The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029850	Salmonella enterica subsp. enterica serovar Typhi strain 343078_203125 chromosome, complete genome	4801819	930248	937560	4801819	integrase,protease	Dickeya_phage(16.67%)	6	931499:931513	942678:942692
AYU24131.1|930248_931367_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYU24132.1|931363_933310_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931499:931513	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYU24133.1|933439_933661_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYU24134.1|933984_934305_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYU24135.1|934335_936612_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYU24136.1|937182_937560_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942678:942692	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029850	Salmonella enterica subsp. enterica serovar Typhi strain 343078_203125 chromosome, complete genome	4801819	1008542	1085854	4801819	transposase,integrase,protease,terminase,tail	Salmonella_phage(73.33%)	93	990608:990627	1061215:1061234
990608:990627	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYU24186.1|1008542_1009883_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYU24187.1|1009879_1010128_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYU24188.1|1010168_1010414_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYU24189.1|1010413_1011295_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYU24190.1|1011291_1012356_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYU24191.1|1012433_1013114_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYU24192.1|1013110_1013896_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYU24193.1|1013901_1014198_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYU24194.1|1014288_1014489_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYU24195.1|1014777_1015182_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYU24196.1|1015513_1015888_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYU24197.1|1015972_1016956_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYU24198.1|1016958_1017708_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYU24199.1|1017718_1018066_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYU24200.1|1018062_1018587_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYU24201.1|1018586_1019060_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYU24202.1|1019063_1019636_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYU24203.1|1019729_1019996_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYU24204.1|1020077_1020239_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU24205.1|1020671_1021169_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU24206.1|1021353_1021593_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYU24207.1|1021582_1021888_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYU24208.1|1021927_1022530_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYU24209.1|1022738_1023350_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYU24210.1|1023482_1024280_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYU24211.1|1024678_1024804_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU24212.1|1024939_1025389_-	lipoprotein	NA	NA	NA	NA	NA
AYU24213.1|1025605_1025995_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYU24214.1|1025981_1026263_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYU24215.1|1026262_1026877_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYU24216.1|1027095_1027350_+	hypothetical protein	NA	NA	NA	NA	NA
AYU24217.1|1027454_1027832_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYU24218.1|1027895_1028156_+	hypothetical protein	NA	NA	NA	NA	NA
AYU24219.1|1028245_1028998_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYU24220.1|1028963_1030367_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYU24221.1|1030366_1031836_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYU24222.1|1031927_1032458_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYU24223.1|1032472_1033705_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYU24224.1|1033709_1034207_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYU24225.1|1034218_1035160_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYU24226.1|1035201_1035570_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYU24227.1|1035535_1035943_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYU24228.1|1035939_1036494_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYU24229.1|1036480_1036870_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYU24230.1|1036844_1037408_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYU24231.1|1037411_1038557_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYU24232.1|1038568_1039009_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYU24233.1|1039012_1039465_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYU24234.1|1039642_1041595_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYU24235.1|1041594_1042245_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYU24236.1|1042248_1042551_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYU24237.1|1042553_1043585_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYU24238.1|1043581_1043917_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYU24239.1|1044111_1044843_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU24240.1|1044842_1045271_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU24241.1|1045329_1046085_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYU24242.1|1046172_1046310_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYU24243.1|1046325_1046679_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYU24244.1|1046679_1047879_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYU24245.1|1047875_1048556_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYU24246.1|1048555_1050067_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYU24247.1|1050081_1050600_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYU24248.1|1051521_1052223_-	hypothetical protein	NA	NA	NA	NA	NA
