The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029855	Salmonella enterica subsp. enterica serovar Typhi strain 343077_292148 chromosome, complete genome	4800586	930426	937738	4800586	integrase,protease	Dickeya_phage(16.67%)	6	931677:931691	942856:942870
AYU15699.1|930426_931545_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYU15700.1|931541_933488_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931677:931691	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYU15701.1|933617_933839_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYU15702.1|934162_934483_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYU15703.1|934513_936790_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYU15704.1|937360_937738_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942856:942870	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029855	Salmonella enterica subsp. enterica serovar Typhi strain 343077_292148 chromosome, complete genome	4800586	1008720	1086032	4800586	transposase,terminase,tail,integrase,protease	Salmonella_phage(73.33%)	93	990786:990805	1061393:1061412
990786:990805	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYU15754.1|1008720_1010061_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYU15755.1|1010057_1010306_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYU15756.1|1010346_1010592_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYU15757.1|1010591_1011473_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYU15758.1|1011469_1012534_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYU15759.1|1012611_1013292_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYU15760.1|1013288_1014074_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYU15761.1|1014079_1014376_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYU15762.1|1014466_1014667_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYU15763.1|1014955_1015360_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYU15764.1|1015691_1016066_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYU15765.1|1016150_1017134_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYU15766.1|1017136_1017886_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYU15767.1|1017896_1018244_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYU15768.1|1018240_1018765_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYU15769.1|1018764_1019238_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYU15770.1|1019241_1019814_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYU15771.1|1019907_1020174_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYU15772.1|1020255_1020417_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU15773.1|1020849_1021347_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU15774.1|1021531_1021771_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYU15775.1|1021760_1022066_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYU15776.1|1022105_1022708_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYU15777.1|1022916_1023528_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYU15778.1|1023660_1024458_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYU15779.1|1024856_1024982_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU15780.1|1025117_1025567_-	lipoprotein	NA	NA	NA	NA	NA
AYU15781.1|1025783_1026173_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYU15782.1|1026159_1026441_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYU15783.1|1026440_1027055_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYU15784.1|1027273_1027528_+	hypothetical protein	NA	NA	NA	NA	NA
AYU15785.1|1027632_1028010_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYU15786.1|1028073_1028334_+	hypothetical protein	NA	NA	NA	NA	NA
AYU15787.1|1028423_1029176_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYU15788.1|1029141_1030545_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYU15789.1|1030544_1032014_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYU15790.1|1032105_1032636_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYU15791.1|1032650_1033883_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYU15792.1|1033887_1034385_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYU15793.1|1034396_1035338_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYU15794.1|1035379_1035748_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYU15795.1|1035713_1036121_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYU15796.1|1036117_1036672_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYU15797.1|1036658_1037048_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYU15798.1|1037022_1037586_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYU15799.1|1037589_1038735_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYU15800.1|1038746_1039187_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYU15801.1|1039190_1039643_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYU15802.1|1039820_1041773_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYU15803.1|1041772_1042423_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYU15804.1|1042426_1042729_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYU15805.1|1042731_1043763_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYU15806.1|1043759_1044095_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYU15807.1|1044289_1045021_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU15808.1|1045020_1045449_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU15809.1|1045507_1046263_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYU15810.1|1046350_1046488_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYU15811.1|1046503_1046857_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYU15812.1|1046857_1048057_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYU15813.1|1048053_1048734_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYU15814.1|1048733_1050245_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYU15815.1|1050259_1050778_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYU15816.1|1051699_1052401_-	hypothetical protein	NA	NA	NA	NA	NA
