The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029942	Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 chromosome, complete genome	4786232	930092	937404	4786232	protease,integrase	Dickeya_phage(16.67%)	6	931343:931357	942522:942536
AYR46136.1|930092_931211_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYR46137.1|931207_933154_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931343:931357	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYR46138.1|933283_933505_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYR46139.1|933828_934149_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYR46140.1|934179_936456_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYR46141.1|937026_937404_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942522:942536	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029942	Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 chromosome, complete genome	4786232	1008347	1085659	4786232	transposase,integrase,protease,tail,terminase	Salmonella_phage(73.33%)	93	990413:990432	1061020:1061039
990413:990432	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYR46191.1|1008347_1009688_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYR46192.1|1009684_1009933_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYR46193.1|1009973_1010219_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYR46194.1|1010218_1011100_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYR46195.1|1011096_1012161_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYR46196.1|1012238_1012919_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYR46197.1|1012915_1013701_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYR46198.1|1013706_1014003_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYR46199.1|1014093_1014294_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYR46200.1|1014582_1014987_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYR46201.1|1015318_1015693_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYR46202.1|1015777_1016761_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYR46203.1|1016763_1017513_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYR46204.1|1017523_1017871_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYR46205.1|1017867_1018392_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYR46206.1|1018391_1018865_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYR46207.1|1018868_1019441_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYR46208.1|1019534_1019801_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYR46209.1|1019882_1020044_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR46210.1|1020476_1020974_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR46211.1|1021158_1021398_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYR46212.1|1021387_1021693_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYR46213.1|1021732_1022335_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYR46214.1|1022543_1023155_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYR46215.1|1023287_1024085_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYR46216.1|1024483_1024609_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR46217.1|1024744_1025194_-	lipoprotein	NA	NA	NA	NA	NA
AYR46218.1|1025410_1025800_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYR46219.1|1025786_1026068_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYR46220.1|1026067_1026682_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYR46221.1|1026900_1027155_+	hypothetical protein	NA	NA	NA	NA	NA
AYR46222.1|1027259_1027637_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYR46223.1|1027700_1027961_+	hypothetical protein	NA	NA	NA	NA	NA
AYR46224.1|1028050_1028803_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYR46225.1|1028768_1030172_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYR46226.1|1030171_1031641_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYR46227.1|1031732_1032263_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYR46228.1|1032277_1033510_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYR46229.1|1033514_1034012_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYR46230.1|1034023_1034965_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYR46231.1|1035006_1035375_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYR46232.1|1035340_1035748_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYR46233.1|1035744_1036299_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYR46234.1|1036285_1036675_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYR46235.1|1036649_1037213_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYR46236.1|1037216_1038362_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYR46237.1|1038373_1038814_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYR46238.1|1038817_1039270_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYR46239.1|1039447_1041400_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYR46240.1|1041399_1042050_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYR46241.1|1042053_1042356_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYR46242.1|1042358_1043390_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYR46243.1|1043386_1043722_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYR46244.1|1043916_1044648_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR46245.1|1044647_1045076_+	bacteriophage protein	NA	NA	NA	NA	NA