AYU24249.1|1052535_1052814_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYU24250.1|1053239_1055852_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYU24251.1|1056059_1057070_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYU24252.1|1057232_1057778_+	hypothetical protein	NA	NA	NA	NA	NA
AYU24253.1|1057774_1058884_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYU24254.1|1058982_1061091_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYU24255.1|1061103_1063011_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061215:1061234	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYU24256.1|1063025_1064279_+	inner membrane protein	NA	NA	NA	NA	NA
AYU24257.1|1064283_1065924_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYU24258.1|1065920_1066484_+	lipoprotein	NA	NA	NA	NA	NA
AYU24259.1|1066737_1066905_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYU24260.1|1067004_1067523_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYU24261.1|1067591_1069352_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYU24262.1|1069537_1069990_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYU24263.1|1070061_1071114_-	outer membrane protein A	NA	NA	NA	NA	NA
AYU24264.1|1071468_1071978_-	cell division inhibitor	NA	NA	NA	NA	NA
AYU24265.1|1072194_1072800_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYU24266.1|1072786_1074940_-	inner membrane protein	NA	NA	NA	NA	NA
AYU24267.1|1074958_1075405_-	hypothetical protein	NA	NA	NA	NA	NA
AYU24268.1|1075528_1077583_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYU24269.1|1077618_1078077_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYU24270.1|1078171_1078834_-	hypothetical protein	NA	NA	NA	NA	NA
AYU24271.1|1079004_1079421_+	hypothetical protein	NA	NA	NA	NA	NA
AYU24272.1|1079465_1079783_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYU24273.1|1079840_1081052_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYU24274.1|1082183_1082642_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU24275.1|1083378_1083660_+	acylphosphatase	NA	NA	NA	NA	NA
AYU24276.1|1083656_1083986_-	sulfite reductase	NA	NA	NA	NA	NA
AYU24277.1|1084072_1084732_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYU24278.1|1085395_1085854_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029850	Salmonella enterica subsp. enterica serovar Typhi strain 343078_203125 chromosome, complete genome	4801819	1528672	1602242	4801819	transposase,plate,head,protease,tRNA,tail	Burkholderia_virus(42.11%)	81	NA	NA
AYU24677.1|1528672_1529131_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU24678.1|1529633_1529915_+	stress response protein	NA	NA	NA	NA	NA
AYU24679.1|1530183_1531005_+|protease	serine protease	protease	NA	NA	NA	NA
AYU24680.1|1531039_1531369_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYU24681.1|1531355_1531718_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYU24682.1|1531829_1532000_-	hypothetical protein	NA	NA	NA	NA	NA
AYU24683.1|1532134_1533169_+	hypothetical protein	NA	NA	NA	NA	NA
AYU24684.1|1533343_1534732_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYU24685.1|1534742_1536272_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYU24686.1|1536798_1537743_+	hypothetical protein	NA	NA	NA	NA	NA
AYU24687.1|1537924_1538314_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYU24688.1|1538285_1538738_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYU24689.1|1538932_1539163_-	hypothetical protein	NA	NA	NA	NA	NA
AYU24690.1|1539159_1539843_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYU24691.1|1539839_1540055_-	hypothetical protein	NA	NA	NA	NA	NA
AYU24692.1|1540047_1540431_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
AYU24693.1|1540427_1540730_-	hypothetical protein	NA	NA	NA	NA	NA
AYU24694.1|1540739_1541012_-	hypothetical protein	NA	NA	NA	NA	NA
AYU24695.1|1541300_1541831_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYU24696.1|1541858_1542128_-	hypothetical protein	NA	NA	NA	NA	NA
AYU24697.1|1542130_1543297_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYU24698.1|1543307_1545077_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYU24699.1|1545254_1545686_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
AYU24700.1|1545681_1546278_+	hypothetical protein	NA	NA	NA	NA	NA
AYU24701.1|1546521_1546872_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYU24702.1|1547586_1548237_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYU24703.1|1548233_1548560_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AYU24704.1|1548559_1548871_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYU24705.1|1548870_1549416_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYU24706.1|1549412_1551008_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYU24707.1|1551007_1552504_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYU24708.1|1552484_1553306_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYU24709.1|1553308_1553767_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYU24710.1|1553981_1555097_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYU24711.1|1555111_1556065_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYU24712.1|1556074_1556413_+	hypothetical protein	NA	NA	NA	NA	NA
AYU24713.1|1556414_1556861_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYU24714.1|1556860_1557325_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYU24715.1|1557321_1557576_+	hypothetical protein	NA	NA	NA	NA	NA
AYU24716.1|1557565_1558993_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYU24717.1|1558992_1559514_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYU24718.1|1559516_1559798_+	hypothetical protein	NA	NA	NA	NA	NA
AYU24719.1|1559895_1560231_+	hypothetical protein	NA	NA	NA	NA	NA
AYU24720.1|1560406_1562872_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYU24721.1|1562871_1563756_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYU24722.1|1563752_1563968_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYU24723.1|1563955_1565110_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYU24724.1|1565106_1565634_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYU24725.1|1565690_1566038_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYU24726.1|1566028_1567132_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYU24727.1|1567124_1567703_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYU24728.1|1567705_1568731_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	52.9	6.2e-64
