The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029853	Salmonella enterica subsp. enterica serovar Typhi strain 343077_281186 chromosome, complete genome	4829489	868659	875971	4829489	protease,integrase	Dickeya_phage(16.67%)	6	869910:869924	881089:881103
AYU02619.1|868659_869778_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYU02620.1|869774_871721_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
869910:869924	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYU02621.1|871850_872072_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYU02622.1|872395_872716_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYU02623.1|872746_875023_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYU02624.1|875593_875971_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
881089:881103	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029853	Salmonella enterica subsp. enterica serovar Typhi strain 343077_281186 chromosome, complete genome	4829489	946871	1024184	4829489	tail,integrase,protease,transposase,terminase	Salmonella_phage(73.33%)	93	928950:928969	999545:999564
928950:928969	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYU02674.1|946871_948212_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYU02675.1|948208_948457_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYU02676.1|948497_948743_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYU02677.1|948742_949624_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYU02678.1|949620_950685_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYU02679.1|950762_951443_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYU02680.1|951439_952225_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYU02681.1|952230_952527_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYU02682.1|952617_952818_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYU02683.1|953106_953511_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYU02684.1|953842_954217_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYU02685.1|954301_955285_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYU02686.1|955287_956037_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYU02687.1|956047_956395_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYU02688.1|956391_956916_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYU02689.1|956915_957389_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYU02690.1|957392_957965_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYU02691.1|958058_958325_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYU02692.1|958406_958568_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU02693.1|959000_959498_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU02694.1|959682_959922_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYU02695.1|959911_960217_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYU02696.1|960256_960859_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYU02697.1|961067_961679_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYU02698.1|961811_962609_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYU02699.1|963007_963133_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU02700.1|963268_963718_-	lipoprotein	NA	NA	NA	NA	NA
AYU02701.1|963934_964324_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYU02702.1|964310_964592_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYU02703.1|964591_965206_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYU02704.1|965425_965680_+	hypothetical protein	NA	NA	NA	NA	NA
AYU02705.1|965784_966162_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYU02706.1|966225_966486_+	hypothetical protein	NA	NA	NA	NA	NA
AYU02707.1|966575_967328_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYU02708.1|967293_968697_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYU02709.1|968696_970163_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	96.7	6.4e-272
AYU02710.1|970257_970788_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYU02711.1|970802_972035_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYU02712.1|972039_972537_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYU02713.1|972548_973490_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYU02714.1|973531_973900_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYU02715.1|973865_974273_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYU02716.1|974269_974824_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYU02717.1|974810_975200_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYU02718.1|975174_975738_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYU02719.1|975741_976887_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYU02720.1|976898_977339_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYU02721.1|977342_977795_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYU02722.1|977972_979925_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYU02723.1|979924_980575_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYU02724.1|980578_980881_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYU02725.1|980883_981915_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYU02726.1|981911_982247_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYU02727.1|982441_983173_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU02728.1|983172_983601_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU02729.1|983659_984415_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYU02730.1|984502_984640_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYU02731.1|984655_985009_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYU02732.1|985009_986209_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.2	2.5e-213