AYU15817.1|1052713_1052992_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYU15818.1|1053417_1056030_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYU15819.1|1056237_1057248_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYU15820.1|1057410_1057956_+	hypothetical protein	NA	NA	NA	NA	NA
AYU15821.1|1057952_1059062_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYU15822.1|1059160_1061269_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYU15823.1|1061281_1063189_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061393:1061412	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYU15824.1|1063203_1064457_+	inner membrane protein	NA	NA	NA	NA	NA
AYU15825.1|1064461_1066102_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYU15826.1|1066098_1066662_+	lipoprotein	NA	NA	NA	NA	NA
AYU15827.1|1066915_1067083_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYU15828.1|1067182_1067701_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYU15829.1|1067769_1069530_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYU15830.1|1069715_1070168_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYU15831.1|1070239_1071292_-	outer membrane protein A	NA	NA	NA	NA	NA
AYU15832.1|1071646_1072156_-	cell division inhibitor	NA	NA	NA	NA	NA
AYU15833.1|1072372_1072978_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYU15834.1|1072964_1075118_-	inner membrane protein	NA	NA	NA	NA	NA
AYU15835.1|1075136_1075583_-	hypothetical protein	NA	NA	NA	NA	NA
AYU15836.1|1075706_1077761_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYU15837.1|1077796_1078255_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYU15838.1|1078349_1079012_-	hypothetical protein	NA	NA	NA	NA	NA
AYU15839.1|1079182_1079599_+	hypothetical protein	NA	NA	NA	NA	NA
AYU15840.1|1079643_1079961_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYU15841.1|1080018_1081230_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYU15842.1|1082361_1082820_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU15843.1|1083556_1083838_+	acylphosphatase	NA	NA	NA	NA	NA
AYU15844.1|1083834_1084164_-	sulfite reductase	NA	NA	NA	NA	NA
AYU15845.1|1084250_1084910_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYU15846.1|1085573_1086032_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029855	Salmonella enterica subsp. enterica serovar Typhi strain 343077_292148 chromosome, complete genome	4800586	1528838	1602436	4800586	transposase,head,protease,tRNA,tail,plate	Burkholderia_virus(44.12%)	72	NA	NA
AYU16246.1|1528838_1529297_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU16247.1|1529799_1530081_+	stress response protein	NA	NA	NA	NA	NA
AYU16248.1|1530349_1531171_+|protease	serine protease	protease	NA	NA	NA	NA
AYU16249.1|1531205_1531535_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYU16250.1|1531521_1531884_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYU16251.1|1531995_1532166_-	hypothetical protein	NA	NA	NA	NA	NA
AYU16252.1|1532300_1533335_+	hypothetical protein	NA	NA	NA	NA	NA
AYU16253.1|1533509_1534898_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYU16254.1|1534908_1536438_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYU16255.1|1536964_1537909_+	hypothetical protein	NA	NA	NA	NA	NA
AYU16256.1|1538090_1538480_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYU16257.1|1538451_1538904_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYU16258.1|1539098_1539329_-	hypothetical protein	NA	NA	NA	NA	NA
AYU16259.1|1539325_1540009_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYU16260.1|1540593_1540896_-	hypothetical protein	NA	NA	NA	NA	NA
AYU16261.1|1541466_1541997_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYU16262.1|1542296_1543463_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYU16263.1|1543473_1545243_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYU16264.1|1546687_1547038_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYU16265.1|1547752_1548403_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYU16266.1|1548725_1549037_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYU16267.1|1549036_1549582_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYU16268.1|1549578_1551174_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYU16269.1|1551173_1552670_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYU16270.1|1552650_1553472_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYU16271.1|1553474_1553933_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYU16272.1|1554147_1555263_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYU16273.1|1555277_1556231_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYU16274.1|1556240_1556579_+	hypothetical protein	NA	NA	NA	NA	NA
AYU16275.1|1556580_1557027_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYU16276.1|1557026_1557491_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYU16277.1|1557731_1559159_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYU16278.1|1559158_1559680_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYU16279.1|1559682_1559964_+	hypothetical protein	NA	NA	NA	NA	NA
