The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029646	Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 chromosome, complete genome	4782348	930130	937442	4782348	protease,integrase	Dickeya_phage(16.67%)	6	931381:931395	942560:942574
AYU85171.1|930130_931249_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYU85172.1|931245_933192_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931381:931395	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYU85173.1|933321_933543_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYU85174.1|933866_934187_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYU85175.1|934217_936494_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYU85176.1|937064_937442_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942560:942574	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029646	Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 chromosome, complete genome	4782348	1008384	1085685	4782348	tail,terminase,protease,transposase,integrase	Salmonella_phage(73.33%)	93	990450:990469	1061057:1061076
990450:990469	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYU85225.1|1008384_1009725_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYU85226.1|1009721_1009970_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYU85227.1|1010010_1010256_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYU85228.1|1010255_1011137_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYU85229.1|1011133_1012198_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYU85230.1|1012275_1012956_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYU85231.1|1012952_1013738_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYU85232.1|1013743_1014040_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYU85233.1|1014130_1014331_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYU85234.1|1014619_1015024_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYU85235.1|1015355_1015730_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYU85236.1|1015814_1016798_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYU85237.1|1016800_1017550_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYU85238.1|1017560_1017908_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYU85239.1|1017904_1018429_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYU85240.1|1018428_1018902_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYU85241.1|1018905_1019478_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYU85242.1|1019571_1019838_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYU85243.1|1019919_1020081_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU85244.1|1020513_1021011_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU85245.1|1021195_1021435_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYU85246.1|1021424_1021730_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYU85247.1|1021769_1022372_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYU85248.1|1022580_1023192_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYU85249.1|1023324_1024122_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYU85250.1|1024520_1024646_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU85251.1|1024781_1025231_-	lipoprotein	NA	NA	NA	NA	NA
AYU85252.1|1025447_1025837_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYU85253.1|1025823_1026105_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYU85254.1|1026104_1026719_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYU85255.1|1026937_1027192_+	hypothetical protein	NA	NA	NA	NA	NA
AYU85256.1|1027296_1027674_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYU85257.1|1027737_1027998_+	hypothetical protein	NA	NA	NA	NA	NA
AYU85258.1|1028087_1028840_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYU85259.1|1028805_1030209_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYU85260.1|1030208_1031678_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYU85261.1|1031769_1032300_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYU85262.1|1032314_1033547_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYU85263.1|1033551_1034049_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYU85264.1|1034060_1035002_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYU85265.1|1035043_1035412_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYU85266.1|1035377_1035785_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYU85267.1|1035781_1036336_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYU85268.1|1036322_1036712_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYU85269.1|1036686_1037250_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYU85270.1|1037253_1038399_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYU85271.1|1038410_1038851_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYU85272.1|1038854_1039307_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYU85273.1|1039484_1041437_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYU85274.1|1041436_1042087_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYU85275.1|1042090_1042393_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYU85276.1|1042395_1043427_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYU85277.1|1043423_1043759_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYU85278.1|1043953_1044685_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU85279.1|1044684_1045113_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU85280.1|1045171_1045927_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYU85281.1|1046014_1046152_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYU85282.1|1046167_1046521_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYU85283.1|1046521_1047721_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYU85284.1|1047717_1048398_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYU85285.1|1048397_1049909_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYU85286.1|1049923_1050442_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYU85287.1|1051363_1052065_-	hypothetical protein	NA	NA	NA	NA	NA
AYU85288.1|1052377_1052656_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYU85289.1|1053081_1055694_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYU85290.1|1055901_1056912_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYU85291.1|1057074_1057620_+	hypothetical protein	NA	NA	NA	NA	NA