AYU02733.1|986205_986886_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYU02734.1|986885_988397_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.1	1.7e-110
AYU02735.1|988411_988930_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYU02736.1|989851_990553_-	hypothetical protein	NA	NA	NA	NA	NA
AYU02737.1|990865_991144_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYU02738.1|991569_994182_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYU02739.1|994389_995400_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYU02740.1|995562_996108_+	hypothetical protein	NA	NA	NA	NA	NA
AYU02741.1|996104_997214_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYU02742.1|997312_999421_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYU02743.1|999433_1001341_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
999545:999564	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYU02744.1|1001355_1002609_+	inner membrane protein	NA	NA	NA	NA	NA
AYU02745.1|1002613_1004254_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYU02746.1|1004250_1004814_+	lipoprotein	NA	NA	NA	NA	NA
AYU02747.1|1005067_1005235_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYU02748.1|1005334_1005853_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYU02749.1|1005921_1007682_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYU02750.1|1007867_1008320_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYU02751.1|1008391_1009444_-	outer membrane protein A	NA	NA	NA	NA	NA
AYU02752.1|1009798_1010308_-	cell division inhibitor	NA	NA	NA	NA	NA
AYU02753.1|1010524_1011130_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYU02754.1|1011116_1013270_-	inner membrane protein	NA	NA	NA	NA	NA
AYU02755.1|1013288_1013735_-	hypothetical protein	NA	NA	NA	NA	NA
AYU02756.1|1013858_1015913_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYU02757.1|1015948_1016407_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYU02758.1|1016501_1017164_-	hypothetical protein	NA	NA	NA	NA	NA
AYU02759.1|1017334_1017751_+	hypothetical protein	NA	NA	NA	NA	NA
AYU02760.1|1017795_1018113_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYU02761.1|1018170_1019382_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYU02762.1|1020513_1020972_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU02763.1|1021708_1021990_+	acylphosphatase	NA	NA	NA	NA	NA
AYU02764.1|1021986_1022316_-	sulfite reductase	NA	NA	NA	NA	NA
AYU02765.1|1022402_1023062_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYU02766.1|1023725_1024184_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029853	Salmonella enterica subsp. enterica serovar Typhi strain 343077_281186 chromosome, complete genome	4829489	1467480	1540594	4829489	tail,tRNA,protease,plate,head,transposase	Burkholderia_virus(43.24%)	80	NA	NA
AYU03164.1|1467480_1467939_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU03165.1|1468441_1468723_+	stress response protein	NA	NA	NA	NA	NA
AYU03166.1|1468991_1469813_+|protease	serine protease	protease	NA	NA	NA	NA
AYU03167.1|1469847_1470177_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYU03168.1|1470163_1470526_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYU03169.1|1470637_1470808_-	hypothetical protein	NA	NA	NA	NA	NA
AYU03170.1|1470942_1471977_+	hypothetical protein	NA	NA	NA	NA	NA
AYU03171.1|1472151_1473540_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYU03172.1|1473550_1475080_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYU03173.1|1475606_1476551_+	hypothetical protein	NA	NA	NA	NA	NA
AYU03174.1|1476732_1477122_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYU03175.1|1477093_1477546_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYU03176.1|1477740_1477971_-	hypothetical protein	NA	NA	NA	NA	NA
AYU03177.1|1477967_1478651_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYU03178.1|1478647_1478863_-	hypothetical protein	NA	NA	NA	NA	NA
AYU03179.1|1478855_1479239_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
AYU03180.1|1479235_1479538_-	hypothetical protein	NA	NA	NA	NA	NA
AYU03181.1|1479547_1479820_-	hypothetical protein	NA	NA	NA	NA	NA
AYU03182.1|1480108_1480639_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYU03183.1|1480666_1480936_-	hypothetical protein	NA	NA	NA	NA	NA
AYU03184.1|1480938_1482105_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYU03185.1|1482115_1483885_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYU03186.1|1484062_1484494_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
AYU03187.1|1484489_1485086_+	hypothetical protein	NA	NA	NA	NA	NA
AYU03188.1|1485329_1485680_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYU03189.1|1486394_1487045_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYU03190.1|1487041_1487368_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AYU03191.1|1487367_1487679_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYU03192.1|1487678_1488224_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYU03193.1|1488220_1489816_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYU03194.1|1489815_1491312_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYU03195.1|1491292_1492114_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYU03196.1|1492116_1492575_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.2e-30
AYU03197.1|1492789_1493905_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYU03198.1|1493919_1494873_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYU03199.1|1494882_1495221_+	hypothetical protein	NA	NA	NA	NA	NA
AYU03200.1|1495222_1495669_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYU03201.1|1495668_1496133_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYU03202.1|1496129_1496384_+	hypothetical protein	NA	NA	NA	NA	NA