AYU16280.1|1560061_1560397_+	hypothetical protein	NA	NA	NA	NA	NA
AYU16281.1|1560572_1563038_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYU16282.1|1563037_1563922_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYU16283.1|1563918_1564134_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYU16284.1|1564121_1565276_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYU16285.1|1565272_1565800_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYU16286.1|1565856_1566204_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYU16287.1|1566194_1567298_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYU16288.1|1567290_1567869_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYU16289.1|1567871_1568897_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYU16290.1|1569410_1570028_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYU16291.1|1571538_1572111_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYU16292.1|1572391_1573774_+	amino acid permease	NA	NA	NA	NA	NA
AYU16293.1|1573835_1574171_-	hypothetical protein	NA	NA	NA	NA	NA
AYU16294.1|1574297_1575029_+	two-component response regulator	NA	NA	NA	NA	NA
AYU16295.1|1575509_1576661_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYU16296.1|1576813_1578520_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYU16297.1|1578627_1579932_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYU16298.1|1580007_1580937_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYU16299.1|1580933_1582337_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYU16300.1|1582504_1584151_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYU16301.1|1584350_1585526_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYU16302.1|1585628_1587137_+	hypothetical protein	NA	NA	NA	NA	NA
AYU16303.1|1587842_1588844_+	adenosine deaminase	NA	NA	NA	NA	NA
AYU16304.1|1588917_1590033_-	oxidoreductase	NA	NA	NA	NA	NA
AYU16305.1|1590135_1590291_+	hypothetical protein	NA	NA	NA	NA	NA
AYU16306.1|1590589_1590805_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYU16307.1|1590893_1591334_+	hypothetical protein	NA	NA	NA	NA	NA
AYU16308.1|1591410_1591992_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYU16309.1|1591991_1592570_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYU16310.1|1592562_1594584_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYU16311.1|1594584_1595643_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYU16312.1|1595646_1596267_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYU16313.1|1596269_1596962_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYU16314.1|1596961_1597597_+	endonuclease III	NA	NA	NA	NA	NA
AYU16315.1|1598197_1599703_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYU16316.1|1599807_1600413_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYU16317.1|1601161_1602436_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029855	Salmonella enterica subsp. enterica serovar Typhi strain 343077_292148 chromosome, complete genome	4800586	1783472	1787884	4800586		Escherichia_phage(50.0%)	6	NA	NA
AYU16501.1|1783472_1783712_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYU16502.1|1784584_1785394_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYU16503.1|1785466_1785844_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYU16504.1|1785991_1786534_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYU16505.1|1786725_1787454_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYU16506.1|1787470_1787884_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029855	Salmonella enterica subsp. enterica serovar Typhi strain 343077_292148 chromosome, complete genome	4800586	1991737	1998971	4800586		Morganella_phage(33.33%)	7	NA	NA
AYU16696.1|1991737_1993168_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYU16697.1|1993241_1993937_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYU16698.1|1994016_1994328_-	hypothetical protein	NA	NA	NA	NA	NA
AYU16699.1|1994978_1996163_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYU16700.1|1996622_1996835_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYU16701.1|1997280_1998549_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYU16702.1|1998551_1998971_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029855	Salmonella enterica subsp. enterica serovar Typhi strain 343077_292148 chromosome, complete genome	4800586	2105271	2115778	4800586		Enterobacteria_phage(37.5%)	10	NA	NA
AYU16799.1|2105271_2106585_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYU16800.1|2106611_2107691_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYU16801.1|2107695_2108469_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYU16802.1|2108484_2109459_-	reductase RfbI	NA	NA	NA	NA	NA
AYU16803.1|2109464_2110016_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYU16804.1|2110016_2110895_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYU16805.1|2110942_2111842_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYU16806.1|2111841_2112927_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYU16807.1|2113303_2114197_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYU16808.1|2114374_2115778_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029855	Salmonella enterica subsp. enterica serovar Typhi strain 343077_292148 chromosome, complete genome	4800586	2191669	2200840	4800586	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYU16867.1|2191669_2193703_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYU16868.1|2193943_2194402_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYU16869.1|2194573_2195104_+	lipoprotein	NA	NA	NA	NA	NA