AYU85292.1|1057616_1058726_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYU85293.1|1058824_1060933_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYU85294.1|1060945_1062853_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061057:1061076	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYU85295.1|1063087_1064110_+	hypothetical protein	NA	NA	NA	NA	NA
AYU85296.1|1064114_1065755_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYU85297.1|1065751_1066315_+	lipoprotein	NA	NA	NA	NA	NA
AYU85298.1|1066568_1066736_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYU85299.1|1066835_1067354_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYU85300.1|1067422_1069183_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYU85301.1|1069368_1069821_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYU85302.1|1069892_1070945_-	outer membrane protein A	NA	NA	NA	NA	NA
AYU85303.1|1071299_1071809_-	cell division inhibitor	NA	NA	NA	NA	NA
AYU85304.1|1072025_1072631_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYU85305.1|1072617_1074771_-	inner membrane protein	NA	NA	NA	NA	NA
AYU85306.1|1074789_1075236_-	hypothetical protein	NA	NA	NA	NA	NA
AYU85307.1|1075359_1077414_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYU85308.1|1077449_1077908_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYU85309.1|1078002_1078665_-	hypothetical protein	NA	NA	NA	NA	NA
AYU85310.1|1078835_1079252_+	hypothetical protein	NA	NA	NA	NA	NA
AYU85311.1|1079296_1079614_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYU85312.1|1079671_1080883_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYU85313.1|1082014_1082473_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU85314.1|1083209_1083491_+	acylphosphatase	NA	NA	NA	NA	NA
AYU85315.1|1083487_1083817_-	sulfite reductase	NA	NA	NA	NA	NA
AYU85316.1|1083903_1084563_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYU85317.1|1085226_1085685_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029646	Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 chromosome, complete genome	4782348	1528502	1602100	4782348	tail,protease,transposase,head,tRNA,plate	Burkholderia_virus(44.12%)	72	NA	NA
AYU85716.1|1528502_1528961_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU85717.1|1529463_1529745_+	stress response protein	NA	NA	NA	NA	NA
AYU85718.1|1530013_1530835_+|protease	serine protease	protease	NA	NA	NA	NA
AYU85719.1|1530869_1531199_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYU85720.1|1531185_1531548_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYU85721.1|1531659_1531830_-	hypothetical protein	NA	NA	NA	NA	NA
AYU85722.1|1531964_1532999_+	hypothetical protein	NA	NA	NA	NA	NA
AYU85723.1|1533173_1534562_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYU85724.1|1534572_1536102_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYU85725.1|1536628_1537573_+	hypothetical protein	NA	NA	NA	NA	NA
AYU85726.1|1537754_1538144_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYU85727.1|1538115_1538568_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYU85728.1|1538762_1538993_-	hypothetical protein	NA	NA	NA	NA	NA
AYU85729.1|1538989_1539673_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYU85730.1|1540257_1540560_-	hypothetical protein	NA	NA	NA	NA	NA
AYU85731.1|1541130_1541661_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYU85732.1|1541960_1543127_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYU85733.1|1543137_1544907_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYU85734.1|1546351_1546702_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYU85735.1|1547416_1548067_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYU85736.1|1548389_1548701_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYU85737.1|1548700_1549246_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYU85738.1|1549242_1550838_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYU85739.1|1550837_1552334_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYU85740.1|1552314_1553136_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYU85741.1|1553138_1553597_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYU85742.1|1553811_1554927_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYU85743.1|1554941_1555895_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYU85744.1|1555904_1556243_+	hypothetical protein	NA	NA	NA	NA	NA
AYU85745.1|1556244_1556691_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYU85746.1|1556690_1557155_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYU85747.1|1557395_1558823_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYU85748.1|1558822_1559344_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYU85749.1|1559346_1559628_+	hypothetical protein	NA	NA	NA	NA	NA
AYU85750.1|1559725_1560061_+	hypothetical protein	NA	NA	NA	NA	NA
AYU85751.1|1560236_1562702_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYU85752.1|1562701_1563586_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYU85753.1|1563582_1563798_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYU85754.1|1563785_1564940_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYU85755.1|1564936_1565464_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYU85756.1|1565520_1565868_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYU85757.1|1565858_1566962_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYU85758.1|1566954_1567533_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYU85759.1|1567535_1568561_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYU85760.1|1569074_1569692_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYU85761.1|1571202_1571775_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYU85762.1|1572055_1573438_+	amino acid permease	NA	NA	NA	NA	NA
AYU85763.1|1573499_1573835_-	hypothetical protein	NA	NA	NA	NA	NA
AYU85764.1|1573961_1574693_+	two-component response regulator	NA	NA	NA	NA	NA
AYU85765.1|1575173_1576325_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYU85766.1|1576477_1578184_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYU85767.1|1578291_1579596_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYU85768.1|1579671_1580601_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYU85769.1|1580597_1582001_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYU85770.1|1582168_1583815_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYU85771.1|1584014_1585190_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYU85772.1|1585292_1586801_+	hypothetical protein	NA	NA	NA	NA	NA
AYU85773.1|1587506_1588508_+	adenosine deaminase	NA	NA	NA	NA	NA
AYU85774.1|1588581_1589697_-	oxidoreductase	NA	NA	NA	NA	NA
