTGGAAAGCCTGCAGCGGGAAGGCTTTCAGCCATTCTTCGCCTGCCAGACACGTGTGCGTGACCCGGGTCGCCGGGAATACACAAAACACATGCTGCGTCTGCGGCGGGCCGGACAGATAACCGGTCAGCATGTCCCTGAAATTATTCTACTCAACTCTCATGACGGTTCATCCAGCTACCAGATGTTACCCGGATATTTTCGTGCCATTTGTACCAATGGACTGGTCTGCGGTCAGTCTCTGGGAGAATTGCGTGTTCCACACCGGGGAAATGTGGTGGAGAAAGTTATTGAAGGGGCTTACGAGGTGGTGGGCGTGTTTGACCGGATAGAGGAGAAGCGTGATGCCATGCAGTCGCTGGTCCTGCCGCCACCGGCACGCCAGGCGCTGGCACAGGCGGCACTGACTTACCGTTATGGTGACGAACATCAGCCAGTCACCACCGCTGACATTCTGACACCACGACGCAGGGAGGATTACGGTAAAGACCTGTGGAGCGCATATCAGACCATCCAGGAGAATATGCTGAAAGGCGGGATTTCCGGCCGCAGTGCAAAAGGAAAACGTATCCACACCCGTGCCATTCACAACATCGACACCGATATTAAGCTCAACCGCGCATTGTGGGTAATGGCAGAAACGCTGCTGGAGAGCCTGCGCTGAGGCAGCATGTCCCTGAAGGCGTGATTCAGGCACCAGAATCACCCGACGCCCCGGAGGCGCTGCCGGGGTGTCGTTCCATTTCTGATGATGACCTGTGCGCCTGGTGTACCCGTCTGCTTTACCGTCCCGGAGAAATCAGTCTGTGCAGACTGAGTATACAGGCAATGGCATCTGGCCATCCGTCTGTGACCGGAACGGTTACGCGTACGGCTGTCCGGAATTTCAGCCGAATATCATTCATCCCTGATATTACCGGGTCATCACGGTCAGTGATGAACGTGATGTTGCCAGCTCCCGACCTTTACTCCCTCTCATTTATTCACATTACAAGGATTTCATACATGAAAACATTGTCTCAGAACACCACCGCTTCGGCCTGTGCACCGGAGACTGGCCTGCAACAACTGGTTGCCACTCCCGTCCCTGATGAACAGCGCATCAGCTTCTGGCCGCAGCATTTTGGCCTCATTCCACAGTGGGTCACCCTGGAACCCCGTGTCTTCGGCTGGATGGACCGTCTGTGTGAAGACTACTGCGGTGGTATCTGGAATCTGTACACCCTGAACAACGGCGGGGCATTTATGGCACCCGAACCGGATGACGATGATGACGAAACATGGGTACTGTTCAATGCCATGAACGGTAACCGCGCTGAAATGAGCCCGGAAGCCGCCGGCATTGCTGCCTGTCTGATGACGTACAGTCATCATGCCTGTCGTACGGAGTGTTATGCCATGACGGTCCATTATTACCGGCTGCGGGATTACGCCCTGCAGCATCCGGAATGCAGCGCCATTATGCGCATCATCGACTGAATGGAGGCAGGGACAATGCAGCAGCTTTCCTTTCTGCCCGGAAACATGACGCCCGGCGAGCGCAGTCTCATTCTGCGGGCCCTGCAAACCCTGGACCGCCATCTTCATGAACCCGGCGTGGCCTTCACCTCCACCCGTGCGGCACGGGAATGGCTGATTCTGAACATGGCGGGACTGGAGCGGGAAGAGTTCCGGGTGCTGTATCTGAACAACCAGAATCAGCTGATTGCCGGTGAAACCCTCTTCACCGGCACCATCAACCGTACGGAAGTTCATCCCCGGGAAGTGATTAAACGCGCCCTGTACCACAATGCCGCTGCCGTGGTGCTGGCGCACAATCACCCGTCCGGTGAAGTCACACCCAGTAAGGCAGACCGGCTTATCACCGAACGTCTGGTACAGGCACTGGGCCTGGTGGATATCCGGGTGCCGGACCATCTGATAGTCGGTGGCAACCAGGTTTTCTCCTTTGCCGAACATGGTCTGCTTTAACCCGTCACAACCACATCACACCTGTTTTCACTTTTATCTTCTGTCTTCAGAGGTATCACATCATGAGAATCATCACCCGTGGTGAAGCCATGCGTATTCACCAACAGCATCCTGCATCCCGTCTTTTTCCGTTCTGTACCGGTAAGTATCGCTGGCACGGCAGTGCTGAAGCGTATACTGGTCGTGAAGTGCAGGATATTCCCGGCGTTCTTGCCGTGTTTGCAGAACGCCGTAAGGACAGTTTTGGCCCGTATGTCCGGCTGATGAGTGTCACCCTGAACTGATGTTCCGTCACCCGGGAAACGAGTACGACCAGATGACCTCAGACGCCGCTGTGGATGAGGCCATTCTCATCAATGCATACATCTTCACCGAAACCGGTCAGCGCGCCGGCTGACCTGTCATCGTTAAACCATTCTTAACCACTTTTCAGAGAGGATTTTATCGTGTCAGACAAACTCTCCGGGATAACTCATCCCGATGACAATCACGACCGCCCCTGGTGGGGGCTTCCCTGCACAGTGAGGCCCTGTTTTGGCGCTCGTCTGGTGCAAGAGGGTAACCGCCTGTATTACCTTGCCGACCGCGCCGGTATCAGAGGCCGCTTCAGCGACGCAGATGCATACCATCTGGACCAGGCCTTTCCGCTGCTGATGAAACAACTGGAACTCATGCTCACCAGCGGTGAACTGAATCCCCGATATCAGCATACCGTCACGCTGTATGCAAAAGGGCTGACCTGCGAAGCCGACACCCTCGGCTCCTGTGGTTACGTTTATCTGGCTGTTTATCCGACACCAGCACCCGCAACCACCTCATAACCCCGAAGCTCTCACCTTTAGCACTACCAGTTACAGAGAACTTAAGATGAAAACATTATCCGACACACATGTACGGGAGGTATCTCGCTGCCCGTCTCCCGTCACCATCTGGCAGACACTGCTCATCCGACTGCTGGACCAGCATTATGGCCTCACACTG	NA	NA	NA	NA
AYV06494.1|4059306_4059798_+	hypothetical protein	NA	NA	NA	NA	NA
AYV06495.1|4059809_4060007_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
AYV07221.1|4060091_4060655_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
AYV06496.1|4060723_4061728_+|transposase	IS110-like element ISSfl8 family transposase	transposase	NA	NA	NA	NA
AYV06497.1|4063755_4064493_+	phosphatase	NA	NA	NA	NA	NA
AYV06498.1|4064516_4065071_+	molecular chaperone	NA	NA	NA	NA	NA
AYV06499.1|4065172_4065664_+	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
AYV06500.1|4066529_4066946_-	curli production assembly/transport component CsgF	NA	NA	NA	NA	NA
AYV06501.1|4066970_4067360_-	curli production assembly/transport protein CsgE	NA	NA	NA	NA	NA
AYV06502.1|4067364_4068015_-	transcriptional regulator CsgD	NA	NA	NA	NA	NA