AYU03203.1|1496373_1497801_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYU03204.1|1497800_1498322_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYU03205.1|1498324_1498606_+	hypothetical protein	NA	NA	NA	NA	NA
AYU03206.1|1498703_1499039_+	hypothetical protein	NA	NA	NA	NA	NA
AYU03207.1|1499214_1501680_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.5	1.1e-167
AYU03208.1|1501679_1502564_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYU03209.1|1502560_1502776_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYU03210.1|1502763_1503918_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYU03211.1|1503914_1504442_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYU03212.1|1504498_1504846_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYU03213.1|1504836_1505940_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYU03214.1|1505932_1506511_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYU03215.1|1506513_1507539_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYU03216.1|1508052_1508670_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYU03217.1|1509696_1510269_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYU03218.1|1510549_1511932_+	amino acid permease	NA	NA	NA	NA	NA
AYU03219.1|1511993_1512329_-	hypothetical protein	NA	NA	NA	NA	NA
AYU03220.1|1512455_1513187_+	two-component response regulator	NA	NA	NA	NA	NA
AYU03221.1|1513667_1514819_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	4.2e-117
AYU03222.1|1514971_1516678_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYU03223.1|1516785_1518090_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYU03224.1|1518165_1519095_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYU03225.1|1519091_1520495_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYU03226.1|1520662_1522309_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYU03227.1|1522508_1523684_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYU03228.1|1523786_1525295_+	hypothetical protein	NA	NA	NA	NA	NA
AYU03229.1|1526000_1527002_+	adenosine deaminase	NA	NA	NA	NA	NA
AYU03230.1|1527075_1528191_-	oxidoreductase	NA	NA	NA	NA	NA
AYU03231.1|1528293_1528449_+	hypothetical protein	NA	NA	NA	NA	NA
AYU03232.1|1528747_1528963_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYU03233.1|1529051_1529492_+	hypothetical protein	NA	NA	NA	NA	NA
AYU03234.1|1529568_1530150_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYU03235.1|1530149_1530728_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYU03236.1|1530720_1532742_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYU03237.1|1532742_1533801_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYU03238.1|1533804_1534425_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYU03239.1|1534427_1535120_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYU03240.1|1535119_1535755_+	endonuclease III	NA	NA	NA	NA	NA
AYU03241.1|1536355_1537861_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYU03242.1|1537965_1538571_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYU03243.1|1539319_1540594_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029853	Salmonella enterica subsp. enterica serovar Typhi strain 343077_281186 chromosome, complete genome	4829489	1721625	1726037	4829489		Escherichia_phage(50.0%)	6	NA	NA
AYU03427.1|1721625_1721865_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
AYU03428.1|1722737_1723547_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYU03429.1|1723619_1723997_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYU03430.1|1724144_1724687_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYU03431.1|1724878_1725607_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYU03432.1|1725623_1726037_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029853	Salmonella enterica subsp. enterica serovar Typhi strain 343077_281186 chromosome, complete genome	4829489	1826112	1862199	4829489	integrase,holin	Salmonella_phage(36.59%)	47	1852665:1852678	1867724:1867737
AYU03519.1|1826112_1826466_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	86.5	1.0e-29
AYU03520.1|1826465_1827533_-	bacteriophage protein	NA	A0A0M4QX01	Salmonella_phage	82.8	7.7e-158
AYU03521.1|1827535_1827838_-	bacteriophage protein	NA	A0A0M4R5B7	Salmonella_phage	92.0	2.2e-49
AYU03522.1|1827837_1828425_-	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	88.0	1.5e-83
AYU03523.1|1828424_1830413_-	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	74.8	1.0e-272
AYU03524.1|1830590_1831043_-	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	72.7	4.7e-56
AYU03525.1|1831046_1831487_-	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
AYU03526.1|1831497_1832643_-	hypothetical protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.5	1.0e-160
AYU03527.1|1832646_1833210_-	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.7	1.7e-79
AYU03528.1|1833184_1833574_-	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	96.1	2.5e-66
AYU03529.1|1833560_1834115_-	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	71.7	8.0e-66
AYU03530.1|1834111_1834519_-	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	94.8	9.7e-69
AYU03531.1|1834893_1835835_-	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	86.9	3.2e-155
AYU03532.1|1835846_1836353_-	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	79.9	3.7e-70
AYU03533.1|1836356_1837577_-	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	88.0	1.2e-199
AYU03534.1|1837591_1838122_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	84.0	1.7e-81
AYU03535.1|1838216_1839683_-	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	92.4	1.8e-261