AYU85775.1|1589799_1589955_+	hypothetical protein	NA	NA	NA	NA	NA
AYU85776.1|1590253_1590469_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYU85777.1|1590557_1590998_+	hypothetical protein	NA	NA	NA	NA	NA
AYU85778.1|1591074_1591656_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYU85779.1|1591655_1592234_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYU85780.1|1592226_1594248_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYU85781.1|1594248_1595307_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYU85782.1|1595310_1595931_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYU85783.1|1595933_1596626_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYU85784.1|1596625_1597261_+	endonuclease III	NA	NA	NA	NA	NA
AYU85785.1|1597861_1599367_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYU85786.1|1599471_1600077_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYU85787.1|1600825_1602100_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029646	Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 chromosome, complete genome	4782348	1783137	1787549	4782348		Escherichia_phage(50.0%)	6	NA	NA
AYU85971.1|1783137_1783377_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYU85972.1|1784249_1785059_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYU85973.1|1785131_1785509_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYU85974.1|1785656_1786199_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYU85975.1|1786390_1787119_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYU85976.1|1787135_1787549_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029646	Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 chromosome, complete genome	4782348	1991403	1998637	4782348		Morganella_phage(33.33%)	7	NA	NA
AYU86167.1|1991403_1992834_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYU86168.1|1992907_1993603_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYU86169.1|1993682_1993994_-	hypothetical protein	NA	NA	NA	NA	NA
AYU86170.1|1994644_1995829_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYU86171.1|1996288_1996501_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYU86172.1|1996946_1998215_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYU86173.1|1998217_1998637_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029646	Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 chromosome, complete genome	4782348	2104937	2115444	4782348		Enterobacteria_phage(37.5%)	10	NA	NA
AYU86270.1|2104937_2106251_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYU86271.1|2106277_2107357_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYU86272.1|2107361_2108135_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYU86273.1|2108150_2109125_-	reductase RfbI	NA	NA	NA	NA	NA
AYU86274.1|2109130_2109682_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYU86275.1|2109682_2110561_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYU86276.1|2110608_2111508_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYU86277.1|2111507_2112593_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYU86278.1|2112969_2113863_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYU86279.1|2114040_2115444_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029646	Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 chromosome, complete genome	4782348	2191335	2200506	4782348	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYU86338.1|2191335_2193369_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYU86339.1|2193609_2194068_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYU86340.1|2194239_2194770_+	lipoprotein	NA	NA	NA	NA	NA
AYU86341.1|2194826_2195294_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYU86342.1|2195340_2196060_-	two-component system response regulator	NA	NA	NA	NA	NA
AYU86343.1|2196056_2197742_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYU86344.1|2197964_2198696_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYU86345.1|2198755_2198863_+	hypothetical protein	NA	NA	NA	NA	NA
AYU86346.1|2198843_2199575_-	ABC transporter permease	NA	NA	NA	NA	NA
AYU86347.1|2199558_2200506_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029646	Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 chromosome, complete genome	4782348	2735943	2749335	4782348	tail	Salmonella_phage(70.0%)	11	NA	NA
AYU86776.1|2735943_2736162_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYU86777.1|2736252_2737353_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYU86778.1|2737349_2737835_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYU86779.1|2737831_2740909_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYU86780.1|2740901_2741021_-	hypothetical protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYU86781.1|2741035_2741338_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYU86782.1|2741392_2741908_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYU86783.1|2741917_2743090_-|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYU86784.1|2743232_2743805_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYU86785.1|2744482_2745598_+	glycosyltransferase	NA	NA	NA	NA	NA
AYU86786.1|2745678_2749335_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029646	Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 chromosome, complete genome	4782348	3066490	3110193	4782348	protease,tRNA,transposase,bacteriocin	Bacillus_virus(33.33%)	44	NA	NA
AYU87073.1|3066490_3066949_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU87074.1|3067138_3068218_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYU87075.1|3068319_3069483_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYU87076.1|3069504_3070551_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYU87077.1|3070924_3071350_+	hypothetical protein	NA	NA	NA	NA	NA
AYU87078.1|3071375_3071954_+	hypothetical protein	NA	NA	NA	NA	NA
AYU87079.1|3071987_3072662_+	hypothetical protein	NA	NA	NA	NA	NA
AYU87080.1|3072643_3073327_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYU87081.1|3073320_3073977_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYU87082.1|3074081_3074540_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU87083.1|3074728_3076720_-	transketolase	NA	NA	NA	NA	NA
AYU87084.1|3076995_3077754_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYU87085.1|3077854_3078775_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYU87086.1|3079002_3080979_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYU87087.1|3080987_3081119_-	hypothetical protein	NA	NA	NA	NA	NA