AYU16870.1|2195160_2195628_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYU16871.1|2195674_2196394_-	two-component system response regulator	NA	NA	NA	NA	NA
AYU16872.1|2196390_2198076_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYU16873.1|2198298_2199030_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYU16874.1|2199089_2199197_+	hypothetical protein	NA	NA	NA	NA	NA
AYU16875.1|2199177_2199909_-	ABC transporter permease	NA	NA	NA	NA	NA
AYU16876.1|2199892_2200840_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029855	Salmonella enterica subsp. enterica serovar Typhi strain 343077_292148 chromosome, complete genome	4800586	2736284	2749676	4800586	tail	Salmonella_phage(70.0%)	11	NA	NA
AYU17305.1|2736284_2736503_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYU17306.1|2736593_2737694_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYU17307.1|2737690_2738176_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYU17308.1|2738172_2741250_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYU17309.1|2741242_2741362_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYU17310.1|2741376_2741679_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYU17311.1|2741733_2742249_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYU17312.1|2742258_2743431_-|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYU17313.1|2743573_2744146_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYU17314.1|2744823_2745939_+	glycosyltransferase	NA	NA	NA	NA	NA
AYU17315.1|2746019_2749676_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029855	Salmonella enterica subsp. enterica serovar Typhi strain 343077_292148 chromosome, complete genome	4800586	3066430	3110133	4800586	transposase,bacteriocin,tRNA,protease	Bacillus_virus(33.33%)	44	NA	NA
AYU17602.1|3066430_3066889_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU17603.1|3067078_3068158_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYU17604.1|3068259_3069423_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYU17605.1|3069444_3070491_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYU17606.1|3070864_3071290_+	hypothetical protein	NA	NA	NA	NA	NA
AYU17607.1|3071315_3071894_+	hypothetical protein	NA	NA	NA	NA	NA
AYU17608.1|3071927_3072602_+	hypothetical protein	NA	NA	NA	NA	NA
AYU17609.1|3072583_3073267_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYU17610.1|3073260_3073917_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYU17611.1|3074021_3074480_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU17612.1|3074668_3076660_-	transketolase	NA	NA	NA	NA	NA
AYU17613.1|3076935_3077694_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYU17614.1|3077794_3078715_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYU17615.1|3078942_3080919_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYU17616.1|3080927_3081059_-	hypothetical protein	NA	NA	NA	NA	NA
AYU17617.1|3081353_3081653_-	membrane protein	NA	NA	NA	NA	NA
AYU17618.1|3081708_3082863_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYU17619.1|3083355_3084750_+	galactose-proton symport	NA	NA	NA	NA	NA
AYU17620.1|3084828_3085326_+	hypothetical protein	NA	NA	NA	NA	NA
AYU17621.1|3085421_3086129_+	endonuclease I	NA	NA	NA	NA	NA
AYU17622.1|3086205_3086937_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYU17623.1|3086956_3087904_+	glutathione synthetase	NA	NA	NA	NA	NA
AYU17624.1|3088119_3088683_+	hypothetical protein	NA	NA	NA	NA	NA
AYU17625.1|3088682_3089099_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYU17626.1|3089145_3089832_-	global regulatory protein	NA	NA	NA	NA	NA
AYU17627.1|3089961_3090942_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYU17628.1|3090959_3091664_+	hypothetical protein	NA	NA	NA	NA	NA
AYU17629.1|3091682_3092249_+	hypothetical protein	NA	NA	NA	NA	NA
AYU17630.1|3092245_3092536_+	hypothetical protein	NA	NA	NA	NA	NA
AYU17631.1|3092543_3093137_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYU17632.1|3093129_3094266_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYU17633.1|3094356_3095364_-	hypothetical protein	NA	NA	NA	NA	NA
AYU17634.1|3095496_3096543_-	L-asparaginase	NA	NA	NA	NA	NA
AYU17635.1|3096861_3097320_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU17636.1|3097442_3098162_-	hypothetical protein	NA	NA	NA	NA	NA
AYU17637.1|3098211_3098538_-	hypothetical protein	NA	NA	NA	NA	NA
AYU17638.1|3098537_3099257_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYU17639.1|3099411_3100464_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYU17640.1|3100491_3100767_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYU17641.1|3100879_3101965_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYU17642.1|3102181_3103438_+	nucleoside permease	NA	NA	NA	NA	NA
AYU17643.1|3106048_3106756_+	hypothetical protein	NA	NA	NA	NA	NA
AYU17644.1|3109345_3109612_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYU17645.1|3109854_3110133_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029855	Salmonella enterica subsp. enterica serovar Typhi strain 343077_292148 chromosome, complete genome	4800586	3488228	3526286	4800586	transposase,portal,terminase,tail,integrase,capsid,plate	Salmonella_phage(82.05%)	46	3483192:3483206	3495358:3495372