AYV06503.1|4068768_4069224_+	curlin minor subunit CsgB	NA	NA	NA	NA	NA
AYV06504.1|4070499_4070865_+	major curlin subunit CsgA	NA	NA	NA	NA	NA
AYV06505.1|4071076_4072245_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
AYV06506.1|4072628_4072940_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
AYV06507.1|4073034_4073568_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	7.8e-26
AYV06508.1|4073509_4074991_+	phospholipase D family protein	NA	NA	NA	NA	NA
AYV06509.1|4074998_4076156_-	glucans biosynthesis protein MdoC	NA	NA	NA	NA	NA
AYV07222.1|4076549_4078085_+	glucans biosynthesis protein MdoG	NA	NA	NA	NA	NA
AYV06510.1|4078077_4080621_+	glucan biosynthesis protein H	NA	NA	NA	NA	NA
AYV06511.1|4081036_4082224_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AYV06512.1|4082223_4082589_-|transposase	transposase	transposase	NA	NA	NA	NA
AYV06513.1|4082607_4083588_+|tail	phage tail tape measure protein	tail	A0A0H3UDV5	Escherichia_phage	34.5	6.2e-45
AYV06514.1|4083562_4084731_-|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	100.0	1.8e-184
AYV06515.1|4084800_4085046_-	resolvase	NA	NA	NA	NA	NA
AYV06516.1|4085012_4085201_-	hypothetical protein	NA	NA	NA	NA	NA
AYV06517.1|4086659_4087815_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
>prophage 16
CP033510	Shigella flexneri strain 2016AM-0877 chromosome, complete genome	4719160	4164381	4173717	4719160	head,tail,protease,terminase,portal	uncultured_Caudovirales_phage(87.5%)	12	NA	NA
AYV06594.1|4164381_4166130_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	39.5	7.3e-89
AYV06595.1|4166418_4166697_+	hypothetical protein	NA	NA	NA	NA	NA
AYV06596.1|4166693_4166999_+	hypothetical protein	NA	NA	NA	NA	NA
AYV06597.1|4167008_4167170_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
AYV06598.1|4168670_4169243_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.6e-61
AYV07224.1|4169280_4170456_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.2	5.8e-183
AYV06599.1|4170452_4170791_+|head,tail	head-tail adaptor protein	head,tail	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.7e-31
AYV06600.1|4170787_4171084_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	62.2	2.2e-30
AYV06601.1|4171083_4171524_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
AYV06602.1|4171507_4171690_+	hypothetical protein	NA	NA	NA	NA	NA
AYV07225.1|4171745_4172072_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	79.6	9.2e-46
AYV06603.1|4172055_4173717_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.4	4.4e-277
>prophage 17
CP033510	Shigella flexneri strain 2016AM-0877 chromosome, complete genome	4719160	4369359	4451058	4719160	tail,protease,integrase,transposase,tRNA	Escherichia_phage(46.15%)	76	4387976:4388035	4411954:4412015
AYV06764.1|4369359_4370556_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AYV06765.1|4370931_4371852_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
AYV06766.1|4372468_4373625_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.9e-67
AYV06767.1|4374152_4375426_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	3.4e-176
AYV06768.1|4375583_4376213_+	hypothetical protein	NA	I6PDJ3	Cronobacter_phage	50.0	3.3e-15
AYV06769.1|4376219_4376966_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	89.2	2.1e-122
AYV06770.1|4376980_4377403_+	DUF977 family protein	NA	A0A2I6TCA7	Escherichia_phage	75.9	1.1e-51
AYV06771.1|4377403_4377817_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	97.5	4.6e-58
AYV06772.1|4377909_4378128_+	DUF4014 domain-containing protein	NA	A0A1I9LJM2	Stx_converting_phage	90.3	1.2e-28
AYV06773.1|4378129_4378495_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	98.3	2.1e-67
AYV06774.1|4378491_4379157_+	hypothetical protein	NA	A0A076G611	Escherichia_phage	44.9	6.1e-36
AYV06775.1|4379156_4379522_+	DUF551 domain-containing protein	NA	Q08J61	Stx2-converting_phage	53.7	6.1e-30