AYU87088.1|3081413_3081713_-	membrane protein	NA	NA	NA	NA	NA
AYU87089.1|3081768_3082923_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYU87090.1|3083415_3084810_+	galactose-proton symport	NA	NA	NA	NA	NA
AYU87091.1|3084888_3085386_+	hypothetical protein	NA	NA	NA	NA	NA
AYU87092.1|3085481_3086189_+	endonuclease I	NA	NA	NA	NA	NA
AYU87093.1|3086265_3086997_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYU87094.1|3087016_3087964_+	glutathione synthetase	NA	NA	NA	NA	NA
AYU87095.1|3088179_3088743_+	hypothetical protein	NA	NA	NA	NA	NA
AYU87096.1|3088742_3089159_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYU87097.1|3089205_3089892_-	global regulatory protein	NA	NA	NA	NA	NA
AYU87098.1|3090021_3091002_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYU87099.1|3091019_3091724_+	hypothetical protein	NA	NA	NA	NA	NA
AYU87100.1|3091742_3092309_+	hypothetical protein	NA	NA	NA	NA	NA
AYU87101.1|3092305_3092596_+	hypothetical protein	NA	NA	NA	NA	NA
AYU87102.1|3092603_3093197_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYU87103.1|3093189_3094326_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYU87104.1|3094416_3095424_-	hypothetical protein	NA	NA	NA	NA	NA
AYU87105.1|3095556_3096603_-	L-asparaginase	NA	NA	NA	NA	NA
AYU87106.1|3096921_3097380_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU87107.1|3097502_3098222_-	hypothetical protein	NA	NA	NA	NA	NA
AYU87108.1|3098271_3098598_-	hypothetical protein	NA	NA	NA	NA	NA
AYU87109.1|3098597_3099317_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYU87110.1|3099471_3100524_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYU87111.1|3100551_3100827_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYU87112.1|3100939_3102025_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYU87113.1|3102241_3103498_+	nucleoside permease	NA	NA	NA	NA	NA
AYU87114.1|3106108_3106816_+	hypothetical protein	NA	NA	NA	NA	NA
AYU87115.1|3109405_3109672_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYU87116.1|3109914_3110193_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029646	Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 chromosome, complete genome	4782348	3487731	3525789	4782348	portal,tail,terminase,transposase,capsid,integrase,plate	Salmonella_phage(82.05%)	46	3482695:3482709	3494861:3494875
3482695:3482709	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYU87445.1|3487731_3489378_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYU87446.1|3489517_3489616_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYU87447.1|3489871_3490201_+	hypothetical protein	NA	NA	NA	NA	NA
AYU87448.1|3490241_3491294_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYU87449.1|3491689_3492259_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYU87450.1|3492384_3492606_+	hypothetical protein	NA	NA	NA	NA	NA
AYU87451.1|3492638_3493148_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYU87452.1|3493322_3493547_+	hypothetical protein	NA	NA	NA	NA	NA
AYU87453.1|3493569_3493911_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYU87454.1|3493978_3494212_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYU87455.1|3494211_3494439_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYU87456.1|3494435_3495293_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3494861:3494875	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYU87457.1|3495289_3497704_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYU87458.1|3497857_3498046_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYU87459.1|3500013_3500928_+	hypothetical protein	NA	NA	NA	NA	NA
AYU87460.1|3500924_3501665_+	hypothetical protein	NA	NA	NA	NA	NA
AYU87461.1|3501699_3502737_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYU87462.1|3502736_3504503_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYU87463.1|3504645_3505479_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYU87464.1|3505495_3506554_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYU87465.1|3506557_3507208_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYU87466.1|3507240_3507768_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYU87467.1|3507767_3507971_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYU87468.1|3507974_3508190_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYU87469.1|3508209_3508683_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYU87470.1|3508684_3509062_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYU87471.1|3509058_3509487_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYU87472.1|3509582_3510014_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYU87473.1|3510006_3510453_+|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYU87474.1|3510521_3511100_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYU87475.1|3511096_3511456_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYU87476.1|3511442_3512351_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYU87477.1|3512343_3512949_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYU87478.1|3512945_3514460_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYU87479.1|3514459_3515053_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYU87480.1|3515024_3515465_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYU87481.1|3515887_3516460_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYU87482.1|3516602_3517775_+|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYU87483.1|3517784_3518300_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYU87484.1|3518354_3518657_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYU87485.1|3518671_3518791_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYU87486.1|3518783_3521861_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYU87487.1|3521857_3522343_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYU87488.1|3522339_3523440_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYU87489.1|3523530_3523749_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYU87490.1|3525330_3525789_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029646	Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 chromosome, complete genome	4782348	4442100	4516264	4782348	portal,tail,terminase,capsid,integrase,plate	Salmonella_phage(82.98%)	76	4503601:4503617	4516423:4516439
AYU88262.1|4442100_4444050_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYU88263.1|4444121_4445030_+	hypothetical protein	NA	NA	NA	NA	NA
AYU88264.1|4445103_4446003_+	hypothetical protein	NA	NA	NA	NA	NA
AYU88265.1|4446044_4446404_+	hypothetical protein	NA	NA	NA	NA	NA