AYR46246.1|1045134_1045890_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYR46247.1|1045977_1046115_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYR46248.1|1046130_1046484_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYR46249.1|1046484_1047684_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYR46250.1|1047680_1048361_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYR46251.1|1048360_1049872_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYR46252.1|1049886_1050405_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYR46253.1|1051326_1052028_-	hypothetical protein	NA	NA	NA	NA	NA
AYR46254.1|1052340_1052619_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYR46255.1|1053044_1055657_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYR46256.1|1055864_1056875_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYR46257.1|1057037_1057583_+	hypothetical protein	NA	NA	NA	NA	NA
AYR46258.1|1057579_1058689_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYR46259.1|1058787_1060896_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYR46260.1|1060908_1062816_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061020:1061039	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYR46261.1|1062830_1064084_+	inner membrane protein	NA	NA	NA	NA	NA
AYR46262.1|1064088_1065729_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYR46263.1|1065725_1066289_+	lipoprotein	NA	NA	NA	NA	NA
AYR46264.1|1066542_1066710_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYR46265.1|1066809_1067328_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYR46266.1|1067396_1069157_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYR46267.1|1069342_1069795_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYR46268.1|1069866_1070919_-	outer membrane protein A	NA	NA	NA	NA	NA
AYR46269.1|1071273_1071783_-	cell division inhibitor	NA	NA	NA	NA	NA
AYR46270.1|1071999_1072605_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYR46271.1|1072591_1074745_-	inner membrane protein	NA	NA	NA	NA	NA
AYR46272.1|1074763_1075210_-	hypothetical protein	NA	NA	NA	NA	NA
AYR46273.1|1075333_1077388_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYR46274.1|1077423_1077882_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYR46275.1|1077976_1078639_-	hypothetical protein	NA	NA	NA	NA	NA
AYR46276.1|1078809_1079226_+	hypothetical protein	NA	NA	NA	NA	NA
AYR46277.1|1079270_1079588_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYR46278.1|1079645_1080857_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYR46279.1|1081988_1082447_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR46280.1|1083183_1083465_+	acylphosphatase	NA	NA	NA	NA	NA
AYR46281.1|1083461_1083791_-	sulfite reductase	NA	NA	NA	NA	NA
AYR46282.1|1083877_1084537_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYR46283.1|1085200_1085659_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029942	Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 chromosome, complete genome	4786232	1528477	1601603	4786232	transposase,head,protease,tail,tRNA,plate	Burkholderia_virus(43.24%)	80	NA	NA
AYR46683.1|1528477_1528936_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR46684.1|1529438_1529720_+	stress response protein	NA	NA	NA	NA	NA
AYR46685.1|1529988_1530810_+|protease	serine protease	protease	NA	NA	NA	NA
AYR46686.1|1530844_1531174_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYR46687.1|1531160_1531523_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYR46688.1|1531634_1531805_-	hypothetical protein	NA	NA	NA	NA	NA
AYR46689.1|1531939_1532974_+	hypothetical protein	NA	NA	NA	NA	NA
AYR46690.1|1533148_1534537_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYR46691.1|1534547_1536077_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYR46692.1|1536603_1537548_+	hypothetical protein	NA	NA	NA	NA	NA
AYR46693.1|1537729_1538119_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYR46694.1|1538090_1538543_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYR46695.1|1538737_1538968_-	hypothetical protein	NA	NA	NA	NA	NA
AYR46696.1|1538964_1539648_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYR46697.1|1539644_1539860_-	hypothetical protein	NA	NA	NA	NA	NA
AYR46698.1|1539852_1540236_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
AYR46699.1|1540232_1540535_-	hypothetical protein	NA	NA	NA	NA	NA
AYR46700.1|1540544_1540817_-	hypothetical protein	NA	NA	NA	NA	NA
AYR46701.1|1541105_1541636_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYR46702.1|1541663_1541933_-	hypothetical protein	NA	NA	NA	NA	NA
AYR46703.1|1541935_1543102_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYR46704.1|1543112_1544882_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYR46705.1|1545059_1545491_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
AYR46706.1|1545486_1546083_+	hypothetical protein	NA	NA	NA	NA	NA