3483192:3483206	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYU17974.1|3488228_3489875_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYU17975.1|3490014_3490113_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYU17976.1|3490368_3490698_+	hypothetical protein	NA	NA	NA	NA	NA
AYU17977.1|3490738_3491791_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYU17978.1|3492186_3492756_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYU17979.1|3492881_3493103_+	hypothetical protein	NA	NA	NA	NA	NA
AYU17980.1|3493135_3493645_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYU17981.1|3493819_3494044_+	hypothetical protein	NA	NA	NA	NA	NA
AYU17982.1|3494066_3494408_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYU17983.1|3494475_3494709_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYU17984.1|3494708_3494936_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYU17985.1|3494932_3495790_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3495358:3495372	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYU17986.1|3495786_3498201_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYU17987.1|3498354_3498543_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYU17988.1|3500510_3501425_+	hypothetical protein	NA	NA	NA	NA	NA
AYU17989.1|3501421_3502162_+	hypothetical protein	NA	NA	NA	NA	NA
AYU17990.1|3502196_3503234_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYU17991.1|3503233_3505000_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYU17992.1|3505142_3505976_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYU17993.1|3505992_3507051_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYU17994.1|3507054_3507705_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYU17995.1|3507737_3508265_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYU17996.1|3508264_3508468_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYU17997.1|3508471_3508687_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYU17998.1|3508706_3509180_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYU17999.1|3509181_3509559_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYU18000.1|3509555_3509984_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYU18001.1|3510079_3510511_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYU18002.1|3510503_3510950_+|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYU18003.1|3511018_3511597_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYU18004.1|3511593_3511953_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYU18005.1|3511939_3512848_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYU18006.1|3512840_3513446_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYU18007.1|3513442_3514957_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYU18008.1|3514956_3515550_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYU18009.1|3515521_3515962_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYU18010.1|3516384_3516957_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYU18011.1|3517099_3518272_+|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYU18012.1|3518281_3518797_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYU18013.1|3518851_3519154_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYU18014.1|3519168_3519288_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYU18015.1|3519280_3522358_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYU18016.1|3522354_3522840_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYU18017.1|3522836_3523937_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYU18018.1|3524027_3524246_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYU18019.1|3525827_3526286_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029855	Salmonella enterica subsp. enterica serovar Typhi strain 343077_292148 chromosome, complete genome	4800586	4459561	4534502	4800586	portal,terminase,tail,capsid,integrase,plate	Salmonella_phage(82.98%)	76	4521839:4521855	4534661:4534677
AYU18810.1|4459561_4461511_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYU18811.1|4461582_4462491_+	hypothetical protein	NA	NA	NA	NA	NA
AYU18812.1|4462564_4463464_+	hypothetical protein	NA	NA	NA	NA	NA
AYU18813.1|4463505_4463865_+	hypothetical protein	NA	NA	NA	NA	NA
AYU18814.1|4463964_4464234_-	hypothetical protein	NA	NA	NA	NA	NA
AYU18815.1|4464365_4465640_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYU18816.1|4465859_4466237_+	hypothetical protein	NA	NA	NA	NA	NA
AYU18817.1|4466323_4466542_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYU18818.1|4466609_4467710_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYU18819.1|4467706_4468192_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYU18820.1|4468191_4470972_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYU18821.1|4470964_4471084_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYU18822.1|4471098_4471401_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYU18823.1|4471455_4471971_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYU18824.1|4471980_4473153_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYU18825.1|4473687_4474410_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYU18826.1|4474607_4475015_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYU18827.1|4475021_4476641_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYU18828.1|4476637_4477243_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYU18829.1|4477235_4478144_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYU18830.1|4478130_4478490_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYU18831.1|4478486_4479065_