AYU03536.1|1839682_1841086_-	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	69.2	3.2e-188
AYU03537.1|1841855_1842035_+	hypothetical protein	NA	NA	NA	NA	NA
AYU03538.1|1842024_1842369_-	hypothetical protein	NA	Q8SBD8	Shigella_phage	74.5	1.4e-36
AYU03539.1|1842563_1843040_-	endolysin	NA	Q8SBE0	Shigella_phage	96.2	1.0e-85
AYU03540.1|1843043_1843385_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	89.2	4.0e-52
AYU03541.1|1843732_1844302_-	hypothetical protein	NA	NA	NA	NA	NA
AYU03542.1|1844535_1845225_-	bacteriophage protein	NA	A0A0N7C203	Escherichia_phage	77.9	2.1e-52
AYU03543.1|1845365_1845920_-	hypothetical protein	NA	A0A0U2S606	Escherichia_phage	71.0	1.3e-71
AYU03544.1|1845916_1846207_-	bacteriophage protein	NA	A0A0U2KD41	Escherichia_phage	89.6	3.3e-47
AYU03545.1|1846206_1846806_-	hypothetical protein	NA	A0A0U2RT94	Escherichia_phage	93.0	5.9e-107
AYU03546.1|1846877_1847090_-	hypothetical protein	NA	NA	NA	NA	NA
AYU03547.1|1847367_1847580_-	Hok/Gef family protein	NA	A0A0P0ZAX5	Stx2-converting_phage	95.7	9.6e-28
AYU03548.1|1847948_1848881_+	hypothetical protein	NA	NA	NA	NA	NA
AYU03549.1|1848877_1849432_+	hypothetical protein	NA	NA	NA	NA	NA
AYU03550.1|1849530_1849938_-	bacteriophage protein	NA	A0A2R2Z307	Escherichia_phage	95.8	1.7e-57
AYU03551.1|1849944_1850367_-	hypothetical protein	NA	A0A0U2QQN3	Escherichia_phage	91.3	1.7e-63
AYU03552.1|1850382_1851177_-	hypothetical protein	NA	A0A0U2SAW4	Escherichia_phage	88.5	1.3e-117
AYU03553.1|1851166_1851913_-	DNA replication protein	NA	V5UQI5	Shigella_phage	79.3	2.0e-112
AYU03554.1|1851919_1852708_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.0	3.9e-42
1852665:1852678	attL	TTATCCGGCGTAAT	NA	NA	NA	NA
AYU03555.1|1852785_1853208_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	94.3	3.4e-69
AYU03556.1|1853204_1853447_-	cro repressor	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
AYU03557.1|1853543_1853963_+	regulator	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
AYU03558.1|1854205_1854424_+	hypothetical protein	NA	M4QQ57	Salicola_phage	53.2	2.5e-07
AYU03559.1|1854577_1854790_-	hypothetical protein	NA	NA	NA	NA	NA
AYU03560.1|1855296_1855518_+	cell division inhibitor protein	NA	A0A0U2RTC4	Escherichia_phage	97.3	6.9e-37
AYU03561.1|1855762_1856038_+	bacteriophage protein	NA	A0A0U2QW85	Escherichia_phage	92.3	3.7e-40
AYU03562.1|1856137_1859266_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	79.5	0.0e+00
AYU03563.1|1859262_1860330_+	hypothetical protein	NA	A0A0U2S5Y9	Escherichia_phage	62.5	1.8e-114
AYU03564.1|1860508_1860769_+	gydaC	NA	A0A0U2QL97	Escherichia_phage	97.9	1.7e-18
AYU03565.1|1861122_1862199_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.7	6.9e-98
1867724:1867737	attR	TTATCCGGCGTAAT	NA	NA	NA	NA
>prophage 6
CP029853	Salmonella enterica subsp. enterica serovar Typhi strain 343077_281186 chromosome, complete genome	4829489	2057547	2068054	4829489		Enterobacteria_phage(37.5%)	10	NA	NA
AYU03752.1|2057547_2058861_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYU03753.1|2058887_2059967_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYU03754.1|2059971_2060745_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYU03755.1|2060760_2061735_-	reductase RfbI	NA	NA	NA	NA	NA
AYU03756.1|2061740_2062292_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYU03757.1|2062292_2063171_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYU03758.1|2063218_2064118_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYU03759.1|2064117_2065203_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYU03760.1|2065579_2066473_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYU03761.1|2066650_2068054_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029853	Salmonella enterica subsp. enterica serovar Typhi strain 343077_281186 chromosome, complete genome	4829489	2143946	2153117	4829489	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYU03818.1|2143946_2145980_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYU03819.1|2146220_2146679_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYU03820.1|2146850_2147381_+	lipoprotein	NA	NA	NA	NA	NA
AYU03821.1|2147437_2147905_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYU03822.1|2147951_2148671_-	two-component system response regulator	NA	NA	NA	NA	NA
AYU03823.1|2148667_2150353_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYU03824.1|2150575_2151307_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYU03825.1|2151366_2151474_+	hypothetical protein	NA	NA	NA	NA	NA
AYU03826.1|2151454_2152186_-	ABC transporter permease	NA	NA	NA	NA	NA
AYU03827.1|2152169_2153117_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029853	Salmonella enterica subsp. enterica serovar Typhi strain 343077_281186 chromosome, complete genome	4829489	2688560	2701952	4829489	tail	Salmonella_phage(70.0%)	11	NA	NA
AYU04257.1|2688560_2688779_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYU04258.1|2688869_2689970_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYU04259.1|2689966_2690452_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYU04260.1|2690448_2693526_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
AYU04261.1|2693518_2693638_-	hypothetical protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYU04262.1|2693652_2693955_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYU04263.1|2694009_2694525_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYU04264.1|2694534_2695707_-|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYU04265.1|2695849_2696422_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYU04266.1|2697099_2698215_+	glycosyltransferase	NA	NA	NA	NA	NA