AYR46707.1|1546326_1546677_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYR46708.1|1547391_1548042_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYR46709.1|1548038_1548365_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AYR46710.1|1548364_1548676_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYR46711.1|1548675_1549221_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYR46712.1|1549217_1550813_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYR46713.1|1550812_1552309_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYR46714.1|1552289_1553111_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYR46715.1|1553113_1553572_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYR46716.1|1553786_1554902_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYR46717.1|1554916_1555870_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYR46718.1|1555879_1556218_+	hypothetical protein	NA	NA	NA	NA	NA
AYR46719.1|1556219_1556666_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYR46720.1|1556665_1557130_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYR46721.1|1557126_1557381_+	hypothetical protein	NA	NA	NA	NA	NA
AYR46722.1|1557370_1558798_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYR46723.1|1558797_1559319_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYR46724.1|1559321_1559603_+	hypothetical protein	NA	NA	NA	NA	NA
AYR46725.1|1559700_1560036_+	hypothetical protein	NA	NA	NA	NA	NA
AYR46726.1|1560211_1562677_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYR46727.1|1562676_1563561_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYR46728.1|1563557_1563773_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYR46729.1|1563760_1564915_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYR46730.1|1564911_1565439_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYR46731.1|1565495_1565843_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYR46732.1|1565833_1566937_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYR46733.1|1566929_1567508_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYR46734.1|1567510_1568536_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYR46735.1|1569049_1569667_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYR46736.1|1570705_1571278_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYR46737.1|1571558_1572941_+	amino acid permease	NA	NA	NA	NA	NA
AYR46738.1|1573002_1573338_-	hypothetical protein	NA	NA	NA	NA	NA
AYR46739.1|1573464_1574196_+	two-component response regulator	NA	NA	NA	NA	NA
AYR46740.1|1574676_1575828_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYR46741.1|1575980_1577687_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYR46742.1|1577794_1579099_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYR46743.1|1579174_1580104_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYR46744.1|1580100_1581504_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYR46745.1|1581671_1583318_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYR46746.1|1583517_1584693_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYR46747.1|1584795_1586304_+	hypothetical protein	NA	NA	NA	NA	NA
AYR46748.1|1587009_1588011_+	adenosine deaminase	NA	NA	NA	NA	NA
AYR46749.1|1588084_1589200_-	oxidoreductase	NA	NA	NA	NA	NA
AYR46750.1|1589302_1589458_+	hypothetical protein	NA	NA	NA	NA	NA
AYR46751.1|1589756_1589972_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYR46752.1|1590060_1590501_+	hypothetical protein	NA	NA	NA	NA	NA
AYR46753.1|1590577_1591159_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYR46754.1|1591158_1591737_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYR46755.1|1591729_1593751_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYR46756.1|1593751_1594810_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYR46757.1|1594813_1595434_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYR46758.1|1595436_1596129_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYR46759.1|1596128_1596764_+	endonuclease III	NA	NA	NA	NA	NA
AYR46760.1|1597364_1598870_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYR46761.1|1598974_1599580_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYR46762.1|1600328_1601603_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029942	Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 chromosome, complete genome	4786232	1782640	1787052	4786232		Escherichia_phage(50.0%)	6	NA	NA
AYR46946.1|1782640_1782880_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYR46947.1|1783752_1784562_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYR46948.1|1784634_1785012_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYR46949.1|1785159_1785702_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYR46950.1|1785893_1786622_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYR46951.1|1786638_1787052_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029942	Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 chromosome, complete genome	4786232	1990905	1998139	4786232		Morganella_phage(33.33%)	7	NA	NA
AYR47141.1|1990905_1992336_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYR47142.1|1992409_1993105_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYR47143.1|1993184_1993496_-	hypothetical protein	NA	NA	NA	NA	NA
AYR47144.1|1994146_1995331_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYR47145.1|1995790_1996003_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYR47146.1|1996448_1997717_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYR47147.1|1997719_1998139_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029942	Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 chromosome, complete genome	4786232	2104440	2114947	4786232		Enterobacteria_phage(37.5%)	10	NA	NA