AYV06776.1|4379919_4380132_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
AYV06777.1|4380368_4380620_+	hypothetical protein	NA	NA	NA	NA	NA
AYV06778.1|4381468_4382068_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	94.5	1.4e-108
AYV06779.1|4382067_4382358_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	89.6	3.3e-47
AYV06780.1|4382354_4382909_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.5	3.7e-71
AYV06781.1|4383049_4383235_+	hypothetical protein	NA	A0A291AWU3	Escherichia_phage	63.4	1.5e-05
AYV06782.1|4383296_4384436_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	8.7e-67
AYV07238.1|4384428_4384989_+	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	73.6	1.9e-43
AYV06783.1|4385622_4387227_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
4387976:4388035	attL	TTGAAGTGGCACACTGAATTTGGCCACCTGAACAGAGGTGATATGCTCACCTCAGAACAA	NA	NA	NA	NA
AYV07239.1|4389409_4390918_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
AYV06784.1|4391886_4392069_+	hypothetical protein	NA	NA	NA	NA	NA
AYV06785.1|4393743_4394112_+	hypothetical protein	NA	A0A0C4UQV0	Shigella_phage	55.4	2.6e-20
AYV06786.1|4394135_4394288_+|tail	phage tail protein	tail	A0A222YXY8	Escherichia_phage	68.0	1.1e-14
AYV06787.1|4394308_4394680_+|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	82.9	2.6e-52
AYV06788.1|4394703_4395972_+|tail	phage tail protein	tail	Q8W611	Enterobacteria_phage	43.0	2.2e-74
AYV06789.1|4395922_4396546_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	78.6	5.8e-81
AYV06790.1|4396746_4397604_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AYV06791.1|4397600_4398458_-	metal ABC transporter permease	NA	NA	NA	NA	NA
AYV06792.1|4398454_4399282_-	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	3.8e-11
AYV06793.1|4399281_4400196_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
AYV06794.1|4400627_4401281_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.1	5.1e-120
AYV06795.1|4402208_4402376_-	DNA-binding protein	NA	A0A0U2RY08	Escherichia_phage	100.0	1.3e-27
AYV06796.1|4403707_4404805_-	hypothetical protein	NA	I6PCV5	Cronobacter_phage	83.8	1.3e-181
AYV06797.1|4404810_4405131_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	83.3	2.5e-40
AYV06798.1|4407897_4408173_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	93.4	4.4e-41
AYV07240.1|4408247_4408418_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	92.9	7.9e-25
AYV06799.1|4408417_4408639_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	95.9	9.0e-37
AYV06800.1|4408715_4409989_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	3.4e-176
AYV06801.1|4411444_4411741_-	hypothetical protein	NA	NA	NA	NA	NA
AYV07241.1|4412097_4412709_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
4411954:4412015	attR	TTGAAGTGGCACACTGAATTTGGCCACCTGAACAGAGGTGATATGCTCACCTCAGAACAACA	NA	NA	NA	NA
AYV06802.1|4412597_4413221_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	75.9	2.7e-78
AYV06803.1|4413220_4413400_+	hypothetical protein	NA	NA	NA	NA	NA
AYV06804.1|4413400_4415107_-	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
AYV06805.1|4417145_4418301_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	4.4e-66
AYV07242.1|4418558_4418750_-	DUF1482 family protein	NA	NA	NA	NA	NA
AYV06806.1|4418854_4419091_-	DUF1480 family protein	NA	NA	NA	NA	NA
AYV06807.1|4423316_4424600_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
AYV06808.1|4424729_4425227_+	GAF domain-containing protein	NA	NA	NA	NA	NA
AYV06809.1|4425323_4426022_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
AYV06810.1|4426041_4428090_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.2e-85
AYV06811.1|4428281_4429163_+|protease	protease HtpX	protease	NA	NA	NA	NA
AYV06812.1|4429208_4430582_-	MFS transporter	NA	NA	NA	NA	NA