AYU24729.1|1568782_1569217_+|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	44.9	1.3e-23
AYU24730.1|1569216_1569834_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYU24731.1|1571344_1571917_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYU24732.1|1572197_1573580_+	amino acid permease	NA	NA	NA	NA	NA
AYU24733.1|1573641_1573977_-	hypothetical protein	NA	NA	NA	NA	NA
AYU24734.1|1574103_1574835_+	two-component response regulator	NA	NA	NA	NA	NA
AYU24735.1|1575315_1576467_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYU24736.1|1576619_1578326_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYU24737.1|1578433_1579738_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYU24738.1|1579813_1580743_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYU24739.1|1580739_1582143_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYU24740.1|1582310_1583957_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYU24741.1|1584156_1585332_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYU24742.1|1585434_1586943_+	hypothetical protein	NA	NA	NA	NA	NA
AYU24743.1|1587648_1588650_+	adenosine deaminase	NA	NA	NA	NA	NA
AYU24744.1|1588723_1589839_-	oxidoreductase	NA	NA	NA	NA	NA
AYU24745.1|1589941_1590097_+	hypothetical protein	NA	NA	NA	NA	NA
AYU24746.1|1590395_1590611_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYU24747.1|1590699_1591140_+	hypothetical protein	NA	NA	NA	NA	NA
AYU24748.1|1591216_1591798_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYU24749.1|1591797_1592376_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYU24750.1|1592368_1594390_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYU24751.1|1594390_1595449_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYU24752.1|1595452_1596073_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYU24753.1|1596075_1596768_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYU24754.1|1596767_1597403_+	endonuclease III	NA	NA	NA	NA	NA
AYU24755.1|1598003_1599509_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYU24756.1|1599613_1600219_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYU24757.1|1600967_1602242_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029850	Salmonella enterica subsp. enterica serovar Typhi strain 343078_203125 chromosome, complete genome	4801819	1783279	1787691	4801819		Escherichia_phage(50.0%)	6	NA	NA
AYU24941.1|1783279_1783519_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYU24942.1|1784391_1785201_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYU24943.1|1785273_1785651_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYU24944.1|1785798_1786341_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYU24945.1|1786532_1787261_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYU24946.1|1787277_1787691_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029850	Salmonella enterica subsp. enterica serovar Typhi strain 343078_203125 chromosome, complete genome	4801819	1991544	1998778	4801819		Morganella_phage(33.33%)	7	NA	NA
AYU25136.1|1991544_1992975_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYU25137.1|1993048_1993744_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYU25138.1|1993823_1994135_-	hypothetical protein	NA	NA	NA	NA	NA
AYU25139.1|1994785_1995970_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYU25140.1|1996429_1996642_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYU25141.1|1997087_1998356_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYU25142.1|1998358_1998778_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029850	Salmonella enterica subsp. enterica serovar Typhi strain 343078_203125 chromosome, complete genome	4801819	2105078	2115585	4801819		Enterobacteria_phage(37.5%)	10	NA	NA
AYU25239.1|2105078_2106392_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYU25240.1|2106418_2107498_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYU25241.1|2107502_2108276_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYU25242.1|2108291_2109266_-	reductase RfbI	NA	NA	NA	NA	NA
AYU25243.1|2109271_2109823_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYU25244.1|2109823_2110702_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYU25245.1|2110749_2111649_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYU25246.1|2111648_2112734_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYU25247.1|2113110_2114004_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYU25248.1|2114181_2115585_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029850	Salmonella enterica subsp. enterica serovar Typhi strain 343078_203125 chromosome, complete genome	4801819	2191476	2200647	4801819	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYU25307.1|2191476_2193510_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYU25308.1|2193750_2194209_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYU25309.1|2194380_2194911_+	lipoprotein	NA	NA	NA	NA	NA
AYU25310.1|2194967_2195435_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYU25311.1|2195481_2196201_-	two-component system response regulator	NA	NA	NA	NA	NA
AYU25312.1|2196197_2197883_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYU25313.1|2198105_2198837_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYU25314.1|2198896_2199004_+	hypothetical protein	NA	NA	NA	NA	NA
AYU25315.1|2198984_2199716_-	ABC transporter permease	NA	NA	NA	NA	NA
AYU25316.1|2199699_2200647_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029850	Salmonella enterica subsp. enterica serovar Typhi strain 343078_203125 chromosome, complete genome	4801819	2736074	2749466	4801819	tail	Salmonella_phage(70.0%)	11	NA	NA
AYU25745.1|2736074_2736293_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYU25746.1|2736383_2737484_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYU25747.1|2737480_2737966_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYU25748.1|2737962_2741040_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYU25749.1|2741032_2741152_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYU25750.1|2741166_2741469_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYU25751.1|2741523_2742039_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYU25752.1|2742048_2743221_-|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYU25753.1|2743363_2743936_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYU25754.1|2744613_2745729_+	glycosyltransferase	NA	NA	NA	NA	NA