AYU88266.1|4446503_4446773_-	hypothetical protein	NA	NA	NA	NA	NA
AYU88267.1|4446904_4448179_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYU88268.1|4448398_4448776_+	hypothetical protein	NA	NA	NA	NA	NA
AYU88269.1|4448862_4449081_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYU88270.1|4449148_4450249_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYU88271.1|4450245_4450731_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYU88272.1|4450730_4453511_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYU88273.1|4453503_4453623_-	hypothetical protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYU88274.1|4453637_4453940_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYU88275.1|4453994_4454510_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYU88276.1|4454519_4455692_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYU88277.1|4456226_4456949_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYU88278.1|4457146_4457554_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYU88279.1|4457560_4459180_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYU88280.1|4459176_4459782_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYU88281.1|4459774_4460683_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYU88282.1|4460669_4461029_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYU88283.1|4461025_4461604_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYU88284.1|4461672_4462119_-|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYU88285.1|4462111_4462543_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYU88286.1|4462638_4463064_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYU88287.1|4463063_4463441_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYU88288.1|4463445_4463916_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYU88289.1|4463935_4464151_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYU88290.1|4464154_4464358_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYU88291.1|4464357_4464822_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYU88292.1|4464915_4465566_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYU88293.1|4465569_4466634_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYU88294.1|4466650_4467484_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYU88295.1|4467626_4469393_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYU88296.1|4469389_4470436_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYU88297.1|4470484_4471180_-	hypothetical protein	NA	NA	NA	NA	NA
AYU88298.1|4471199_4472264_-	hypothetical protein	NA	NA	NA	NA	NA
AYU88299.1|4472260_4473325_-	hypothetical protein	NA	NA	NA	NA	NA
AYU88300.1|4474249_4474579_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYU88301.1|4474575_4476645_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYU88302.1|4476635_4477496_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYU88303.1|4477492_4478077_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYU88304.1|4478073_4478301_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYU88305.1|4478300_4478534_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYU88306.1|4478601_4478943_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYU88307.1|4478906_4479107_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYU88308.1|4479114_4479624_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYU88309.1|4479656_4479899_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYU88310.1|4480015_4480648_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYU88311.1|4480651_4481677_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYU88312.1|4481783_4482137_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYU88313.1|4482753_4483041_+	hypothetical protein	NA	NA	NA	NA	NA
AYU88314.1|4483051_4483942_+	methyltransferase	NA	NA	NA	NA	NA
AYU88315.1|4483941_4484688_+	hypothetical protein	NA	NA	NA	NA	NA
AYU88316.1|4484989_4486960_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYU88317.1|4486979_4488284_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYU88318.1|4488306_4489002_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYU88319.1|4489027_4489822_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYU88320.1|4489831_4490899_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYU88321.1|4490943_4492680_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYU88322.1|4492679_4495175_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYU88323.1|4495198_4496245_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYU88324.1|4496247_4497525_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYU88325.1|4497769_4498309_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYU88326.1|4499162_4500674_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYU88327.1|4500657_4502247_+	hypothetical protein	NA	NA	NA	NA	NA
AYU88328.1|4502410_4503424_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4503601:4503617	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYU88329.1|4503850_4504144_+	hypothetical protein	NA	NA	NA	NA	NA
AYU88330.1|4504140_4504629_+	hypothetical protein	NA	NA	NA	NA	NA
AYU88331.1|4504808_4505261_-	hypothetical protein	NA	NA	NA	NA	NA
AYU88332.1|4510483_4510945_+	hypothetical protein	NA	NA	NA	NA	NA
AYU88333.1|4510941_4511163_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYU88334.1|4512019_4512802_+	hypothetical protein	NA	NA	NA	NA	NA
AYU88335.1|4513428_4513653_-	hypothetical protein	NA	NA	NA	NA	NA
AYU88336.1|4513782_4514694_-	hypothetical protein	NA	NA	NA	NA	NA
AYU88337.1|4515004_4516264_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4516423:4516439	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 12
CP029646	Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 chromosome, complete genome	4782348	4658516	4668775	4782348	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYU88474.1|4658516_4659593_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYU88475.1|4659589_4660663_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYU88476.1|4660637_4661801_-	hypothetical protein	NA	NA	NA	NA	NA
AYU88477.1|4662076_4662643_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYU88478.1|4662658_4662898_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYU88479.1|4662901_4663762_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYU88480.1|4664184_4664508_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYU88481.1|4664491_4664992_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYU88482.1|4664988_4665216_+	hypothetical protein	NA	NA	NA	NA	NA