AYU04267.1|2698295_2701952_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029853	Salmonella enterica subsp. enterica serovar Typhi strain 343077_281186 chromosome, complete genome	4829489	3018644	3062347	4829489	protease,tRNA,transposase,bacteriocin	Bacillus_virus(33.33%)	44	NA	NA
AYU04554.1|3018644_3019103_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU04555.1|3019292_3020372_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYU04556.1|3020473_3021637_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYU04557.1|3021658_3022705_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYU04558.1|3023078_3023504_+	hypothetical protein	NA	NA	NA	NA	NA
AYU04559.1|3023529_3024108_+	hypothetical protein	NA	NA	NA	NA	NA
AYU04560.1|3024141_3024816_+	hypothetical protein	NA	NA	NA	NA	NA
AYU04561.1|3024797_3025481_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYU04562.1|3025474_3026131_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYU04563.1|3026235_3026694_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU04564.1|3026882_3028874_-	transketolase	NA	NA	NA	NA	NA
AYU04565.1|3029149_3029908_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYU04566.1|3030008_3030929_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYU04567.1|3031156_3033133_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYU04568.1|3033141_3033273_-	hypothetical protein	NA	NA	NA	NA	NA
AYU04569.1|3033567_3033867_-	membrane protein	NA	NA	NA	NA	NA
AYU04570.1|3033922_3035077_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYU04571.1|3035569_3036964_+	galactose-proton symport	NA	NA	NA	NA	NA
AYU04572.1|3037042_3037540_+	hypothetical protein	NA	NA	NA	NA	NA
AYU04573.1|3037635_3038343_+	endonuclease I	NA	NA	NA	NA	NA
AYU04574.1|3038419_3039151_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYU04575.1|3039170_3040118_+	glutathione synthetase	NA	NA	NA	NA	NA
AYU04576.1|3040333_3040897_+	hypothetical protein	NA	NA	NA	NA	NA
AYU04577.1|3040896_3041313_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYU04578.1|3041359_3042046_-	global regulatory protein	NA	NA	NA	NA	NA
AYU04579.1|3042175_3043156_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYU04580.1|3043173_3043878_+	hypothetical protein	NA	NA	NA	NA	NA
AYU04581.1|3043896_3044463_+	hypothetical protein	NA	NA	NA	NA	NA
AYU04582.1|3044459_3044750_+	hypothetical protein	NA	NA	NA	NA	NA
AYU04583.1|3044757_3045351_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYU04584.1|3045343_3046480_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYU04585.1|3046570_3047578_-	hypothetical protein	NA	NA	NA	NA	NA
AYU04586.1|3047710_3048757_-	L-asparaginase	NA	NA	NA	NA	NA
AYU04587.1|3049075_3049534_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU04588.1|3049656_3050376_-	hypothetical protein	NA	NA	NA	NA	NA
AYU04589.1|3050425_3050752_-	hypothetical protein	NA	NA	NA	NA	NA
AYU04590.1|3050751_3051471_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYU04591.1|3051625_3052678_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYU04592.1|3052705_3052981_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYU04593.1|3053093_3054179_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYU04594.1|3054395_3055652_+	nucleoside permease	NA	NA	NA	NA	NA
AYU04595.1|3058262_3058970_+	hypothetical protein	NA	NA	NA	NA	NA
AYU04596.1|3061559_3061826_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYU04597.1|3062068_3062347_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029853	Salmonella enterica subsp. enterica serovar Typhi strain 343077_281186 chromosome, complete genome	4829489	3439802	3477860	4829489	tail,integrase,plate,capsid,transposase,portal,terminase	Salmonella_phage(82.05%)	46	3434766:3434780	3446932:3446946
3434766:3434780	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYU04926.1|3439802_3441449_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYU04927.1|3441588_3441687_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYU04928.1|3441942_3442272_+	hypothetical protein	NA	NA	NA	NA	NA
AYU04929.1|3442312_3443365_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYU04930.1|3443760_3444330_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYU04931.1|3444455_3444677_+	hypothetical protein	NA	NA	NA	NA	NA
AYU04932.1|3444709_3445219_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYU04933.1|3445393_3445618_+	hypothetical protein	NA	NA	NA	NA	NA
AYU04934.1|3445640_3445982_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYU04935.1|3446049_3446283_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYU04936.1|3446282_3446510_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYU04937.1|3446506_3447364_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3446932:3446946	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYU04938.1|3447360_3449775_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYU04939.1|3449928_3450117_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYU04940.1|3452084_3452999_+	hypothetical protein	NA	NA	NA	NA	NA
AYU04941.1|3452995_3453736_+	hypothetical protein	NA	NA	NA	NA	NA