AYU25755.1|2745809_2749466_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029850	Salmonella enterica subsp. enterica serovar Typhi strain 343078_203125 chromosome, complete genome	4801819	3066826	3110529	4801819	protease,transposase,bacteriocin,tRNA	Bacillus_virus(33.33%)	44	NA	NA
AYU26042.1|3066826_3067285_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU26043.1|3067474_3068554_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYU26044.1|3068655_3069819_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYU26045.1|3069840_3070887_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYU26046.1|3071260_3071686_+	hypothetical protein	NA	NA	NA	NA	NA
AYU26047.1|3071711_3072290_+	hypothetical protein	NA	NA	NA	NA	NA
AYU26048.1|3072323_3072998_+	hypothetical protein	NA	NA	NA	NA	NA
AYU26049.1|3072979_3073663_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYU26050.1|3073656_3074313_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYU26051.1|3074417_3074876_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU26052.1|3075064_3077056_-	transketolase	NA	NA	NA	NA	NA
AYU26053.1|3077331_3078090_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYU26054.1|3078190_3079111_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYU26055.1|3079338_3081315_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYU26056.1|3081323_3081455_-	hypothetical protein	NA	NA	NA	NA	NA
AYU26057.1|3081749_3082049_-	membrane protein	NA	NA	NA	NA	NA
AYU26058.1|3082104_3083259_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYU26059.1|3083751_3085146_+	galactose-proton symport	NA	NA	NA	NA	NA
AYU26060.1|3085224_3085722_+	hypothetical protein	NA	NA	NA	NA	NA
AYU26061.1|3085817_3086525_+	endonuclease I	NA	NA	NA	NA	NA
AYU26062.1|3086601_3087333_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYU26063.1|3087352_3088300_+	glutathione synthetase	NA	NA	NA	NA	NA
AYU26064.1|3088515_3089079_+	hypothetical protein	NA	NA	NA	NA	NA
AYU26065.1|3089078_3089495_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYU26066.1|3089541_3090228_-	global regulatory protein	NA	NA	NA	NA	NA
AYU26067.1|3090357_3091338_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYU26068.1|3091355_3092060_+	hypothetical protein	NA	NA	NA	NA	NA
AYU26069.1|3092078_3092645_+	hypothetical protein	NA	NA	NA	NA	NA
AYU26070.1|3092641_3092932_+	hypothetical protein	NA	NA	NA	NA	NA
AYU26071.1|3092939_3093533_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYU26072.1|3093525_3094662_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYU26073.1|3094752_3095760_-	hypothetical protein	NA	NA	NA	NA	NA
AYU26074.1|3095892_3096939_-	L-asparaginase	NA	NA	NA	NA	NA
AYU26075.1|3097257_3097716_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU26076.1|3097838_3098558_-	hypothetical protein	NA	NA	NA	NA	NA
AYU26077.1|3098607_3098934_-	hypothetical protein	NA	NA	NA	NA	NA
AYU26078.1|3098933_3099653_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYU26079.1|3099807_3100860_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYU26080.1|3100887_3101163_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYU26081.1|3101275_3102361_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYU26082.1|3102577_3103834_+	nucleoside permease	NA	NA	NA	NA	NA
AYU26083.1|3106444_3107152_+	hypothetical protein	NA	NA	NA	NA	NA
AYU26084.1|3109741_3110008_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYU26085.1|3110250_3110529_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029850	Salmonella enterica subsp. enterica serovar Typhi strain 343078_203125 chromosome, complete genome	4801819	3439827	3463895	4801819	integrase,transposase	Salmonella_phage(27.27%)	29	3446574:3446633	3465423:3466190
AYU26371.1|3439827_3440730_-|integrase	integrase/recombinase	integrase	A0A142F1N9	Bacillus_phage	30.6	1.6e-26
AYU26372.1|3440726_3441434_-	hypothetical protein	NA	NA	NA	NA	NA
AYU26373.1|3441430_3442255_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
AYU26374.1|3442291_3442495_-	lipoprotein	NA	NA	NA	NA	NA
AYU26375.1|3442680_3444690_+	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	97.0	2.3e-118
AYU26376.1|3444704_3445058_+	hypothetical protein	NA	NA	NA	NA	NA
AYU26377.1|3445127_3445448_+	CyaY protein	NA	NA	NA	NA	NA
AYU26378.1|3445519_3445882_-	hypothetical protein	NA	NA	NA	NA	NA
AYU26379.1|3445893_3446436_-	hypothetical protein	NA	NA	NA	NA	NA
3446574:3446633	attL	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGC	NA	NA	NA	NA
AYU26380.1|3447432_3447867_-	transcriptional regulator MerR	NA	NA	NA	NA	NA
AYU26381.1|3447884_3448289_+	MerT	NA	NA	NA	NA	NA
AYU26382.1|3448302_3448578_+	mercuric transport protein	NA	NA	NA	NA	NA
AYU26383.1|3448613_3449036_+	mercury transport protein MerC	NA	NA	NA	NA	NA
AYU26384.1|3449087_3450782_+	mercuric reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
AYU26385.1|3450799_3451162_+	transcriptional regulator MerD	NA	NA	NA	NA	NA
AYU26386.1|3451158_3451395_+	mercury resistance protein	NA	NA	NA	NA	NA
AYU26387.1|3451391_3452099_+	hypothetical protein	NA	NA	NA	NA	NA
AYU26388.1|3452137_3453442_+|integrase	integrase	integrase	NA	NA	NA	NA
AYU26389.1|3453470_3454193_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYU26390.1|3454334_3455195_-	beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AYU26391.1|3455377_3455644_-	resolvase	NA	Q1MVP4	Enterobacteria_phage	100.0	1.4e-36
AYU26392.1|3455676_3456399_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	3.2e-139
AYU26393.1|3456632_3457559_-	sulfonamide-resistant dihydropteroate synthase sul1	NA	NA	NA	NA	NA
AYU26394.1|3457465_3457846_-	Ethidium bromide-methyl viologen resistance protein EmrE	NA	NA	NA	NA	NA
AYU26395.1|3458042_3458642_-	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	31.4	3.1e-15
AYU26396.1|3458673_3459687_+|integrase	phage integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
AYU26397.1|3459676_3460240_+	transposon tn21 modulator protein	NA	NA	NA	NA	NA
AYU26398.1|3460365_3460926_+	Tn21 resolvase	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