AYR47244.1|2104440_2105754_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYR47245.1|2105780_2106860_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYR47246.1|2106864_2107638_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYR47247.1|2107653_2108628_-	reductase RfbI	NA	NA	NA	NA	NA
AYR47248.1|2108633_2109185_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYR47249.1|2109185_2110064_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYR47250.1|2110111_2111011_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYR47251.1|2111010_2112096_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYR47252.1|2112472_2113366_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYR47253.1|2113543_2114947_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029942	Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 chromosome, complete genome	4786232	2192176	2201347	4786232	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYR47313.1|2192176_2194210_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYR47314.1|2194450_2194909_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYR47315.1|2195080_2195611_+	lipoprotein	NA	NA	NA	NA	NA
AYR47316.1|2195667_2196135_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYR47317.1|2196181_2196901_-	two-component system response regulator	NA	NA	NA	NA	NA
AYR47318.1|2196897_2198583_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYR47319.1|2198805_2199537_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYR47320.1|2199596_2199704_+	hypothetical protein	NA	NA	NA	NA	NA
AYR47321.1|2199684_2200416_-	ABC transporter permease	NA	NA	NA	NA	NA
AYR47322.1|2200399_2201347_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029942	Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 chromosome, complete genome	4786232	2736784	2750176	4786232	tail	Salmonella_phage(70.0%)	11	NA	NA
AYR47751.1|2736784_2737003_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYR47752.1|2737093_2738194_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYR47753.1|2738190_2738676_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYR47754.1|2738672_2741750_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYR47755.1|2741742_2741862_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYR47756.1|2741876_2742179_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYR47757.1|2742233_2742749_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYR47758.1|2742758_2743931_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYR47759.1|2744073_2744646_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYR47760.1|2745323_2746439_+	glycosyltransferase	NA	NA	NA	NA	NA
AYR47761.1|2746519_2750176_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029942	Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 chromosome, complete genome	4786232	3068675	3112378	4786232	transposase,tRNA,protease,bacteriocin	Bacillus_virus(33.33%)	44	NA	NA
AYR48051.1|3068675_3069134_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR48052.1|3069323_3070403_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYR48053.1|3070504_3071668_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYR48054.1|3071689_3072736_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYR48055.1|3073109_3073535_+	hypothetical protein	NA	NA	NA	NA	NA
AYR48056.1|3073560_3074139_+	hypothetical protein	NA	NA	NA	NA	NA
AYR48057.1|3074172_3074847_+	hypothetical protein	NA	NA	NA	NA	NA
AYR48058.1|3074828_3075512_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYR48059.1|3075505_3076162_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYR48060.1|3076266_3076725_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR48061.1|3076913_3078905_-	transketolase	NA	NA	NA	NA	NA
AYR48062.1|3079180_3079939_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYR48063.1|3080039_3080960_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYR48064.1|3081187_3083164_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYR48065.1|3083172_3083304_-	hypothetical protein	NA	NA	NA	NA	NA
AYR48066.1|3083598_3083898_-	membrane protein	NA	NA	NA	NA	NA
AYR48067.1|3083953_3085108_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYR48068.1|3085600_3086995_+	galactose-proton symport	NA	NA	NA	NA	NA
AYR48069.1|3087073_3087571_+	hypothetical protein	NA	NA	NA	NA	NA
AYR48070.1|3087666_3088374_+	endonuclease I	NA	NA	NA	NA	NA
AYR48071.1|3088450_3089182_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYR48072.1|3089201_3090149_+	glutathione synthetase	NA	NA	NA	NA	NA
AYR48073.1|3090364_3090928_+	hypothetical protein	NA	NA	NA	NA	NA
AYR48074.1|3090927_3091344_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYR48075.1|3091390_3092077_-	global regulatory protein	NA	NA	NA	NA	NA
AYR48076.1|3092206_3093187_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYR48077.1|3093204_3093909_+	hypothetical protein	NA	NA	NA	NA	NA
AYR48078.1|3093927_3094494_+	hypothetical protein	NA	NA	NA	NA	NA
AYR48079.1|3094490_3094781_+	hypothetical protein	NA	NA	NA	NA	NA
AYR48080.1|3094788_3095382_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYR48081.1|3095374_3096511_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYR48082.1|3096601_3097609_-	hypothetical protein	NA	NA	NA	NA	NA
AYR48083.1|3097741_3098788_-	L-asparaginase	NA	NA	NA	NA	NA
AYR48084.1|3099106_3099565_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYR48085.1|3099687_3100407_-	hypothetical protein	NA	NA	NA	NA	NA