AYV06813.1|4430758_4431550_+	transcriptional regulator KdgR	NA	NA	NA	NA	NA
AYV06814.1|4431692_4431932_-	hypothetical protein	NA	NA	NA	NA	NA
AYV06815.1|4432090_4432234_+	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
AYV06816.1|4432308_4432596_+	hypothetical protein	NA	NA	NA	NA	NA
AYV06817.1|4433266_4433410_+	DUF2627 domain-containing protein	NA	NA	NA	NA	NA
AYV06818.1|4433422_4433632_+	cold-shock protein CspC	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
AYV06819.1|4433797_4434607_+	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
AYV06820.1|4434603_4435170_-	manganese efflux pump MntP	NA	NA	NA	NA	NA
AYV06821.1|4436358_4436835_-	DUF986 domain-containing protein	NA	NA	NA	NA	NA
AYV06822.1|4436889_4437741_-	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
AYV06823.1|4437753_4438554_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
AYV06824.1|4438616_4439588_-	PTS mannose transporter subunit EIIAB	NA	NA	NA	NA	NA
AYV06825.1|4440050_4441601_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
AYV06826.1|4441604_4443203_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
AYV06827.1|4443333_4444698_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
AYV06828.1|4444881_4445460_-	coenzyme A pyrophosphatase	NA	NA	NA	NA	NA
AYV06829.1|4445463_4446825_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	41.7	6.4e-40
AYV06830.1|4446898_4447078_+	YoaH family protein	NA	NA	NA	NA	NA
AYV06831.1|4447197_4447557_-	DUF1889 family protein	NA	NA	NA	NA	NA
AYV06832.1|4447918_4448263_-	RidA family protein	NA	NA	NA	NA	NA
AYV06833.1|4448394_4450305_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.7	3.8e-91
AYV06834.1|4450362_4451058_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 18
CP033510	Shigella flexneri strain 2016AM-0877 chromosome, complete genome	4719160	4560213	4605500	4719160	transposase,holin	Shigella_phage(22.22%)	48	NA	NA
AYV06924.1|4560213_4560393_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	91.5	4.1e-24
AYV06925.1|4560700_4560889_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
AYV06926.1|4561148_4561484_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
AYV06927.1|4561931_4562258_-	hypothetical protein	NA	NA	NA	NA	NA
AYV06928.1|4562793_4563615_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	6.1e-78
AYV06929.1|4563629_4563986_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	6.1e-35
AYV06930.1|4563998_4565048_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	3.2e-108
AYV06931.1|4565394_4565646_-	hypothetical protein	NA	NA	NA	NA	NA
AYV06932.1|4565863_4566019_-	protein HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
AYV06933.1|4566090_4566378_-	mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
AYV06934.1|4566377_4566617_-	antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
AYV06935.1|4566641_4566947_+	hypothetical protein	NA	NA	NA	NA	NA
AYV06936.1|4566943_4568100_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	2.0e-66
AYV06937.1|4569269_4570730_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.1e-42
AYV06938.1|4570765_4570969_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
AYV06939.1|4571146_4571833_-	transcriptional regulator	NA	NA	NA	NA	NA
AYV06940.1|4571921_4572668_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
AYV06941.1|4572804_4574850_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
AYV06942.1|4574894_4575413_-	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
AYV06943.1|4575978_4577134_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	5.2e-67
AYV06944.1|4577382_4577478_-	hypothetical protein	NA	NA	NA	NA	NA
AYV06945.1|4577604_4578723_-	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
AYV06946.1|4578986_4579886_+	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