AYU26399.1|3460928_3463895_+|transposase	transposase tn21	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
3465423:3466190	attR	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGCTTCTGTTTCTATCAGCTGTCCCTCCTGTTCAGCTACTGACGGGGTGGTGCGTAACGGCAAAAGCACCGCCGGACATCAGCGCTATCTCTGCTCTCACTGCCGTAAAACATGGCAACTGCAGTTCACTTACACCGCTTCTCAACCCGGTACGCACCAGAAAATCATTGATATGGCCATGAATGGCGTTGGATGCCGGGCAACCGCCCGCATTATGGGCGTTGGCCTCAACACGATTTTCCGCCATTTAAAAAACTCAGGCCGCAGTCGGTAACCTCGCGCATACAGCCGGGCAGTGACGTCATCGTCTGCGCGGAAATGGACGAACAGTGGGGATACGTCGGGGCTAAATCGCGCCAGCGCTGGCTGTTTTACGCGTATGACAGGCTCCGGAAGACGGTTGTTGCGCACGTATTCGGTGAACGCACTATGGCGACGCTGGGGCGTCTTATGAGCCTGCTGTCACCCTTTGACGTGGTGATATGGATGACGGATGGCTGGCCGCTGTATGAATCCCGCCTGAAGGGAAAGCTGCACGTAATCAGCAAGCGATATACGCAGCGAATTGAGCGGCATAACCTGAATCTGAGGCAGCACCTGGCACGGCTGGGACGGAAGTCGCTGTCGTTCTCAAAATCGGTGGAGCTGCATGACAAAGTCATCGGGCATTATCTGAACATAAAACACTATCAATAAGTTGGAGTCATTACC	NA	NA	NA	NA
>prophage 11
CP029850	Salmonella enterica subsp. enterica serovar Typhi strain 343078_203125 chromosome, complete genome	4801819	3507609	3599377	4801819	transposase,plate,integrase,tRNA,portal,terminase,capsid,tail	Salmonella_phage(66.67%)	83	3496471:3496486	3575482:3575497
3496471:3496486	attL	CGGTGACGAATTCGAC	NA	NA	NA	NA
AYU26436.1|3507609_3509256_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYU26437.1|3509395_3509494_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYU26438.1|3509749_3510079_+	hypothetical protein	NA	NA	NA	NA	NA
AYU26439.1|3510119_3511172_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYU26440.1|3511567_3512137_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYU26441.1|3512262_3512484_+	hypothetical protein	NA	NA	NA	NA	NA
AYU26442.1|3512516_3513026_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYU26443.1|3513200_3513425_+	hypothetical protein	NA	NA	NA	NA	NA
AYU26444.1|3513447_3513789_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYU26445.1|3513856_3514090_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYU26446.1|3514089_3514317_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYU26447.1|3514313_3515171_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
AYU26448.1|3515167_3517582_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYU26449.1|3517735_3517924_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYU26450.1|3519891_3520806_+	hypothetical protein	NA	NA	NA	NA	NA
AYU26451.1|3520802_3521543_+	hypothetical protein	NA	NA	NA	NA	NA
AYU26452.1|3521577_3522615_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYU26453.1|3522614_3524381_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYU26454.1|3524523_3525357_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.3	3.4e-121
AYU26455.1|3525373_3526432_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYU26456.1|3526435_3527086_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYU26457.1|3527118_3527646_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYU26458.1|3527645_3527849_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYU26459.1|3527852_3528068_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYU26460.1|3528087_3528561_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYU26461.1|3528562_3528940_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYU26462.1|3528936_3529365_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYU26463.1|3529460_3529892_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYU26464.1|3529884_3530331_+|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYU26465.1|3530399_3530978_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYU26466.1|3530974_3531334_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYU26467.1|3531320_3532229_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYU26468.1|3532221_3532827_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYU26469.1|3532823_3534338_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYU26470.1|3534337_3534931_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYU26471.1|3534902_3535343_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYU26472.1|3535765_3536338_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYU26473.1|3536480_3537653_+|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYU26474.1|3537662_3538178_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYU26475.1|3538232_3538535_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYU26476.1|3538549_3538669_+	hypothetical protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYU26477.1|3538661_3541739_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYU26478.1|3541735_3542221_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYU26479.1|3542217_3543318_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYU26480.1|3543408_3543627_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYU26481.1|3545208_3545667_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU26482.1|3545774_3546113_-	hypothetical protein	NA	NA	NA	NA	NA
AYU26483.1|3546231_3547068_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
AYU26484.1|3553290_3554880_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.4	8.4e-68
AYU26485.1|3554895_3556185_+	phosphoribosylglycineamide synthetase	NA	NA	NA	NA	NA
AYU26486.1|3556181_3557507_-	transcriptional regulator	NA	NA	NA	NA	NA
AYU26487.1|3557512_3558910_-	two-component system sensor protein	NA	NA	NA	NA	NA
AYU26488.1|3559163_3559619_+	zinc resistance protein	NA	NA	NA	NA	NA
AYU26489.1|3559660_3560353_-	hypothetical protein	NA	NA	NA	NA	NA
AYU26490.1|3560364_3560637_-	histone like DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	57.8	5.5e-20
AYU26491.1|3560823_3561414_-	hypothetical protein	NA	NA	NA	NA	NA
AYU26492.1|3561455_3562127_-	endonuclease	NA	A0A1V0SJW5	Klosneuvirus	28.7	2.1e-20
AYU26493.1|3562136_3563201_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
AYU26494.1|3563241_3564015_-	NADH pyrophosphatase	NA	NA	NA	NA	NA
AYU26495.1|3564107_3564596_+	regulatory protein	NA	NA	NA	NA	NA
AYU26496.1|3564959_3566855_+	thiamine biosynthesis protein ThiC	NA	NA	NA	NA	NA
AYU26497.1|3566854_3567490_+	thiamine-phosphate pyrophosphorylase	NA	NA	NA	NA	NA
AYU26498.1|3567482_3568241_+	thiamine biosynthesis protein ThiF	NA	A0A1V0SAV8	Catovirus	28.5	7.0e-12
AYU26499.1|3568248_3568422_+	thiamine biosynthesis protein ThiS	NA	NA	NA	NA	NA