AYU04942.1|3453770_3454808_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYU04943.1|3454807_3456574_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYU04944.1|3456716_3457550_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYU04945.1|3457566_3458625_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYU04946.1|3458628_3459279_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYU04947.1|3459311_3459839_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYU04948.1|3459838_3460042_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYU04949.1|3460045_3460261_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYU04950.1|3460280_3460754_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYU04951.1|3460755_3461133_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYU04952.1|3461129_3461558_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYU04953.1|3461653_3462085_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYU04954.1|3462077_3462524_+|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYU04955.1|3462592_3463171_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYU04956.1|3463167_3463527_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYU04957.1|3463513_3464422_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYU04958.1|3464414_3465020_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYU04959.1|3465016_3466531_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYU04960.1|3466530_3467124_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYU04961.1|3467095_3467536_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYU04962.1|3467958_3468531_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYU04963.1|3468673_3469846_+|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYU04964.1|3469855_3470371_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYU04965.1|3470425_3470728_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYU04966.1|3470742_3470862_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYU04967.1|3470854_3473932_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
AYU04968.1|3473928_3474414_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYU04969.1|3474410_3475511_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYU04970.1|3475601_3475820_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYU04971.1|3477401_3477860_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029853	Salmonella enterica subsp. enterica serovar Typhi strain 343077_281186 chromosome, complete genome	4829489	4393318	4467495	4829489	tail,integrase,plate,capsid,portal,terminase	Salmonella_phage(82.61%)	75	4454832:4454848	4467654:4467670
AYU05744.1|4393318_4395268_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYU05745.1|4395339_4396248_+	hypothetical protein	NA	NA	NA	NA	NA
AYU05746.1|4396321_4397221_+	hypothetical protein	NA	NA	NA	NA	NA
AYU05747.1|4397262_4397622_+	hypothetical protein	NA	NA	NA	NA	NA
AYU05748.1|4397721_4397991_-	hypothetical protein	NA	NA	NA	NA	NA
AYU05749.1|4398122_4399397_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYU05750.1|4399616_4399994_+	hypothetical protein	NA	NA	NA	NA	NA
AYU05751.1|4400080_4400299_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYU05752.1|4400366_4401467_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYU05753.1|4401463_4401949_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYU05754.1|4401948_4404729_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYU05755.1|4404721_4404841_-	hypothetical protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYU05756.1|4404855_4405158_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYU05757.1|4405212_4405728_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYU05758.1|4405737_4406910_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYU05759.1|4407444_4408167_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYU05760.1|4408364_4408772_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	83.5	3.4e-58
AYU05761.1|4408778_4410398_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYU05762.1|4410394_4411000_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYU05763.1|4410992_4411901_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYU05764.1|4411887_4412247_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYU05765.1|4412243_4412822_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYU05766.1|4412890_4413337_-|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYU05767.1|4413329_4413761_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
AYU05768.1|4413856_4414282_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYU05769.1|4414281_4414659_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYU05770.1|4414663_4415134_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYU05771.1|4415153_4415369_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYU05772.1|4415372_4415576_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYU05773.1|4415575_4416040_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	97.4	7.1e-84
AYU05774.1|4416133_4416784_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYU05775.1|4416787_4417852_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYU05776.1|4417868_4418702_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYU05777.1|4418844_4420611_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYU05778.1|4420607_4421654_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYU05779.1|4421702_4422398_-	hypothetical protein	NA	NA	NA	NA	NA
AYU05780.1|4422417_4423482_-	hypothetical protein	NA	NA	NA	NA	NA
AYU05781.1|4423478_4424543_-	hypothetical protein	NA	NA	NA	NA	NA
AYU05782.1|4425467_4427876_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	95.1	0.0e+00
AYU05783.1|4427866_4428727_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYU05784.1|4428723_4429308_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYU05785.1|4429304_4429532_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYU05786.1|4429531_4429765_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYU05787.1|4429832_4430174_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYU05788.1|4430137_4430338_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYU05789.1|4430345_4430855_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYU05790.1|4430887_4431130_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYU05791.1|4431246_4431879_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYU05792.1|4431882_4432908_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYU05793.1|4433014_4433368_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYU05794.1|4433984_4434272_+	hypothetical protein	NA	NA	NA	NA	NA