AYU88483.1|4665212_4665533_+	P4 phage protein	NA	NA	NA	NA	NA
AYU88484.1|4665547_4666222_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYU88485.1|4666218_4667880_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYU88486.1|4668616_4668775_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
>prophage 1
CP029645	Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM1, complete sequence	216963	3612	57130	216963	transposase,holin	Escherichia_phage(43.75%)	56	NA	NA
AYU84148.1|3612_3888_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYU84149.1|3806_4310_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYU84150.1|4636_4861_-	hypothetical protein	NA	NA	NA	NA	NA
AYU84151.1|5516_5777_-	hypothetical protein	NA	NA	NA	NA	NA
AYU84152.1|5865_6357_-	hypothetical protein	NA	NA	NA	NA	NA
AYU84153.1|6361_6670_-	hypothetical protein	NA	NA	NA	NA	NA
AYU84154.1|6877_7258_-	hypothetical protein	NA	NA	NA	NA	NA
AYU84155.1|7343_7592_-	hypothetical protein	NA	NA	NA	NA	NA
AYU84156.1|7629_7851_-	hypothetical protein	NA	S4TRP7	Salmonella_phage	40.3	8.2e-06
AYU84157.1|8013_8397_-	hypothetical protein	NA	NA	NA	NA	NA
AYU84158.1|8711_8936_-	hypothetical protein	NA	NA	NA	NA	NA
AYU84159.1|9022_9487_-	hypothetical protein	NA	NA	NA	NA	NA
AYU84160.1|9669_12099_-	hypothetical protein	NA	NA	NA	NA	NA
AYU84161.1|12221_12668_-	hypothetical protein	NA	NA	NA	NA	NA
AYU84162.1|12715_13522_-	hypothetical protein	NA	NA	NA	NA	NA
AYU84163.1|13749_13992_-	hypothetical protein	NA	NA	NA	NA	NA
AYU84164.1|14069_14402_-	hypothetical protein	NA	NA	NA	NA	NA
AYU84165.1|14901_16083_-	hypothetical protein	NA	NA	NA	NA	NA
AYU84166.1|16091_16388_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	35.1	4.9e-06
AYU84167.1|16451_16919_-	hypothetical protein	NA	NA	NA	NA	NA
AYU84168.1|17778_18555_+	hypothetical protein	NA	NA	NA	NA	NA
AYU84169.1|18704_19481_+	hypothetical protein	NA	NA	NA	NA	NA
AYU84170.1|19669_20011_+	hypothetical protein	NA	NA	NA	NA	NA
AYU84171.1|20111_20375_+	hypothetical protein	NA	M9UXL5	Escherichia_phage	45.1	2.1e-08
AYU84172.1|20608_21307_+	hypothetical protein	NA	A0A1W6DXB8	Sphingobium_phage	25.2	4.2e-11
AYU84173.1|21461_21758_-	hypothetical protein	NA	NA	NA	NA	NA
AYU84174.1|21845_24230_-	periplasmic protein	NA	NA	NA	NA	NA
AYU84175.1|24480_25089_+	hypothetical protein	NA	NA	NA	NA	NA
AYU84176.1|25201_25498_+	hypothetical protein	NA	NA	NA	NA	NA
AYU84177.1|25502_26099_+	hypothetical protein	NA	NA	NA	NA	NA
AYU84178.1|26490_27372_+	replication protein	NA	J9Q7H0	Salmonella_phage	41.3	6.5e-54
AYU84179.1|27957_28473_-	hypothetical protein	NA	NA	NA	NA	NA
AYU84180.1|29123_31580_-	periplasmic protein	NA	NA	NA	NA	NA
AYU84181.1|32216_33971_-	DNA restriction methylase	NA	J9Q747	Salmonella_phage	30.9	1.1e-68
AYU84182.1|34156_35314_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	24.6	1.1e-19
AYU84183.1|35673_36498_+	DNA modification methylase	NA	A0A2P9J4Y7	Pectobacterium_phage	37.6	2.8e-46
AYU84184.1|36512_37334_-	hypothetical protein	NA	NA	NA	NA	NA
AYU84185.1|37616_38324_-	hypothetical protein	NA	NA	NA	NA	NA
AYU84186.1|38538_39615_-	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	31.8	7.8e-09
AYU84187.1|40149_41025_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	43.5	1.6e-60
AYU84188.1|41278_41860_-	hypothetical protein	NA	NA	NA	NA	NA
AYU84189.1|42466_42820_+	hypothetical protein	NA	NA	NA	NA	NA
AYU84190.1|42871_43189_+	hypothetical protein	NA	NA	NA	NA	NA
AYU84191.1|43188_43986_+	pilus assembly protein	NA	NA	NA	NA	NA
AYU84192.1|43988_45221_+	hypothetical protein	NA	NA	NA	NA	NA
AYU84193.1|45222_45663_+	hypothetical protein	NA	NA	NA	NA	NA
AYU84194.1|45640_47011_+	TrhB	NA	NA	NA	NA	NA
AYU84195.1|47019_47532_+	hypothetical protein	NA	NA	NA	NA	NA
AYU84196.1|47532_48390_+	plasmid transfer protein	NA	NA	NA	NA	NA
AYU84197.1|48399_49350_+	hypothetical protein	NA	NA	NA	NA	NA
AYU84198.1|49358_52040_+	hypothetical protein	NA	NA	NA	NA	NA
AYU84199.1|52673_52949_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	93.4	1.9e-44
AYU84200.1|53077_55081_+|holin	transporter, betaine/carnitine/choline family	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.5e-21
AYU84201.1|55143_56439_+	hypothetical protein	NA	NA	NA	NA	NA
AYU84202.1|56432_56936_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYU84203.1|56854_57130_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
>prophage 2
CP029645	Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM1, complete sequence	216963	81906	134469	216963	transposase,integrase	Escherichia_phage(50.0%)	63	106810:106824	131310:131324
AYU84224.1|81906_82410_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYU84225.1|82328_82604_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYU84226.1|82645_84502_+	hypothetical protein	NA	S5MMD7	Bacillus_phage	26.4	2.2e-19
AYU84227.1|84899_85775_+	hypothetical protein	NA	NA	NA	NA	NA
AYU84228.1|85833_86211_+	hypothetical protein	NA	NA	NA	NA	NA
AYU84229.1|86271_87258_+	hypothetical protein	NA	NA	NA	NA	NA
AYU84230.1|87317_88370_+	hypothetical protein	NA	NA	NA	NA	NA
AYU84231.1|88408_88678_+	hypothetical protein	NA	NA	NA	NA	NA
AYU84232.1|88748_89876_+	hypothetical protein	NA	NA	NA	NA	NA
AYU84233.1|89953_91966_+	hypothetical protein	NA	NA	NA	NA	NA
AYU84234.1|92037_92259_+	hypothetical protein	NA	NA	NA	NA	NA
AYU84235.1|92373_93606_+	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	29.7	3.0e-12
AYU84236.1|93880_94405_+	hypothetical protein	NA	NA	NA	NA	NA
AYU84237.1|94395_95361_+	hypothetical protein	NA	NA	NA	NA	NA
AYU84238.1|95431_96367_+	hypothetical protein	NA	NA	NA	NA	NA
AYU84239.1|96444_97365_+	hypothetical protein	NA	NA	NA	NA	NA
AYU84240.1|97437_98373_+	hypothetical protein	NA	NA	NA	NA	NA
AYU84241.1|98549_99506_+	hypothetical protein	NA	NA	NA	NA	NA
AYU84242.1|99918_100188_+	hypothetical protein	NA	NA	NA	NA	NA
AYU84243.1|100242_100833_+	hypothetical protein	NA	NA	NA	NA	NA
AYU84244.1|100840_101098_+	hypothetical protein	NA	NA	NA	NA	NA
AYU84245.1|101171_101708_+	hypothetical protein	NA	NA	NA	NA	NA
AYU84246.1|101724_102180_+	hypothetical protein	NA	NA	NA	NA	NA
AYU84247.1|102163_102391_+	hypothetical protein	NA	NA	NA	NA	NA
AYU84248.1|102439_102694_-	hypothetical protein	NA	NA	NA	NA	NA
AYU84249.1|102761_103721_+	hypothetical protein	NA	NA	NA	NA	NA
AYU84250.1|103731_104640_+	hypothetical protein	NA	NA	NA	NA	NA
AYU84251.1|104944_106126_-	recombinase	NA	NA	NA	NA	NA
AYU84252.1|106340_106553_+	regulatory protein	NA	NA	NA	NA	NA
106810:106824	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