AYR48086.1|3100456_3100783_-	hypothetical protein	NA	NA	NA	NA	NA
AYR48087.1|3100782_3101502_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYR48088.1|3101656_3102709_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYR48089.1|3102736_3103012_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYR48090.1|3103124_3104210_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYR48091.1|3104426_3105683_+	nucleoside permease	NA	NA	NA	NA	NA
AYR48092.1|3108293_3109001_+	hypothetical protein	NA	NA	NA	NA	NA
AYR48093.1|3111590_3111857_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYR48094.1|3112099_3112378_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029942	Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 chromosome, complete genome	4786232	3489697	3527755	4786232	transposase,integrase,portal,tail,plate,terminase,capsid	Salmonella_phage(82.05%)	46	3484661:3484675	3496827:3496841
3484661:3484675	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYR48422.1|3489697_3491344_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYR48423.1|3491483_3491582_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYR48424.1|3491837_3492167_+	hypothetical protein	NA	NA	NA	NA	NA
AYR48425.1|3492207_3493260_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYR48426.1|3493655_3494225_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYR48427.1|3494350_3494572_+	hypothetical protein	NA	NA	NA	NA	NA
AYR48428.1|3494604_3495114_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYR48429.1|3495288_3495513_+	hypothetical protein	NA	NA	NA	NA	NA
AYR48430.1|3495535_3495877_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYR48431.1|3495944_3496178_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYR48432.1|3496177_3496405_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYR48433.1|3496401_3497259_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3496827:3496841	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYR48434.1|3497255_3499670_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYR48435.1|3499823_3500012_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYR48436.1|3501979_3502894_+	hypothetical protein	NA	NA	NA	NA	NA
AYR48437.1|3502890_3503631_+	hypothetical protein	NA	NA	NA	NA	NA
AYR48438.1|3503665_3504703_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYR48439.1|3504702_3506469_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYR48440.1|3506611_3507445_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYR48441.1|3507461_3508520_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYR48442.1|3508523_3509174_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYR48443.1|3509206_3509734_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYR48444.1|3509733_3509937_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYR48445.1|3509940_3510156_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYR48446.1|3510175_3510649_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYR48447.1|3510650_3511028_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYR48448.1|3511024_3511453_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYR48449.1|3511548_3511980_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYR48450.1|3511972_3512419_+|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYR48451.1|3512487_3513066_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYR48452.1|3513062_3513422_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYR48453.1|3513408_3514317_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYR48454.1|3514309_3514915_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYR48455.1|3514911_3516426_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYR48456.1|3516425_3517019_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYR48457.1|3516990_3517431_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYR48458.1|3517853_3518426_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYR48459.1|3518568_3519741_+|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYR48460.1|3519750_3520266_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYR48461.1|3520320_3520623_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYR48462.1|3520637_3520757_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYR48463.1|3520749_3523827_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYR48464.1|3523823_3524309_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYR48465.1|3524305_3525406_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYR48466.1|3525496_3525715_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYR48467.1|3527296_3527755_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029942	Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 chromosome, complete genome	4786232	4444779	4519036	4786232	integrase,portal,tail,plate,terminase,capsid	Salmonella_phage(82.98%)	76	4506280:4506296	4519195:4519211
AYR49242.1|4444779_4446729_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYR49243.1|4446800_4447709_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49244.1|4447782_4448682_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49245.1|4448723_4449083_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49246.1|4449182_4449452_-	hypothetical protein	NA	NA	NA	NA	NA