AYV06947.1|4579916_4580135_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
AYV06948.1|4580166_4580550_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
AYV06949.1|4580569_4581004_-	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
AYV06950.1|4581211_4581877_+	NAAT family transporter MarC	NA	NA	NA	NA	NA
AYV06951.1|4581901_4583092_-	sugar efflux transporter	NA	NA	NA	NA	NA
AYV06952.1|4583241_4584357_-	putative protein YneK	NA	NA	NA	NA	NA
AYV06953.1|4584436_4585372_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
AYV06954.1|4585435_4586362_+	glutaminase 2	NA	NA	NA	NA	NA
AYV06955.1|4586361_4586706_+	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
AYV06956.1|4586859_4588278_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.5	1.1e-18
AYV06957.1|4588504_4589956_+	altronate oxidoreductase	NA	NA	NA	NA	NA
AYV06958.1|4590252_4591451_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AYV06959.1|4591460_4591649_-	hypothetical protein	NA	NA	NA	NA	NA
AYV06960.1|4591663_4591867_-	hypothetical protein	NA	NA	NA	NA	NA
AYV06961.1|4591849_4592764_+	hypothetical protein	NA	NA	NA	NA	NA
AYV06962.1|4592767_4593526_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
AYV06963.1|4593565_4593856_-	autoinducer 2-degrading protein LsrG	NA	NA	NA	NA	NA
AYV06964.1|4593879_4594650_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
AYV06965.1|4594674_4595948_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
AYV06966.1|4597152_4598145_-	autoinducer 2 import system permease LsrD	NA	NA	NA	NA	NA
AYV06967.1|4598144_4599173_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
AYV06968.1|4599166_4600702_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	9.8e-21
AYV06969.1|4600950_4601904_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
AYV06970.1|4601982_4602885_+	carbohydrate kinase	NA	NA	NA	NA	NA
AYV06971.1|4604352_4605500_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
>prophage 1
CP033511	Shigella flexneri strain 2016AM-0877 plasmid p2016AM-0877, complete sequence	222142	0	143674	222142	protease,transposase,integrase,tRNA	Stx2-converting_phage(30.43%)	121	4688:4747	153002:153301
AYV07255.1|3263_4460_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AYV07256.1|4651_5656_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	97.8	2.0e-184
4688:4747	attL	GGGGTTGTCGAAGCTCACCAGATTTTCACCAGGATGCACGTCATACTCTTTTTTCTCCGG	NA	NA	NA	NA
AYV07257.1|5894_6095_+	hypothetical protein	NA	NA	NA	NA	NA
AYV07258.1|7008_7788_+|protease	cysteine protease	protease	NA	NA	NA	NA
AYV07259.1|8734_9664_-	Virulence regulon transcriptional activator VirB	NA	Q1MVJ4	Enterobacteria_phage	42.6	1.4e-51
AYV07260.1|9880_10117_-	acyl carrier protein	NA	NA	NA	NA	NA
AYV07261.1|10120_12022_-	invasin	NA	NA	NA	NA	NA
AYV07262.1|12030_13029_-	type III secretion system needle tip complex protein IpaD	NA	NA	NA	NA	NA
AYV07263.1|13079_14171_-	IpaC/SipC family type III secretion system effector	NA	NA	NA	NA	NA
AYV07264.1|14190_15933_-	type III secretion system needle tip complex protein SipB	NA	NA	NA	NA	NA
AYV07265.1|15938_16406_-	type III secretion system translocator chaperone SicA	NA	NA	NA	NA	NA
AYV07266.1|16462_17089_-	protein IpgB	NA	NA	NA	NA	NA
AYV07267.1|17104_17494_-	chaperone protein IpgA	NA	NA	NA	NA	NA
AYV07268.1|17506_18991_-	virulence factor	NA	NA	NA	NA	NA
AYV07418.1|18974_19169_-	hypothetical protein	NA	NA	NA	NA	NA
AYV07269.1|19304_20921_+	type III secretion system effector inositol phosphate phosphatase	NA	NA	NA	NA	NA
AYV07270.1|20930_21293_+	type III secretion system chaperone	NA	NA	NA	NA	NA
AYV07271.1|21292_21751_+	invasion protein IagB	NA	NA	NA	NA	NA
AYV07272.1|21759_22875_+	protein mxiG	NA	NA	NA	NA	NA
AYV07273.1|22882_23134_+	type III secretion system needle complex protein	NA	NA	NA	NA	NA
AYV07274.1|23146_23440_+	protein MxiI	NA	NA	NA	NA	NA