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYU18832.1|4479133_4479580_-|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYU18833.1|4479572_4480004_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYU18834.1|4480099_4480525_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYU18835.1|4480524_4480902_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYU18836.1|4480906_4481377_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYU18837.1|4481396_4481612_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYU18838.1|4481615_4481819_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYU18839.1|4481818_4482283_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYU18840.1|4482376_4483027_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYU18841.1|4483030_4484095_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYU18842.1|4484111_4484945_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYU18843.1|4485087_4486854_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYU18844.1|4486850_4487897_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYU18845.1|4487945_4488641_-	hypothetical protein	NA	NA	NA	NA	NA
AYU18846.1|4488660_4489725_-	hypothetical protein	NA	NA	NA	NA	NA
AYU18847.1|4489721_4490786_-	hypothetical protein	NA	NA	NA	NA	NA
AYU18848.1|4491710_4492040_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYU18849.1|4492036_4494106_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYU18850.1|4494096_4494957_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYU18851.1|4494953_4495538_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYU18852.1|4495534_4495762_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYU18853.1|4495761_4495995_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYU18854.1|4496062_4496404_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYU18855.1|4496367_4496568_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYU18856.1|4496575_4497085_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYU18857.1|4497117_4497360_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYU18858.1|4497476_4498109_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYU18859.1|4498112_4499138_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYU18860.1|4499244_4499598_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYU18861.1|4500214_4500502_+	hypothetical protein	NA	NA	NA	NA	NA
AYU18862.1|4500512_4501403_+	methyltransferase	NA	NA	NA	NA	NA
AYU18863.1|4501402_4502149_+	hypothetical protein	NA	NA	NA	NA	NA
AYU18864.1|4502450_4504421_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYU18865.1|4504440_4505745_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYU18866.1|4505767_4506463_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYU18867.1|4506488_4507283_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYU18868.1|4507292_4508360_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYU18869.1|4508404_4510141_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYU18870.1|4510140_4512636_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYU18871.1|4512659_4513706_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYU18872.1|4513708_4514980_-	Vi polysaccharide biosynthesis protein vipA/tviB	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.2e-21
AYU18873.1|4516007_4516547_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYU18874.1|4517400_4518912_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYU18875.1|4518895_4520485_+	hypothetical protein	NA	NA	NA	NA	NA
AYU18876.1|4520648_4521662_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4521839:4521855	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYU18877.1|4522088_4522382_+	hypothetical protein	NA	NA	NA	NA	NA
AYU18878.1|4522378_4522867_+	hypothetical protein	NA	NA	NA	NA	NA
AYU18879.1|4523046_4523499_-	hypothetical protein	NA	NA	NA	NA	NA
AYU18880.1|4528721_4529183_+	hypothetical protein	NA	NA	NA	NA	NA
AYU18881.1|4529179_4529401_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYU18882.1|4530257_4531040_+	hypothetical protein	NA	NA	NA	NA	NA
AYU18883.1|4531666_4531891_-	hypothetical protein	NA	NA	NA	NA	NA
AYU18884.1|4532020_4532932_-	hypothetical protein	NA	NA	NA	NA	NA
AYU18885.1|4533242_4534502_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4534661:4534677	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 12
CP029855	Salmonella enterica subsp. enterica serovar Typhi strain 343077_292148 chromosome, complete genome	4800586	4676754	4687013	4800586	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYU19022.1|4676754_4677831_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYU19023.1|4677827_4678901_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYU19024.1|4678875_4680039_-	hypothetical protein	NA	NA	NA	NA	NA
AYU19025.1|4680314_4680881_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYU19026.1|4680896_4681136_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYU19027.1|4681139_4682000_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYU19028.1|4682422_4682746_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYU19029.1|4682729_4683230_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYU19030.1|4683226_4683454_+	hypothetical protein	NA	NA	NA	NA	NA
AYU19031.1|4683450_4683771_+	P4 phage protein	NA	NA	NA	NA	NA
AYU19032.1|4683785_4684460_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYU19033.1|4684456_4686118_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYU19034.1|4686854_4687013_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