AYR49247.1|4449583_4450858_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYR49248.1|4451077_4451455_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49249.1|4451541_4451760_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYR49250.1|4451827_4452928_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYR49251.1|4452924_4453410_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYR49252.1|4453409_4456190_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYR49253.1|4456182_4456302_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYR49254.1|4456316_4456619_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYR49255.1|4456673_4457189_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYR49256.1|4457198_4458371_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYR49257.1|4458905_4459628_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYR49258.1|4459825_4460233_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYR49259.1|4460239_4461859_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYR49260.1|4461855_4462461_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYR49261.1|4462453_4463362_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYR49262.1|4463348_4463708_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYR49263.1|4463704_4464283_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYR49264.1|4464351_4464798_-|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYR49265.1|4464790_4465222_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYR49266.1|4465317_4465743_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYR49267.1|4465742_4466120_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYR49268.1|4466124_4466595_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYR49269.1|4466614_4466830_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYR49270.1|4466833_4467037_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYR49271.1|4467036_4467501_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYR49272.1|4467594_4468245_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYR49273.1|4468248_4469313_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYR49274.1|4469329_4470163_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYR49275.1|4470305_4472072_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYR49276.1|4472068_4473115_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYR49277.1|4473163_4473859_-	hypothetical protein	NA	NA	NA	NA	NA
AYR49278.1|4473878_4474943_-	hypothetical protein	NA	NA	NA	NA	NA
AYR49279.1|4474939_4476004_-	hypothetical protein	NA	NA	NA	NA	NA
AYR49280.1|4476928_4477258_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYR49281.1|4477254_4479324_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYR49282.1|4479314_4480175_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYR49283.1|4480171_4480756_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYR49284.1|4480752_4480980_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYR49285.1|4480979_4481213_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYR49286.1|4481280_4481622_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYR49287.1|4481585_4481786_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYR49288.1|4481793_4482303_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYR49289.1|4482335_4482578_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYR49290.1|4482694_4483327_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYR49291.1|4483330_4484356_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYR49292.1|4484462_4484816_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYR49293.1|4485432_4485720_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49294.1|4485730_4486621_+	methyltransferase	NA	NA	NA	NA	NA
AYR49295.1|4486620_4487367_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49296.1|4487668_4489639_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYR49297.1|4489658_4490963_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYR49298.1|4490985_4491681_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYR49299.1|4491706_4492501_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYR49300.1|4492510_4493578_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYR49301.1|4493622_4495359_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYR49302.1|4495358_4497854_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYR49303.1|4497877_4498924_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYR49304.1|4498926_4500204_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYR49305.1|4500448_4500988_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYR49306.1|4501841_4503353_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYR49307.1|4503336_4504926_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49308.1|4505089_4506103_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4506280:4506296	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYR49309.1|4506529_4506823_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49310.1|4506819_4507308_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49311.1|4507487_4507940_-	hypothetical protein	NA	NA	NA	NA	NA
AYR49312.1|4513162_4513624_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49313.1|4513620_4513842_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYR49314.1|4514698_4515481_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49315.1|4516107_4516332_-	hypothetical protein	NA	NA	NA	NA	NA