AYV07275.1|23445_24171_+	EscJ/YscJ/HrcJ family type III secretion inner membrane ring protein	NA	NA	NA	NA	NA
AYV07276.1|24167_24695_+	type III secretion apparatus protein OrgA/MxiK	NA	NA	NA	NA	NA
AYV07277.1|24636_25332_+	MxiN	NA	NA	NA	NA	NA
AYV07278.1|25324_25732_+	Mxi-Spa secretion machinery protein MxiL	NA	NA	NA	NA	NA
AYV07279.1|25715_26144_+	lipoprotein MxiM	NA	NA	NA	NA	NA
AYV07280.1|26273_26906_+	transcriptional regulator MxiE	NA	NA	NA	NA	NA
AYV07281.1|26892_28593_+	EscC/YscC/HrcC family type III secretion system outer membrane ring protein	NA	NA	NA	NA	NA
AYV07282.1|28611_29679_+	YopN family type III secretion system gatekeeper subunit	NA	NA	NA	NA	NA
AYV07283.1|29691_31752_+	EscV/YscV/HrcV family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
AYV07284.1|31764_32166_+	surface presentation of antigens protein SpaK	NA	NA	NA	NA	NA
AYV07285.1|32169_33462_+	FliI/YscN family ATPase	NA	NA	NA	NA	NA
AYV07419.1|33554_33893_+	surface presentation of antigens protein SpaM	NA	NA	NA	NA	NA
AYV07286.1|33879_34758_+	surface presentation of antigens protein SpaN	NA	NA	NA	NA	NA
AYV07287.1|34751_35633_+	hypothetical protein	NA	NA	NA	NA	NA
AYV07288.1|35637_36288_+	EscR/YscR/HrcR family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
AYV07289.1|36302_36563_+	EscS/YscS/HrcS family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
AYV07290.1|36562_37333_+	EscT/YscT/HrcT family type III secretion system export apparatus protein	NA	NA	NA	NA	NA
AYV07291.1|37339_38368_+	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
AYV07292.1|38380_38623_+	hypothetical protein	NA	NA	NA	NA	NA
AYV07293.1|39199_40263_-|transposase	IS3-like element ISSfl11 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.6	3.1e-58
AYV07294.1|40727_40916_+	hypothetical protein	NA	NA	NA	NA	NA
AYV07295.1|40925_42123_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AYV07420.1|42861_43266_-	hypothetical protein	NA	NA	NA	NA	NA
AYV07296.1|48101_48524_-|transposase	transposase	transposase	NA	NA	NA	NA
AYV07297.1|49186_49426_-	reverse transcriptase	NA	NA	NA	NA	NA
AYV07298.1|50854_52057_-|protease	cysteine protease	protease	NA	NA	NA	NA
AYV07299.1|52585_55894_+	outer membrane protein IcsA autotransporter	NA	A0A2L1IV18	Escherichia_phage	28.7	1.5e-74
AYV07300.1|58078_59731_+	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
AYV07301.1|62028_62778_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
AYV07302.1|62947_63792_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	49.1	2.2e-22
AYV07303.1|63837_64212_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
AYV07304.1|64400_64796_-	plasmid stabilization protein	NA	NA	NA	NA	NA
AYV07305.1|64795_65755_-	plasmid stabilization protein	NA	A0A222YXF2	Escherichia_phage	40.9	1.4e-62
AYV07421.1|66194_67097_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
AYV07306.1|67468_68152_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	2.3e-30
AYV07307.1|68152_68374_+	hypothetical protein	NA	NA	NA	NA	NA
AYV07308.1|68864_69635_+	hypothetical protein	NA	NA	NA	NA	NA
AYV07309.1|71804_72961_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	5.2e-67
AYV07310.1|73566_73917_-|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	68.7	3.5e-27
AYV07311.1|73913_74588_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.1	5.8e-10
AYV07422.1|75823_76054_+	hypothetical protein	NA	NA	NA	NA	NA
AYV07312.1|76480_77699_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	97.9	8.6e-137
AYV07313.1|77647_78322_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.0e-10
AYV07314.1|78318_78669_+|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	68.7	3.5e-27
AYV07315.1|78665_80267_+|transposase	IS66-like element ISSfl3 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	61.6	1.1e-147
AYV07423.1|80740_80920_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