AYU84253.1|106859_107135_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	7.7e-46
106810:106824	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
AYU84254.1|107053_107557_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYU84255.1|107663_108098_-	transcriptional regulator MerR	NA	NA	NA	NA	NA
AYU84256.1|108115_108520_+	MerT	NA	NA	NA	NA	NA
AYU84257.1|108533_108809_+	mercuric transport protein	NA	NA	NA	NA	NA
AYU84258.1|108844_109267_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AYU84259.1|109318_111013_+	mercuric reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AYU84260.1|111030_111393_+	transcriptional regulator MerD	NA	NA	NA	NA	NA
AYU84261.1|111389_111626_+	mercury resistance protein	NA	NA	NA	NA	NA
AYU84262.1|111622_112330_+	hypothetical protein	NA	NA	NA	NA	NA
AYU84263.1|112368_113673_+|integrase	integrase	integrase	NA	NA	NA	NA
AYU84264.1|113701_114424_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYU84265.1|115179_116031_+	replication protein	NA	NA	NA	NA	NA
AYU84266.1|116338_117154_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
AYU84267.1|117214_118018_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYU84268.1|118017_118854_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYU84269.1|118914_119637_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYU84270.1|120216_121077_-	beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
120671:120685	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
AYU84271.1|121259_121526_-	resolvase	NA	Q1MVP4	Enterobacteria_phage	100.0	1.4e-36
120671:120685	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
AYU84272.1|121558_122281_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYU84273.1|122514_123441_-	sulfonamide-resistant dihydropteroate synthase sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	7.2e-11
AYU84274.1|123347_123728_-	Ethidium bromide-methyl viologen resistance protein EmrE	NA	NA	NA	NA	NA
AYU84275.1|123924_124524_-	dihydrofolate reductase	NA	A0A1B2IAU3	Erwinia_phage	32.8	5.3e-15
AYU84276.1|124555_125569_+|integrase	phage integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYU84277.1|125558_126122_+	transposon tn21 modulator protein	NA	NA	NA	NA	NA
AYU84278.1|126247_126808_+	Tn21 resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AYU84279.1|126810_129777_+|transposase	transposase tn21	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AYU84280.1|129843_130221_+	hypothetical protein	NA	NA	NA	NA	NA
AYU84281.1|130421_131081_-	chloramphenicol acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
AYU84282.1|131359_131635_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYU84283.1|131553_132057_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYU84284.1|132638_133394_+	replication protein	NA	I3WF20	Macacine_betaherpesvirus	94.8	1.9e-134
AYU84285.1|133771_134047_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYU84286.1|133965_134469_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	94.6	5.5e-90
>prophage 1
CP029647	Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM2, complete sequence	106706	567	76486	106706	tail	Salmonella_phage(97.73%)	91	NA	NA
AYU88577.1|567_1299_-|tail	putative phage tail protein	tail	J9Q7Y5	Salmonella_phage	99.1	3.3e-136
AYU88578.1|1355_1691_-	hypothetical protein	NA	J9Q6E1	Salmonella_phage	97.3	5.7e-59
AYU88579.1|1732_6316_-	hypothetical protein	NA	J9Q712	Salmonella_phage	92.9	0.0e+00
AYU88580.1|6323_6593_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	8.4e-37
AYU88581.1|6673_6991_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
AYU88582.1|7050_7797_-	hypothetical protein	NA	J9Q7Y4	Salmonella_phage	96.8	7.8e-125
AYU88583.1|7871_8255_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	100.0	1.7e-67
AYU88584.1|8256_8730_-	hypothetical protein	NA	J9Q711	Salmonella_phage	100.0	2.3e-82
AYU88585.1|8720_9065_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
AYU88586.1|9162_9996_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	100.0	2.6e-153
AYU88587.1|9995_10430_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	100.0	2.1e-74
AYU88588.1|10473_11397_-	hypothetical protein	NA	J9Q6D6	Salmonella_phage	100.0	3.3e-157
AYU88589.1|11471_12347_-	hypothetical protein	NA	J9Q710	Salmonella_phage	100.0	3.8e-163
AYU88590.1|12373_13270_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	96.6	5.7e-146
AYU88591.1|13292_14867_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.0	3.2e-301
AYU88592.1|14900_16157_-	hypothetical protein	NA	J9Q7Y2	Salmonella_phage	99.8	5.3e-251
AYU88593.1|16159_16801_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	99.5	1.8e-109
AYU88594.1|16996_17263_-	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
AYU88595.1|17272_18172_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.3	4.0e-168
AYU88596.1|18168_18423_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
AYU88597.1|18415_19054_-	putative ABC transporter ATP-binding protein	NA	J9Q807	Salmonella_phage	99.1	5.5e-111
AYU88598.1|19050_19719_-	hypothetical protein	NA	J9Q6L1	Salmonella_phage	99.5	1.1e-114
AYU88599.1|19718_20399_-	hypothetical protein	NA	J9Q756	Salmonella_phage	99.6	7.4e-122
AYU88600.1|20481_22041_+	putative helicase	NA	J9Q7I4	Salmonella_phage	99.4	5.7e-295
AYU88601.1|22043_22322_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	98.9	3.4e-41
AYU88602.1|22381_22804_+	putative lipoprotein	NA	J9Q806	Salmonella_phage	85.7	8.2e-63
AYU88603.1|22808_23336_+	putative transcriptional regulator	NA	J9Q6L0	Salmonella_phage	96.6	4.1e-80
AYU88604.1|23970_24621_+	hypothetical protein	NA	J9Q754	Salmonella_phage	100.0	1.4e-114
AYU88605.1|24705_24933_+	hypothetical protein	NA	NA	NA	NA	NA
AYU88606.1|25564_26047_-	hypothetical protein	NA	J9Q805	Salmonella_phage	96.9	5.5e-87
AYU88607.1|26252_26540_-	hypothetical protein	NA	J9Q753	Salmonella_phage	94.6	1.5e-47
AYU88608.1|26660_27053_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	65.4	1.7e-41
AYU88609.1|27181_27493_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	92.2	1.1e-45
AYU88610.1|27569_27884_-	hypothetical protein	NA	NA	NA	NA	NA
AYU88611.1|27978_28197_-	hypothetical protein	NA	J9Q804	Salmonella_phage	98.6	6.4e-35
AYU88612.1|28207_28423_-	hypothetical protein	NA	J9Q6K7	Salmonella_phage	95.8	4.5e-33
AYU88613.1|28565_28811_+	hypothetical protein	NA	J9Q751	Salmonella_phage	92.5	5.8e-37
AYU88614.1|30247_31438_-	hypothetical protein	NA	J9Q803	Salmonella_phage	54.6	5.4e-120
AYU88615.1|31447_31765_-	hypothetical protein	NA	J9Q750	Salmonella_phage	80.0	8.1e-47