AYR49316.1|4516461_4517466_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
AYR49317.1|4517776_4519036_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4519195:4519211	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 12
CP029942	Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 chromosome, complete genome	4786232	4661288	4671547	4786232	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYR49454.1|4661288_4662365_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYR49455.1|4662361_4663435_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYR49456.1|4663409_4664573_-	hypothetical protein	NA	NA	NA	NA	NA
AYR49457.1|4664848_4665415_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYR49458.1|4665430_4665670_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYR49459.1|4665673_4666534_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYR49460.1|4666956_4667280_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYR49461.1|4667263_4667764_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYR49462.1|4667760_4667988_+	hypothetical protein	NA	NA	NA	NA	NA
AYR49463.1|4667984_4668305_+	P4 phage protein	NA	NA	NA	NA	NA
AYR49464.1|4668319_4668994_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYR49465.1|4668990_4670652_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYR49466.1|4671388_4671547_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
>prophage 1
CP029941	Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 plasmid pHCM1, complete sequence	217175	3612	57130	217175	holin,transposase	Escherichia_phage(43.75%)	56	NA	NA
AYR45117.1|3612_3888_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR45118.1|3806_4310_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	98.8	6.3e-94
AYR45119.1|4636_4861_-	hypothetical protein	NA	NA	NA	NA	NA
AYR45120.1|5516_5777_-	hypothetical protein	NA	NA	NA	NA	NA
AYR45121.1|5865_6357_-	hypothetical protein	NA	NA	NA	NA	NA
AYR45122.1|6361_6670_-	hypothetical protein	NA	NA	NA	NA	NA
AYR45123.1|6877_7258_-	hypothetical protein	NA	NA	NA	NA	NA
AYR45124.1|7343_7592_-	hypothetical protein	NA	NA	NA	NA	NA
AYR45125.1|7629_7851_-	hypothetical protein	NA	S4TRP7	Salmonella_phage	40.3	8.2e-06
AYR45126.1|8013_8397_-	hypothetical protein	NA	NA	NA	NA	NA
AYR45127.1|8711_8936_-	hypothetical protein	NA	NA	NA	NA	NA
AYR45128.1|9022_9487_-	hypothetical protein	NA	NA	NA	NA	NA
AYR45129.1|9669_12099_-	hypothetical protein	NA	NA	NA	NA	NA
AYR45130.1|12221_12668_-	hypothetical protein	NA	NA	NA	NA	NA
AYR45131.1|12715_13522_-	hypothetical protein	NA	NA	NA	NA	NA
AYR45132.1|13749_13992_-	hypothetical protein	NA	NA	NA	NA	NA
AYR45133.1|14069_14402_-	hypothetical protein	NA	NA	NA	NA	NA
AYR45134.1|14901_16083_-	hypothetical protein	NA	NA	NA	NA	NA
AYR45135.1|16091_16388_-	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	35.1	4.9e-06
AYR45136.1|16451_16919_-	hypothetical protein	NA	NA	NA	NA	NA
AYR45137.1|17778_18555_+	hypothetical protein	NA	NA	NA	NA	NA
AYR45138.1|18704_19481_+	hypothetical protein	NA	NA	NA	NA	NA
AYR45139.1|19669_20011_+	hypothetical protein	NA	NA	NA	NA	NA
AYR45140.1|20111_20375_+	hypothetical protein	NA	M9UXL5	Escherichia_phage	45.1	2.1e-08
AYR45141.1|20608_21307_+	hypothetical protein	NA	A0A1W6DXB8	Sphingobium_phage	25.2	4.2e-11
AYR45142.1|21461_21758_-	hypothetical protein	NA	NA	NA	NA	NA
AYR45143.1|21845_24230_-	periplasmic protein	NA	NA	NA	NA	NA
AYR45144.1|24480_25089_+	hypothetical protein	NA	NA	NA	NA	NA
AYR45145.1|25201_25498_+	hypothetical protein	NA	NA	NA	NA	NA
AYR45146.1|25502_26099_+	hypothetical protein	NA	NA	NA	NA	NA
AYR45147.1|26490_27372_+	replication protein	NA	J9Q7H0	Salmonella_phage	41.3	6.5e-54
AYR45148.1|27957_28473_-	hypothetical protein	NA	NA	NA	NA	NA
AYR45149.1|29123_31580_-	periplasmic protein	NA	NA	NA	NA	NA
AYR45150.1|32216_33971_-	DNA restriction methylase	NA	J9Q747	Salmonella_phage	30.9	1.1e-68
AYR45151.1|34156_35314_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	24.6	1.1e-19
AYR45152.1|35673_36498_+	DNA modification methylase	NA	A0A2P9J4Y7	Pectobacterium_phage	37.6	2.8e-46
AYR45153.1|36512_37334_-	hypothetical protein	NA	NA	NA	NA	NA
AYR45154.1|37616_38324_-	hypothetical protein	NA	NA	NA	NA	NA
AYR45155.1|38538_39615_-	hypothetical protein	NA	A0A1P8DTT7	Salmonella_phage	31.8	7.8e-09
AYR45156.1|40149_41025_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	43.5	1.6e-60
AYR45157.1|41278_41860_-	hypothetical protein	NA	NA	NA	NA	NA
AYR45158.1|42466_42820_+	hypothetical protein	NA	NA	NA	NA	NA
AYR45159.1|42871_43189_+	hypothetical protein	NA	NA	NA	NA	NA
AYR45160.1|43188_43986_+	pilus assembly protein	NA	NA	NA	NA	NA
AYR45161.1|43988_45221_+	hypothetical protein	NA	NA	NA	NA	NA
AYR45162.1|45222_45663_+	hypothetical protein	NA	NA	NA	NA	NA
AYR45163.1|45640_47011_+	TrhB	NA	NA	NA	NA	NA
AYR45164.1|47019_47532_+	hypothetical protein	NA	NA	NA	NA	NA
AYR45165.1|47532_48390_+	plasmid transfer protein	NA	NA	NA	NA	NA
AYR45166.1|48399_49350_+	hypothetical protein	NA	NA	NA	NA	NA
AYR45167.1|49358_52040_+	hypothetical protein	NA	NA	NA	NA	NA
AYR45168.1|52673_52949_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	93.4	1.9e-44
AYR45169.1|53077_55081_+|holin	transporter, betaine/carnitine/choline family	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.5e-21
AYR45170.1|55143_56439_+	hypothetical protein	NA	NA	NA	NA	NA