AYV07316.1|80999_81251_-	transporter	NA	NA	NA	NA	NA
AYV07317.1|81372_81495_-	replication protein RepA4	NA	NA	NA	NA	NA
AYV07318.1|81702_81987_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
AYV07319.1|81986_82262_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
AYV07320.1|82314_82494_+	hypothetical protein	NA	NA	NA	NA	NA
AYV07321.1|84729_84948_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
AYV07322.1|84949_85255_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
AYV07323.1|85242_85386_+|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
AYV07324.1|85647_87285_+	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
AYV07325.1|88013_88604_+	protein kinase OspG	NA	NA	NA	NA	NA
AYV07424.1|89008_89251_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AYV07326.1|89307_90609_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AYV07327.1|91955_92198_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AYV07425.1|92501_95351_-	hypothetical protein	NA	NA	NA	NA	NA
AYV07328.1|95416_95533_+|integrase	integrase	integrase	NA	NA	NA	NA
AYV07426.1|95917_96739_+	carbohydrate transporter	NA	NA	NA	NA	NA
AYV07329.1|96741_97830_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
AYV07330.1|97834_98785_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
AYV07331.1|98849_99794_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
AYV07332.1|99947_100904_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
AYV07333.1|100915_102072_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	1.2e-66
AYV07334.1|102110_102296_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
AYV07335.1|102304_102703_-|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
AYV07336.1|102702_102933_-	antitoxin	NA	NA	NA	NA	NA
AYV07337.1|102990_103383_+	conjugative relaxase	NA	NA	NA	NA	NA
AYV07338.1|108284_109031_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	32.0	5.4e-09
AYV07427.1|109085_109646_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
AYV07339.1|109776_109989_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
AYV07340.1|110515_111672_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	3.4e-66
AYV07341.1|112006_112216_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
AYV07342.1|112254_112845_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
AYV07343.1|113084_113345_+	replication regulatory protein repA2	NA	NA	NA	NA	NA
AYV07344.1|113396_113522_-	replication protein RepA	NA	NA	NA	NA	NA
AYV07428.1|113568_113643_+	positive regulator of RepFIC repA1 expression	NA	NA	NA	NA	NA
AYV07345.1|113635_114493_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
AYV07346.1|115193_115385_+	hypothetical protein	NA	NA	NA	NA	NA
AYV07347.1|115614_116810_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AYV07348.1|116819_117008_-	hypothetical protein	NA	NA	NA	NA	NA
AYV07349.1|117338_119066_-	E3 ubiquitin--protein ligase	NA	NA	NA	NA	NA
AYV07350.1|119455_119722_-	hypothetical protein	NA	NA	NA	NA	NA
AYV07351.1|122566_123839_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
AYV07352.1|125249_125387_-	non-LEE-encoded type III effector F	NA	NA	NA	NA	NA
AYV07429.1|126348_127296_+|protease	omptin family outer membrane protease IcsP	protease	NA	NA	NA	NA
AYV07430.1|129025_129709_+	OspB	NA	A0A0P0ZCT1	Stx2-converting_phage	34.2	5.8e-26
AYV07353.1|130037_130778_+	phosphatase PAP2 family protein	NA	A0A1B1IUP6	uncultured_Mediterranean_phage	28.4	7.5e-11
AYV07354.1|130878_131061_-	hypothetical protein	NA	A0A0N7C1Y0	Escherichia_phage	86.0	5.5e-16
AYV07355.1|133411_133762_-	hypothetical protein	NA	A0A0P0I4A4	Acinetobacter_phage	37.0	2.8e-08
AYV07356.1|135101_136811_-	ShET2/EspL2 family type III secretion system effector toxin	NA	NA	NA	NA	NA
AYV07357.1|137242_137962_-	type III secretion system effector phosphothreonine lyase	NA	NA	NA	NA	NA