AYU26500.1|3568423_3569194_+	thiamine biosynthesis protein ThiG	NA	NA	NA	NA	NA
AYU26501.1|3569190_3570324_+	thiamine biosynthesis protein ThiH	NA	NA	NA	NA	NA
AYU26502.1|3570404_3570662_-	hypothetical protein	NA	NA	NA	NA	NA
AYU26503.1|3571423_3571702_-	hypothetical protein	NA	NA	NA	NA	NA
AYU26504.1|3571788_3576012_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.1	5.0e-67
3575482:3575497	attR	GTCGAATTCGTCACCG	NA	NA	NA	NA
AYU26505.1|3576088_3580117_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
AYU26506.1|3580434_3580800_-	50S ribosomal subunit protein L7/L12	NA	NA	NA	NA	NA
AYU26507.1|3580866_3581364_-	50S ribosomal subunit protein L10	NA	NA	NA	NA	NA
AYU26508.1|3581779_3582484_-	50S ribosomal subunit protein L1	NA	NA	NA	NA	NA
AYU26509.1|3582487_3582916_-	50S ribosomal subunit protein L11	NA	NA	NA	NA	NA
AYU26510.1|3583073_3583619_-	transcription antitermination protein	NA	NA	NA	NA	NA
AYU26511.1|3583620_3584004_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
AYU26512.1|3584233_3585418_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.6e-13
AYU26513.1|3586376_3587327_+	pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.5	7.9e-29
AYU26514.1|3587361_3588324_-	bifunctional biotin operon repressor/biotin-[acetyl-CoA carboxylase] synthetase	NA	NA	NA	NA	NA
AYU26515.1|3588320_3589349_-	UDP-N-acetylenolpyruvoylglucosamine reductase	NA	NA	NA	NA	NA
AYU26516.1|3595262_3596045_-	glutamate racemase	NA	NA	NA	NA	NA
AYU26517.1|3596058_3597903_-	vitamin B12 receptor protein	NA	A0A0P0I887	Acinetobacter_phage	30.0	2.2e-11
AYU26518.1|3598276_3599377_+|tRNA	tRNA (uracil-5)-methyltransferase	tRNA	NA	NA	NA	NA
>prophage 12
CP029850	Salmonella enterica subsp. enterica serovar Typhi strain 343078_203125 chromosome, complete genome	4801819	4461445	4535705	4801819	plate,integrase,portal,terminase,capsid,tail	Salmonella_phage(82.98%)	76	4522949:4522965	4535864:4535880
AYU27253.1|4461445_4463395_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYU27254.1|4463466_4464375_+	hypothetical protein	NA	NA	NA	NA	NA
AYU27255.1|4464448_4465348_+	hypothetical protein	NA	NA	NA	NA	NA
AYU27256.1|4465389_4465749_+	hypothetical protein	NA	NA	NA	NA	NA
AYU27257.1|4465848_4466118_-	hypothetical protein	NA	NA	NA	NA	NA
AYU27258.1|4466249_4467524_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYU27259.1|4467743_4468121_+	hypothetical protein	NA	NA	NA	NA	NA
AYU27260.1|4468207_4468426_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYU27261.1|4468493_4469594_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYU27262.1|4469590_4470076_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYU27263.1|4470075_4472856_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYU27264.1|4472848_4472968_-	hypothetical protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYU27265.1|4472982_4473285_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYU27266.1|4473339_4473855_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYU27267.1|4473864_4475037_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYU27268.1|4475571_4476294_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYU27269.1|4476491_4476899_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYU27270.1|4476905_4478525_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYU27271.1|4478521_4479127_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYU27272.1|4479119_4480028_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	95.4	7.0e-152
AYU27273.1|4480014_4480374_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYU27274.1|4480370_4480949_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYU27275.1|4481017_4481464_-|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYU27276.1|4481456_4481888_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYU27277.1|4481983_4482409_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYU27278.1|4482408_4482786_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYU27279.1|4482790_4483261_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYU27280.1|4483280_4483496_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYU27281.1|4483499_4483703_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYU27282.1|4483702_4484167_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYU27283.1|4484260_4484911_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYU27284.1|4484914_4485979_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYU27285.1|4485995_4486829_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYU27286.1|4486971_4488738_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYU27287.1|4488734_4489781_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYU27288.1|4489829_4490525_-	hypothetical protein	NA	NA	NA	NA	NA
AYU27289.1|4490544_4491609_-	hypothetical protein	NA	NA	NA	NA	NA
AYU27290.1|4491605_4492670_-	hypothetical protein	NA	NA	NA	NA	NA
AYU27291.1|4493594_4493924_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYU27292.1|4493920_4495990_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYU27293.1|4495980_4496841_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYU27294.1|4496837_4497422_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYU27295.1|4497418_4497646_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYU27296.1|4497645_4497879_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYU27297.1|4497946_4498288_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYU27298.1|4498251_4498452_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYU27299.1|4498459_4498969_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYU27300.1|4499001_4499244_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYU27301.1|4499360_4499993_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYU27302.1|4499996_4501022_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYU27303.1|4501128_4501482_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYU27304.1|4502098_4502386_+	hypothetical protein	NA	NA	NA	NA	NA
AYU27305.1|4502396_4503287_+	methyltransferase	NA	NA	NA	NA	NA
AYU27306.1|4503286_4504033_+	hypothetical protein	NA	NA	NA	NA	NA
AYU27307.1|4504334_4506308_-	Vi polysaccharide export protein VexE	NA	NA	NA	NA	NA