AYU05795.1|4434282_4435173_+	methyltransferase	NA	NA	NA	NA	NA
AYU05796.1|4435172_4435919_+	hypothetical protein	NA	NA	NA	NA	NA
AYU05797.1|4436220_4438191_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYU05798.1|4438210_4439515_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYU05799.1|4439537_4440233_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYU05800.1|4440258_4441053_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYU05801.1|4441062_4442130_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYU05802.1|4442174_4443911_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYU05803.1|4443910_4446406_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYU05804.1|4446429_4447476_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYU05805.1|4447478_4448756_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYU05806.1|4449000_4449540_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYU05807.1|4450393_4451905_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYU05808.1|4451888_4453478_+	hypothetical protein	NA	NA	NA	NA	NA
AYU05809.1|4453641_4454655_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4454832:4454848	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYU05810.1|4455081_4455375_+	hypothetical protein	NA	NA	NA	NA	NA
AYU05811.1|4455371_4455860_+	hypothetical protein	NA	NA	NA	NA	NA
AYU05812.1|4456039_4456492_-	hypothetical protein	NA	NA	NA	NA	NA
AYU05813.1|4461714_4462176_+	hypothetical protein	NA	NA	NA	NA	NA
AYU05814.1|4462172_4462394_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYU05815.1|4463250_4464033_+	hypothetical protein	NA	NA	NA	NA	NA
AYU05816.1|4464659_4464884_-	hypothetical protein	NA	NA	NA	NA	NA
AYU05817.1|4465013_4465925_-	hypothetical protein	NA	NA	NA	NA	NA
AYU05818.1|4466235_4467495_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4467654:4467670	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 12
CP029853	Salmonella enterica subsp. enterica serovar Typhi strain 343077_281186 chromosome, complete genome	4829489	4504472	4594058	4829489	tail,tRNA,integrase,protease,plate,head,transposase,portal	Enterobacteria_phage(87.5%)	96	4539912:4539928	4592670:4592686
AYU05854.1|4504472_4505423_+|tRNA	tRNA delta-2-isopentenylpyrophosphate (IPP) transferase	tRNA	NA	NA	NA	NA
AYU05855.1|4505505_4505814_+	RNA-binding protein Hfq	NA	NA	NA	NA	NA
AYU05856.1|4505885_4507166_+	GTPase HflX	NA	NA	NA	NA	NA
AYU05857.1|4507380_4508640_+|protease	FtsH protease regulator HflK	protease	NA	NA	NA	NA
AYU05858.1|4508642_4509647_+|protease	FtsH protease regulator HflC	protease	NA	NA	NA	NA
AYU05859.1|4509725_4509923_+	hypothetical protein	NA	NA	NA	NA	NA
AYU05860.1|4510025_4511324_+	adenylosuccinate synthetase	NA	W5S5V7	Pithovirus	35.6	4.9e-66
AYU05861.1|4511543_4511969_+	transcriptional repressor NsrR	NA	NA	NA	NA	NA
AYU05862.1|4512006_4514445_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	9.9e-68
AYU05863.1|4514535_4515267_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
AYU05864.1|4515398_4515803_+	hypothetical protein	NA	NA	NA	NA	NA
AYU05865.1|4516739_4517423_+	hypothetical protein	NA	NA	NA	NA	NA
AYU05866.1|4517440_4517839_+	hypothetical protein	NA	NA	NA	NA	NA
AYU05867.1|4517848_4518487_+	hypothetical protein	NA	NA	NA	NA	NA
AYU05868.1|4518489_4519653_+	ATP-Grasp family ATPase	NA	B2ZXR7	Ralstonia_phage	43.8	1.5e-82
AYU05869.1|4519737_4521360_+	acyl Co-A dehydrogenase	NA	NA	NA	NA	NA
AYU05870.1|4521404_4521728_-	hypothetical protein	NA	NA	NA	NA	NA
AYU05871.1|4521810_4522140_-	biofilm stress and motility protein A	NA	NA	NA	NA	NA
AYU05872.1|4522323_4523073_+	esterase	NA	NA	NA	NA	NA
AYU05873.1|4523069_4523825_-	transcriptional regulator	NA	NA	NA	NA	NA
AYU05874.1|4523929_4524994_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
AYU05875.1|4525323_4526754_+	transport protein SgaT	NA	NA	NA	NA	NA
AYU05876.1|4526769_4527075_+	PTS system transporter subunit IIB	NA	NA	NA	NA	NA
AYU05877.1|4527084_4527549_+	sugar phosphotransferase	NA	NA	NA	NA	NA
AYU05878.1|4527562_4528213_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
AYU05879.1|4528222_4529077_+	L-xylulose 5-phosphate 3-epimerase	NA	NA	NA	NA	NA
AYU05880.1|4529076_4529763_+	class II aldolase	NA	NA	NA	NA	NA
AYU05881.1|4529892_4530168_-	hypothetical protein	NA	NA	NA	NA	NA
AYU05882.1|4530638_4531034_+	30s ribosomal protein S6	NA	NA	NA	NA	NA
AYU05883.1|4531040_4531355_+	primosomal replication protein N	NA	NA	NA	NA	NA
AYU05884.1|4531359_4531587_+	30s ribosomal subunit protein S18	NA	NA	NA	NA	NA
AYU05885.1|4531628_4532078_+	50s ribosomal subunit protein L9	NA	NA	NA	NA	NA
AYU05886.1|4532225_4533152_+	hypothetical protein	NA	NA	NA	NA	NA
AYU05887.1|4533201_4533837_-	hypothetical protein	NA	NA	NA	NA	NA
AYU05888.1|4534014_4534677_+	FkbP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
AYU05889.1|4534972_4536376_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
AYU05890.1|4536713_4537853_+	hypothetical protein	NA	NA	NA	NA	NA
AYU05891.1|4537867_4539256_+	hypothetical protein	NA	NA	NA	NA	NA
AYU05892.1|4539322_4539985_-	iron-sulfur cluster repair di-iron protein	NA	NA	NA	NA	NA
4539912:4539928	attL	TACTGGCGAAACAGCGC	NA	NA	NA	NA
AYU05893.1|4540087_4541053_-	hypothetical protein	NA	NA	NA	NA	NA
AYU05894.1|4541133_4541982_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
AYU05895.1|4542069_4542456_+	transcriptional regulator	NA	NA	NA	NA	NA
AYU05896.1|4542513_4544457_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
AYU05897.1|4544723_4545464_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