AYV07358.1|138993_139572_-	hypothetical protein	NA	NA	NA	NA	NA
AYV07359.1|140893_141142_-|transposase	transposase	transposase	NA	NA	NA	NA
AYV07360.1|141241_141526_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
AYV07361.1|141536_142865_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
AYV07362.1|143326_143674_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZDM8	Stx2-converting_phage	74.8	9.8e-46
153002:153301	attR	CCGGAGAAAAAAGAGTATGACGTGCATCCTGGTGAAAATCTGGTGAGCTTCGACAACCCCCCCCAGCATCATCCACTCTCCATCTACGACTCATTCTGCAGAGGAGTGGCGTGATGATGGAACTGCAACATCAACGACTGATGGCGCTCGCCGGGCAGTTGCAACTGGAAAGCCTTATAAGCGCAGCGCCTGCGCTGTCACAACAGGCAGTAGACCAGGAATGGAGTTATATGGACTTCCTGGAGCATCTGCTTCATGAAGAAAAACTGGCACGTCATCAACGTAAACAGGCGATGTATA	NA	NA	NA	NA
>prophage 2
CP033511	Shigella flexneri strain 2016AM-0877 plasmid p2016AM-0877, complete sequence	222142	151485	159008	222142	transposase	Escherichia_phage(50.0%)	6	NA	NA
AYV07368.1|151485_152679_-|transposase	IS4-like element ISSfl1 family transposase	transposase	S5FM71	Shigella_phage	62.5	2.0e-138
AYV07369.1|153111_153894_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	98.8	8.5e-138
AYV07370.1|154276_154483_+	hypothetical protein	NA	A0A0P0ZEB3	Stx2-converting_phage	57.1	1.0e-05
AYV07371.1|154620_155820_+	ParA family protein	NA	Q71TL9	Escherichia_phage	75.1	2.0e-175
AYV07372.1|155819_156800_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	58.2	5.0e-95
AYV07373.1|157829_159008_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.4	2.6e-29
>prophage 3
CP033511	Shigella flexneri strain 2016AM-0877 plasmid p2016AM-0877, complete sequence	222142	163761	164172	222142	transposase	Escherichia_phage(100.0%)	1	NA	NA
AYV07376.1|163761_164172_+|transposase	transposase	transposase	A0A2L1IVB6	Escherichia_phage	98.1	5.7e-53
>prophage 4
CP033511	Shigella flexneri strain 2016AM-0877 plasmid p2016AM-0877, complete sequence	222142	179102	187372	222142	protease,transposase	Stx2-converting_phage(33.33%)	6	NA	NA
AYV07388.1|179102_179591_+	hypothetical protein	NA	A0A0P0ZEB3	Stx2-converting_phage	65.4	1.9e-47
AYV07389.1|180405_184500_-|protease	serine protease autotransporter toxin SepA	protease	Q9LA58	Enterobacterial_phage	42.3	1.2e-280
AYV07390.1|184549_184813_+	hypothetical protein	NA	NA	NA	NA	NA
AYV07391.1|184901_185090_+	hypothetical protein	NA	NA	NA	NA	NA
AYV07392.1|185099_186297_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
AYV07393.1|186673_187372_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.1	7.3e-125
>prophage 5
CP033511	Shigella flexneri strain 2016AM-0877 plasmid p2016AM-0877, complete sequence	222142	207674	219716	222142	transposase	Stx2-converting_phage(42.86%)	12	NA	NA
AYV07404.1|207674_208540_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	47.7	6.7e-19
AYV07405.1|208628_209102_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
AYV07406.1|209352_210549_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
AYV07407.1|211195_211834_-	transcriptional regulator	NA	A0A0F7L444	uncultured_marine_virus	50.0	1.2e-52
AYV07408.1|211999_213273_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.7	1.5e-176
AYV07409.1|213342_214499_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.7	5.2e-67
AYV07410.1|215019_215505_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
AYV07411.1|215492_215777_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
AYV07412.1|216846_216981_-	arylsulfatase	NA	NA	NA	NA	NA
AYV07413.1|217096_218698_-|transposase	IS66-like element ISSfl3 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	61.6	1.2e-146
AYV07414.1|218694_219045_-|transposase	transposase	transposase	A0A0P0ZDM8	Stx2-converting_phage	68.7	3.5e-27
AYV07415.1|219041_219716_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.8	2.0e-10