AYU88616.1|31849_32131_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	71.6	3.2e-31
AYU88617.1|32304_32508_+	hypothetical protein	NA	J9Q802	Salmonella_phage	95.5	1.5e-30
AYU88618.1|32568_32856_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	58.8	9.9e-28
AYU88619.1|32852_33161_-	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	56.9	3.0e-14
AYU88620.1|33172_33715_-	hypothetical protein	NA	J9Q748	Salmonella_phage	93.1	2.6e-93
AYU88621.1|33711_34353_-	hypothetical protein	NA	J9Q7H7	Salmonella_phage	100.0	9.7e-116
AYU88622.1|34444_34816_-	hypothetical protein	NA	J9Q7T4	Salmonella_phage	100.0	3.2e-63
AYU88623.1|34926_35100_-	hypothetical protein	NA	J9Q801	Salmonella_phage	98.2	9.5e-26
AYU88624.1|35096_35786_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	98.3	6.1e-124
AYU88625.1|35844_37548_-	putative DNA modification methylase	NA	J9Q747	Salmonella_phage	98.9	0.0e+00
AYU88626.1|37671_38244_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	98.9	8.2e-98
AYU88627.1|38352_39195_-	hypothetical protein	NA	J9Q7T3	Salmonella_phage	71.1	2.1e-70
AYU88628.1|39303_39492_-	hypothetical protein	NA	J9Q800	Salmonella_phage	100.0	1.2e-26
AYU88629.1|39501_39996_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	96.3	1.9e-79
AYU88630.1|40138_40747_-	putative ribonuclease H	NA	J9Q745	Salmonella_phage	99.5	2.2e-117
AYU88631.1|41332_41563_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	100.0	2.1e-36
AYU88632.1|41765_42359_-	hypothetical protein	NA	J9Q7T2	Salmonella_phage	99.5	4.6e-112
AYU88633.1|42544_43471_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	85.4	4.1e-107
AYU88634.1|43515_44073_-	hypothetical protein	NA	J9Q6J8	Salmonella_phage	99.5	7.0e-102
AYU88635.1|44082_44502_-	hypothetical protein	NA	J9Q743	Salmonella_phage	98.6	2.9e-68
AYU88636.1|44565_45210_-	hypothetical protein	NA	J9Q7H4	Salmonella_phage	100.0	5.2e-117
AYU88637.1|45209_45686_-	hypothetical protein	NA	J9Q7T1	Salmonella_phage	100.0	1.4e-90
AYU88638.1|45682_46096_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	97.8	4.7e-71
AYU88639.1|46097_47213_-	putative thymidylate synthase	NA	J9Q6J6	Salmonella_phage	98.1	7.6e-217
AYU88640.1|47328_48258_-	hypothetical protein	NA	J9Q742	Salmonella_phage	99.0	3.8e-161
AYU88641.1|48340_49483_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	99.5	2.4e-218
AYU88642.1|49590_51906_-	ribonucleotide-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.7	0.0e+00
AYU88643.1|51983_52553_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	99.5	1.7e-103
AYU88644.1|52565_53312_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	98.0	4.4e-136
AYU88645.1|53301_55218_-	exonuclease	NA	J9Q741	Salmonella_phage	98.6	0.0e+00
AYU88646.1|55214_55451_-	hypothetical protein	NA	J9Q7H1	Salmonella_phage	98.4	1.1e-29
AYU88647.1|55447_56533_-	exonuclease	NA	J9Q7S9	Salmonella_phage	98.9	2.7e-206
AYU88648.1|56959_57265_+	hypothetical protein	NA	J9Q7Z6	Salmonella_phage	97.0	2.0e-50
AYU88649.1|57296_57791_-	hypothetical protein	NA	J9Q6J3	Salmonella_phage	97.6	2.3e-88
AYU88650.1|57866_58511_-	hypothetical protein	NA	J9Q739	Salmonella_phage	98.1	2.4e-122
AYU88651.1|59255_60311_+	putative replication protein A	NA	J9Q7H0	Salmonella_phage	98.0	1.5e-185
AYU88652.1|60839_61043_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	4.0e-31
AYU88653.1|61042_61348_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	90.8	4.9e-33
AYU88654.1|61388_61664_-	hypothetical protein	NA	J9Q738	Salmonella_phage	96.7	5.9e-46
AYU88655.1|61732_62143_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.1	1.4e-75
AYU88656.1|62126_62498_-	hypothetical protein	NA	J9Q7S7	Salmonella_phage	98.4	3.0e-69
AYU88657.1|62660_63503_-	putative lipoprotein	NA	J9Q7Z4	Salmonella_phage	97.1	2.3e-125
AYU88658.1|63798_64875_-	putative recombinase	NA	J9Q736	Salmonella_phage	99.7	5.5e-204
AYU88659.1|64877_65144_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
AYU88660.1|65143_66088_-	exonuclease	NA	J9Q7S6	Salmonella_phage	99.4	6.8e-182
AYU88661.1|66148_67177_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.8	1.1e-164
AYU88662.1|67296_67728_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	100.0	4.0e-73
AYU88663.1|67973_68564_+	hypothetical protein	NA	NA	NA	NA	NA
AYU88664.1|68657_69101_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	97.9	3.0e-71
AYU88665.1|69097_72616_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.1	0.0e+00
AYU88666.1|72796_74032_-	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	99.5	1.8e-238
AYU88667.1|74128_76486_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	90.7	0.0e+00
>prophage 2
CP029647	Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM2, complete sequence	106706	84976	105894	106706	tail	Salmonella_phage(85.0%)	20	NA	NA
AYU88681.1|84976_85282_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	98.0	9.2e-48
AYU88682.1|85278_85431_-	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	96.0	7.6e-19
AYU88683.1|85430_85637_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.5	8.1e-32
AYU88684.1|85802_87125_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	98.4	5.8e-256
AYU88685.1|87159_87417_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	92.9	4.9e-34
AYU88686.1|87717_88512_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.2	4.9e-141
AYU88687.1|88695_89748_+	hypothetical protein	NA	J9Q6F5	Salmonella_phage	56.7	1.9e-92
AYU88688.1|89749_90961_-	hypothetical protein	NA	J9Q720	Salmonella_phage	96.5	6.6e-214
AYU88689.1|91023_92364_-	putative DNA helicase	NA	J9Q7G4	Salmonella_phage	99.6	3.8e-247
AYU88690.1|92424_93150_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	98.3	2.4e-139
AYU88691.1|93427_94483_+	hypothetical protein	NA	A0A2I7RNF6	Vibrio_phage	42.6	5.1e-61
AYU88692.1|94552_95308_-	hypothetical protein	NA	J9Q7Y9	Salmonella_phage	43.0	3.2e-57
AYU88693.1|95356_95716_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	2.3e-45
AYU88694.1|95715_96381_-	hypothetical protein	NA	J9Q7R7	Salmonella_phage	95.0	8.0e-113
AYU88695.1|96711_97263_+	hypothetical protein	NA	A0A2H4J5U3	uncultured_Caudovirales_phage	39.8	7.8e-29
AYU88696.1|97313_97658_-	hypothetical protein	NA	J9Q7G2	Salmonella_phage	83.6	5.9e-27
AYU88697.1|97726_98446_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	95.7	1.5e-125
AYU88698.1|98432_98756_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	97.2	2.7e-50
AYU88699.1|98870_101423_-	hypothetical protein	NA	A0A0A0YQM3	Citrobacter_virus	52.5	1.4e-152
AYU88700.1|101505_105894_-|tail	putative phage tail protein	tail	J9Q713	Salmonella_phage	86.7	0.0e+00