AYU05898.1|4545453_4546011_-	transcriptional regulator	NA	NA	NA	NA	NA
AYU05899.1|4546337_4546544_+	hypothetical protein	NA	NA	NA	NA	NA
AYU05900.1|4546686_4547145_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU05901.1|4547342_4548686_-	hypothetical protein	NA	NA	NA	NA	NA
AYU05902.1|4548882_4549521_-	peptide methionine sulfoxide reductase	NA	NA	NA	NA	NA
AYU05903.1|4549733_4551467_+	hypothetical protein	NA	NA	NA	NA	NA
AYU05904.1|4551463_4555243_+	hypothetical protein	NA	NA	NA	NA	NA
AYU05905.1|4555245_4555590_+	hypothetical protein	NA	NA	NA	NA	NA
AYU05906.1|4556653_4556914_-	prophage late promoter activator protein	NA	NA	NA	NA	NA
AYU05907.1|4556956_4558066_-	phage protein D	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	6.3e-195
AYU05908.1|4558223_4559408_+|tail	Phage tail sheath protein FI	tail	A0A0A7NV69	Enterobacteria_phage	99.7	1.5e-226
AYU05909.1|4559407_4559920_+|tail	major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
AYU05910.1|4559974_4560340_+	hypothetical protein	NA	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
AYU05911.1|4560490_4563298_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	98.0	0.0e+00
AYU05912.1|4563310_4563799_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.1	4.0e-85
AYU05913.1|4564296_4565019_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYU05914.1|4565226_4565634_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	83.5	3.4e-58
AYU05915.1|4565640_4567974_-	hypothetical protein	NA	A0A0A7NV63	Enterobacteria_phage	76.8	4.4e-150
AYU05916.1|4567976_4568507_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	96.9	5.3e-91
AYU05917.1|4568499_4569396_-|plate	phage baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	2.5e-154
AYU05918.1|4569399_4569750_-|plate	Phage baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
AYU05919.1|4569746_4570328_-	hypothetical protein	NA	A0A0A7NRZ3	Enterobacteria_phage	97.9	2.5e-102
AYU05920.1|4570324_4570969_-	phage virion morphogenesis-like protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
AYU05921.1|4570952_4571420_-|tail	tail completion phage protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	1.0e-85
AYU05922.1|4571557_4571965_-	hypothetical protein	NA	A0A0A7NPY2	Enterobacteria_phage	94.1	6.1e-63
AYU05923.1|4571961_4572354_-	peptidase M15	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
AYU05924.1|4572350_4572674_-	hypothetical protein	NA	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
AYU05925.1|4572876_4573371_-|head	phage head protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
AYU05926.1|4573472_4574273_-	hypothetical protein	NA	A0A0A7NPX9	Enterobacteria_phage	88.3	1.4e-124
AYU05927.1|4574318_4575371_-	hypothetical protein	NA	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
AYU05928.1|4575394_4576231_-	hypothetical protein	NA	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
AYU05929.1|4576385_4578137_+	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	99.7	0.0e+00
AYU05930.1|4578136_4579183_+|portal	Presumed portal vertex protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
AYU05931.1|4579889_4580393_+	hypothetical protein	NA	NA	NA	NA	NA
AYU05932.1|4580483_4580795_-	hypothetical protein	NA	A0A0A7NPT5	Enterobacteria_phage	94.2	1.9e-48
AYU05933.1|4580799_4581759_-	plasmid partition protein	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	4.6e-178
AYU05934.1|4581835_4584658_-	phage DNA replication protein	NA	A0A0A7NQ77	Enterobacteria_phage	96.5	0.0e+00
AYU05935.1|4584664_4585030_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
AYU05936.1|4585102_4585333_-	hypothetical protein	NA	A0A0A7NV48	Enterobacteria_phage	67.1	3.7e-17
AYU05937.1|4585869_4586355_+	hypothetical protein	NA	NA	NA	NA	NA
AYU05938.1|4586394_4586709_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	86.7	5.2e-38
AYU05939.1|4586705_4586951_-	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	93.8	6.9e-38
AYU05940.1|4587173_4587584_-	hypothetical protein	NA	NA	NA	NA	NA
AYU05941.1|4587786_4588029_-	hypothetical protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
AYU05942.1|4588040_4588298_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.3	4.9e-18
AYU05943.1|4588330_4588681_-	DUF4761 domain-containing protein	NA	A0A0A7NV42	Enterobacteria_phage	95.7	1.1e-57
AYU05944.1|4588718_4589144_-	phage regulatory protein	NA	A0A0A7NPS5	Enterobacteria_phage	100.0	9.1e-78
AYU05945.1|4589252_4589552_+	transcriptional regulator, y4mF family	NA	A0A0A7NPW3	Enterobacteria_phage	100.0	1.2e-44
AYU05946.1|4589591_4590614_+|integrase	integrase	integrase	A0A0A7NQ69	Enterobacteria_phage	99.7	5.4e-193
AYU05947.1|4590749_4591958_-	sugar transporter	NA	NA	NA	NA	NA
AYU05948.1|4591954_4593118_-	metallo-dependent hydrolase	NA	NA	NA	NA	NA
4592670:4592686	attR	TACTGGCGAAACAGCGC	NA	NA	NA	NA
AYU05949.1|4593527_4594058_-	inorganic pyrophosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	4.2e-56
>prophage 13
CP029853	Salmonella enterica subsp. enterica serovar Typhi strain 343077_281186 chromosome, complete genome	4829489	4644857	4651333	4829489	capsid	Enterobacteria_phage(66.67%)	8	NA	NA
AYU05996.1|4644857_4645934_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYU05997.1|4645930_4647004_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYU05998.1|4646978_4648142_-	hypothetical protein	NA	NA	NA	NA	NA
AYU05999.1|4648417_4648984_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYU06000.1|4648999_4649239_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYU06001.1|4649242_4650103_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYU06002.1|4650525_4650849_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYU06003.1|4650832_4651333_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