AYR45171.1|56432_56936_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	99.4	9.7e-95
AYR45172.1|56854_57130_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
>prophage 2
CP029941	Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 plasmid pHCM1, complete sequence	217175	82223	134676	217175	transposase,integrase	Escherichia_phage(50.0%)	63	107127:107141	131627:131641
AYR45192.1|82223_82727_-|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYR45193.1|82645_82921_-|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR45194.1|82962_84819_+	hypothetical protein	NA	S5MMD7	Bacillus_phage	26.4	2.2e-19
AYR45195.1|85216_86092_+	hypothetical protein	NA	NA	NA	NA	NA
AYR45196.1|86150_86528_+	hypothetical protein	NA	NA	NA	NA	NA
AYR45197.1|86588_87575_+	hypothetical protein	NA	NA	NA	NA	NA
AYR45198.1|87634_88687_+	hypothetical protein	NA	NA	NA	NA	NA
AYR45199.1|88725_88995_+	hypothetical protein	NA	NA	NA	NA	NA
AYR45200.1|89065_90193_+	hypothetical protein	NA	NA	NA	NA	NA
AYR45201.1|90270_92283_+	hypothetical protein	NA	NA	NA	NA	NA
AYR45202.1|92354_92576_+	hypothetical protein	NA	NA	NA	NA	NA
AYR45203.1|92690_93923_+	hypothetical protein	NA	A0A0H5AWB1	Pseudomonas_phage	29.7	3.0e-12
AYR45204.1|94197_94722_+	hypothetical protein	NA	NA	NA	NA	NA
AYR45205.1|94712_95678_+	hypothetical protein	NA	NA	NA	NA	NA
AYR45206.1|95748_96684_+	hypothetical protein	NA	NA	NA	NA	NA
AYR45207.1|96761_97682_+	hypothetical protein	NA	NA	NA	NA	NA
AYR45208.1|97754_98690_+	hypothetical protein	NA	NA	NA	NA	NA
AYR45209.1|98866_99823_+	hypothetical protein	NA	NA	NA	NA	NA
AYR45210.1|100235_100505_+	hypothetical protein	NA	NA	NA	NA	NA
AYR45211.1|100559_101150_+	hypothetical protein	NA	NA	NA	NA	NA
AYR45212.1|101157_101415_+	hypothetical protein	NA	NA	NA	NA	NA
AYR45213.1|101488_102025_+	hypothetical protein	NA	NA	NA	NA	NA
AYR45214.1|102041_102497_+	hypothetical protein	NA	NA	NA	NA	NA
AYR45215.1|102480_102708_+	hypothetical protein	NA	NA	NA	NA	NA
AYR45216.1|102756_103011_-	hypothetical protein	NA	NA	NA	NA	NA
AYR45217.1|103078_104038_+	hypothetical protein	NA	NA	NA	NA	NA
AYR45218.1|104048_104957_+	hypothetical protein	NA	NA	NA	NA	NA
AYR45219.1|105261_106443_-	recombinase	NA	NA	NA	NA	NA
AYR45220.1|106657_106870_+	regulatory protein	NA	NA	NA	NA	NA
107127:107141	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
AYR45221.1|107176_107452_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	98.9	7.7e-46
107127:107141	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
AYR45222.1|107370_107874_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	100.0	1.5e-95
AYR45223.1|107980_108415_-	transcriptional regulator MerR	NA	NA	NA	NA	NA
AYR45224.1|108432_108837_+	MerT	NA	NA	NA	NA	NA
AYR45225.1|108850_109126_+	mercuric transport protein	NA	NA	NA	NA	NA
AYR45226.1|109161_109584_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AYR45227.1|109635_111330_+	mercuric reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AYR45228.1|111347_111710_+	transcriptional regulator MerD	NA	NA	NA	NA	NA
AYR45229.1|111706_111943_+	mercury resistance protein	NA	NA	NA	NA	NA
AYR45230.1|111939_112647_+	hypothetical protein	NA	NA	NA	NA	NA
AYR45231.1|112685_113990_+|integrase	integrase	integrase	NA	NA	NA	NA
AYR45232.1|114018_114741_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYR45233.1|115496_116348_+	replication protein	NA	NA	NA	NA	NA
AYR45234.1|116655_117471_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
AYR45235.1|117531_118335_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYR45236.1|118334_119171_+	streptomycin phosphotransferase	NA	NA	NA	NA	NA
AYR45237.1|119231_119954_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYR45238.1|120533_121394_-	beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
120988:121002	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
AYR45239.1|121576_121843_-	resolvase	NA	Q1MVP4	Enterobacteria_phage	100.0	1.4e-36
120988:121002	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
AYR45240.1|121875_122598_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYR45241.1|122831_123758_-	sulfonamide-resistant dihydropteroate synthase sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	7.2e-11
AYR45242.1|123664_124045_-	Ethidium bromide-methyl viologen resistance protein EmrE	NA	NA	NA	NA	NA
AYR45243.1|124241_124841_-	dihydrofolate reductase	NA	A0A1B2IAU3	Erwinia_phage	32.8	5.3e-15
AYR45244.1|124872_125886_+|integrase	phage integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYR45245.1|125875_126439_+	transposon tn21 modulator protein	NA	NA	NA	NA	NA
AYR45246.1|126564_127125_+	Tn21 resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AYR45247.1|127127_130094_+|transposase	transposase tn21	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
AYR45248.1|130160_130538_+	hypothetical protein	NA	NA	NA	NA	NA
AYR45249.1|130738_131398_-	chloramphenicol acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
AYR45250.1|131676_131952_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR45251.1|131870_132374_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	99.4	1.3e-94
AYR45252.1|132955_133711_+	replication protein	NA	I3WF20	Macacine_betaherpesvirus	94.8	1.9e-134
AYR45253.1|133978_134254_+|transposase	IS1 transposase	transposase	Q71TE9	Escherichia_phage	100.0	3.1e-47
AYR45254.1|134172_134676_+|transposase	IS1 transposase	transposase	Q71TF0	Escherichia_phage	92.8	1.4e-88