AYU27308.1|4506327_4507632_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYU27309.1|4507654_4508350_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYU27310.1|4508375_4509170_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYU27311.1|4509179_4510247_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYU27312.1|4510291_4512028_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYU27313.1|4512027_4514523_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYU27314.1|4514546_4515593_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYU27315.1|4515595_4516873_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYU27316.1|4517117_4517657_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYU27317.1|4518510_4520022_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYU27318.1|4520005_4521595_+	hypothetical protein	NA	NA	NA	NA	NA
AYU27319.1|4521758_4522772_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4522949:4522965	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYU27320.1|4523198_4523492_+	hypothetical protein	NA	NA	NA	NA	NA
AYU27321.1|4523488_4523977_+	hypothetical protein	NA	NA	NA	NA	NA
AYU27322.1|4524156_4524609_-	hypothetical protein	NA	NA	NA	NA	NA
AYU27323.1|4529831_4530293_+	hypothetical protein	NA	NA	NA	NA	NA
AYU27324.1|4530289_4530511_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYU27325.1|4531367_4532150_+	hypothetical protein	NA	NA	NA	NA	NA
AYU27326.1|4532776_4533001_-	hypothetical protein	NA	NA	NA	NA	NA
AYU27327.1|4533130_4534135_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
AYU27328.1|4534445_4535705_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4535864:4535880	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 13
CP029850	Salmonella enterica subsp. enterica serovar Typhi strain 343078_203125 chromosome, complete genome	4801819	4677957	4688216	4801819	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYU27465.1|4677957_4679034_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYU27466.1|4679030_4680104_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYU27467.1|4680078_4681242_-	hypothetical protein	NA	NA	NA	NA	NA
AYU27468.1|4681517_4682084_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYU27469.1|4682099_4682339_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYU27470.1|4682342_4683203_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYU27471.1|4683625_4683949_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYU27472.1|4683932_4684433_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYU27473.1|4684429_4684657_+	hypothetical protein	NA	NA	NA	NA	NA
AYU27474.1|4684653_4684974_+	P4 phage protein	NA	NA	NA	NA	NA
AYU27475.1|4684988_4685663_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYU27476.1|4685659_4687321_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYU27477.1|4688057_4688216_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
>prophage 1
CP029851	Salmonella enterica subsp. enterica serovar Typhi strain 343078_203125 plasmid pHCM2, complete sequence	106705	558	90015	106705	tail	Salmonella_phage(95.28%)	108	NA	NA
AYU27568.1|558_990_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	100.0	4.0e-73
AYU27569.1|1109_2138_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.8	1.1e-164
AYU27570.1|2198_3143_+	exonuclease	NA	J9Q7S6	Salmonella_phage	99.4	6.8e-182
AYU27571.1|3142_3409_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
AYU27572.1|3411_4488_+	putative recombinase	NA	J9Q736	Salmonella_phage	99.7	5.5e-204
AYU27573.1|4783_5626_+	putative lipoprotein	NA	J9Q7Z4	Salmonella_phage	97.1	2.3e-125
AYU27574.1|5788_6160_+	hypothetical protein	NA	J9Q7S7	Salmonella_phage	98.4	3.0e-69
AYU27575.1|6143_6554_+	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.1	1.4e-75
AYU27576.1|6622_6898_+	hypothetical protein	NA	J9Q738	Salmonella_phage	96.7	5.9e-46
AYU27577.1|6937_7243_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	90.8	4.9e-33
AYU27578.1|7242_7446_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	4.0e-31
AYU27579.1|7974_9030_-	putative replication protein A	NA	J9Q7H0	Salmonella_phage	98.0	1.5e-185
AYU27580.1|9774_10419_+	hypothetical protein	NA	J9Q739	Salmonella_phage	98.1	2.4e-122
AYU27581.1|10494_10989_+	hypothetical protein	NA	J9Q6J3	Salmonella_phage	97.6	2.3e-88
AYU27582.1|11020_11326_-	hypothetical protein	NA	J9Q7Z6	Salmonella_phage	97.0	2.0e-50
AYU27583.1|11752_12838_+	exonuclease	NA	J9Q7S9	Salmonella_phage	98.9	2.7e-206
AYU27584.1|12834_13071_+	hypothetical protein	NA	J9Q7H1	Salmonella_phage	98.4	1.1e-29
AYU27585.1|13067_14984_+	exonuclease	NA	J9Q741	Salmonella_phage	98.6	0.0e+00
AYU27586.1|14973_15720_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	98.0	4.4e-136
AYU27587.1|15732_16302_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	99.5	1.7e-103
AYU27588.1|16379_18695_+	ribonucleotide-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.7	0.0e+00
AYU27589.1|18802_19945_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	99.5	2.4e-218
AYU27590.1|20027_20957_+	hypothetical protein	NA	J9Q742	Salmonella_phage	99.0	3.8e-161
AYU27591.1|21072_22188_+	putative thymidylate synthase	NA	J9Q6J6	Salmonella_phage	98.1	7.6e-217
AYU27592.1|22189_22603_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	97.8	4.7e-71
AYU27593.1|22599_23076_+	hypothetical protein	NA	J9Q7T1	Salmonella_phage	100.0	1.4e-90
AYU27594.1|23075_23720_+	hypothetical protein	NA	J9Q7H4	Salmonella_phage	100.0	5.2e-117
AYU27595.1|23783_24203_+	hypothetical protein	NA	J9Q743	Salmonella_phage	98.6	2.9e-68
AYU27596.1|24212_24770_+	hypothetical protein	NA	J9Q6J8	Salmonella_phage	99.5	7.0e-102
AYU27597.1|24814_25741_+	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	85.4	4.1e-107
AYU27598.1|25926_26520_+	hypothetical protein	NA	J9Q7T2	Salmonella_phage	99.5	4.6e-112
AYU27599.1|26722_26953_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	100.0	2.1e-36
AYU27600.1|27538_28147_+	putative ribonuclease H	NA	J9Q745	Salmonella_phage	99.5	2.2e-117
AYU27601.1|28289_28784_+	hypothetical protein	NA	J9Q6J9	Salmonella_phage	96.3	1.9e-79
AYU27602.1|28793_28982_+	hypothetical protein	NA	J9Q800	Salmonella_phage	100.0	1.2e-26
AYU27603.1|29090_29933_+	hypothetical protein	NA	J9Q7T3	Salmonella_phage	71.1	2.1e-70
AYU27604.1|30041_30614_+	hypothetical protein	NA	J9Q7H6	Salmonella_phage	98.9	8.2e-98
AYU27605.1|30737_32441_+	putative DNA modification methylase	NA	J9Q747	Salmonella_phage	98.9	0.0e+00
AYU27606.1|32499_33189_+	hypothetical protein	NA	J9Q6K2	Salmonella_phage	98.3	6.1e-124
AYU27607.1|33185_33359_+	hypothetical protein	NA	J9Q801	Salmonella_phage	98.2	9.5e-26
AYU27608.1|33469_33841_+	hypothetical protein	NA	J9Q7T4	Salmonella_phage	100.0	3.2e-63
AYU27609.1|33932_34574_+	hypothetical protein	NA	J9Q7H7	Salmonella_phage	100.0	9.7e-116
AYU27610.1|34570_35113_+	hypothetical protein	NA	J9Q748	Salmonella_phage	93.1	2.6e-93
AYU27611.1|35124_35433_+	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	56.9	3.0e-14
AYU27612.1|35429_35717_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	58.8	9.9e-28
AYU27613.1|35777_35981_-	hypothetical protein	NA	J9Q802	Salmonella_phage	95.5	1.5e-30
AYU27614.1|36154_36436_+	hypothetical protein	NA	J9Q7T5	Salmonella_phage	71.6	3.2e-31
AYU27615.1|36520_36838_+	hypothetical protein	NA	J9Q750	Salmonella_phage	80.0	8.1e-47
AYU27616.1|36847_38038_+	hypothetical protein	NA	J9Q803	Salmonella_phage	54.6	5.4e-120
AYU27617.1|39474_39720_-	hypothetical protein	NA	J9Q751	Salmonella_phage	92.5	5.8e-37
AYU27618.1|39862_40078_+	hypothetical protein	NA	J9Q6K7	Salmonella_phage	95.8	4.5e-33
AYU27619.1|40088_40307_+	hypothetical protein	NA	J9Q804	Salmonella_phage	98.6	6.4e-35
AYU27620.1|40401_40716_+	hypothetical protein	NA	NA	NA	NA	NA
AYU27621.1|40792_41104_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	92.2	1.1e-45
AYU27622.1|41232_41625_+	hypothetical protein	NA	J9Q7I1	Salmonella_phage	65.4	1.7e-41
AYU27623.1|41745_42033_+	hypothetical protein	NA	J9Q753	Salmonella_phage	94.6	1.5e-47
AYU27624.1|42238_42721_+	hypothetical protein	NA	J9Q805	Salmonella_phage	96.9	5.5e-87
AYU27625.1|43352_43580_-	hypothetical protein	NA	NA	NA	NA	NA
AYU27626.1|43664_44315_-	hypothetical protein	NA	J9Q754	Salmonella_phage	100.0	1.4e-114
AYU27627.1|44949_45477_-	putative transcriptional regulator	NA	J9Q6L0	Salmonella_phage	96.6	4.1e-80
AYU27628.1|45481_45904_-	putative lipoprotein	NA	J9Q806	Salmonella_phage	85.7	8.2e-63
AYU27629.1|45963_46242_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	98.9	3.4e-41
AYU27630.1|46244_47804_-	putative helicase	NA	J9Q7I4	Salmonella_phage	99.4	5.7e-295
AYU27631.1|47886_48567_+	hypothetical protein	NA	J9Q756	Salmonella_phage	99.6	7.4e-122
AYU27632.1|48566_49235_+	hypothetical protein	NA	J9Q6L1	Salmonella_phage	99.5	1.1e-114
AYU27633.1|49231_49870_+	putative ABC transporter ATP-binding protein	NA	J9Q807	Salmonella_phage	99.1	5.5e-111
AYU27634.1|49862_50117_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
AYU27635.1|50113_51013_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.3	4.0e-168
AYU27636.1|51022_51289_+	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
AYU27637.1|51484_52126_+	hypothetical protein	NA	J9Q6D4	Salmonella_phage	99.1	1.2e-108
AYU27638.1|52128_53385_+	hypothetical protein	NA	J9Q7Y2	Salmonella_phage	99.8	5.3e-251
AYU27639.1|53418_54993_+	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.0	3.2e-301
AYU27640.1|55015_55912_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	96.6	5.7e-146
AYU27641.1|55938_56814_+	hypothetical protein	NA	J9Q710	Salmonella_phage	100.0	3.8e-163
AYU27642.1|56888_57812_+	hypothetical protein	NA	J9Q6D6	Salmonella_phage	100.0	3.3e-157
AYU27643.1|57855_58290_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	100.0	2.1e-74
AYU27644.1|58289_59123_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	100.0	2.6e-153
AYU27645.1|59220_59565_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
AYU27646.1|59555_60029_+	hypothetical protein	NA	J9Q711	Salmonella_phage	100.0	2.3e-82
AYU27647.1|60030_60414_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	100.0	1.7e-67
AYU27648.1|60488_61235_+	hypothetical protein	NA	J9Q7Y4	Salmonella_phage	96.8	7.8e-125
AYU27649.1|61294_61612_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
AYU27650.1|61692_61962_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	8.4e-37
AYU27651.1|61969_66553_+	hypothetical protein	NA	J9Q712	Salmonella_phage	92.8	0.0e+00
AYU27652.1|66594_66930_+	hypothetical protein	NA	J9Q6E1	Salmonella_phage	97.3	5.7e-59
AYU27653.1|66986_67718_+|tail	putative phage tail protein	tail	J9Q7Y5	Salmonella_phage	99.1	3.3e-136
AYU27654.1|67710_68508_+	hypothetical protein	NA	J9Q7R4	Salmonella_phage	95.8	1.2e-155
AYU27655.1|68495_69083_+|tail	putative phage tail protein	tail	J9Q7F8	Salmonella_phage	91.8	2.5e-102
AYU27656.1|69097_73486_+|tail	putative phage tail protein	tail	J9Q713	Salmonella_phage	86.7	0.0e+00
AYU27657.1|73568_76121_+	hypothetical protein	NA	A0A0A0YQM3	Citrobacter_virus	52.5	1.4e-152
AYU27658.1|76235_76559_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	97.2	2.7e-50
AYU27659.1|76545_77265_+	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	95.7	1.5e-125
AYU27660.1|77333_77678_+	hypothetical protein	NA	J9Q7G2	Salmonella_phage	83.6	5.9e-27
AYU27661.1|77728_78280_-	hypothetical protein	NA	A0A2H4J5U3	uncultured_Caudovirales_phage	39.8	7.8e-29
AYU27662.1|78610_79276_+	hypothetical protein	NA	J9Q7R7	Salmonella_phage	95.0	8.0e-113
AYU27663.1|79275_79635_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	2.3e-45
AYU27664.1|79683_80439_+	hypothetical protein	NA	J9Q7Y9	Salmonella_phage	43.0	3.2e-57
AYU27665.1|80508_81564_-	hypothetical protein	NA	A0A2I7RNF6	Vibrio_phage	42.6	5.1e-61
AYU27666.1|81841_82567_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	98.3	2.4e-139
AYU27667.1|82627_83968_+	putative DNA helicase	NA	J9Q7G4	Salmonella_phage	99.6	3.8e-247
AYU27668.1|84030_85242_+	hypothetical protein	NA	J9Q720	Salmonella_phage	96.5	6.6e-214
AYU27669.1|85243_86296_-	hypothetical protein	NA	J9Q6F5	Salmonella_phage	56.7	1.9e-92
AYU27670.1|86479_87274_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.2	4.9e-141
AYU27671.1|87574_87832_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	92.9	4.9e-34
AYU27672.1|87866_89189_+	DNA ligase	NA	J9Q7G5	Salmonella_phage	98.4	5.8e-256
AYU27673.1|89354_89561_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.5	8.1e-32
AYU27674.1|89560_89713_+	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	96.0	7.6e-19
AYU27675.1|89709_90015_+	hypothetical protein	NA	J9Q7S1	Salmonella_phage	98.0	9.2e-48
