The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029960	Salmonella enterica subsp. enterica serovar Typhi strain 343078_251131 chromosome, complete genome	4799747	930528	937840	4799747	integrase,protease	Dickeya_phage(16.67%)	6	931779:931793	942958:942972
AYU41428.1|930528_931647_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYU41429.1|931643_933590_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931779:931793	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYU41430.1|933719_933941_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYU41431.1|934264_934585_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYU41432.1|934615_936892_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYU41433.1|937462_937840_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942958:942972	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029960	Salmonella enterica subsp. enterica serovar Typhi strain 343078_251131 chromosome, complete genome	4799747	1008978	1086290	4799747	integrase,terminase,tail,protease,transposase	Salmonella_phage(73.33%)	93	991044:991063	1061651:1061670
991044:991063	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYU41483.1|1008978_1010319_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYU41484.1|1010315_1010564_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYU41485.1|1010604_1010850_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYU41486.1|1010849_1011731_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYU41487.1|1011727_1012792_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYU41488.1|1012869_1013550_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYU41489.1|1013546_1014332_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYU41490.1|1014337_1014634_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYU41491.1|1014724_1014925_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYU41492.1|1015213_1015618_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYU41493.1|1015949_1016324_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYU41494.1|1016408_1017392_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYU41495.1|1017394_1018144_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYU41496.1|1018154_1018502_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYU41497.1|1018498_1019023_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYU41498.1|1019022_1019496_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYU41499.1|1019499_1020072_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYU41500.1|1020165_1020432_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYU41501.1|1020513_1020675_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU41502.1|1021107_1021605_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU41503.1|1021789_1022029_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYU41504.1|1022018_1022324_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYU41505.1|1022363_1022966_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYU41506.1|1023174_1023786_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYU41507.1|1023918_1024716_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYU41508.1|1025114_1025240_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU41509.1|1025375_1025825_-	lipoprotein	NA	NA	NA	NA	NA
AYU41510.1|1026041_1026431_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYU41511.1|1026417_1026699_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYU41512.1|1026698_1027313_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYU41513.1|1027531_1027786_+	hypothetical protein	NA	NA	NA	NA	NA
AYU41514.1|1027890_1028268_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYU41515.1|1028331_1028592_+	hypothetical protein	NA	NA	NA	NA	NA
AYU41516.1|1028681_1029434_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYU41517.1|1029399_1030803_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYU41518.1|1030802_1032272_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYU41519.1|1032363_1032894_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYU41520.1|1032908_1034141_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYU41521.1|1034145_1034643_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYU41522.1|1034654_1035596_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYU41523.1|1035637_1036006_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYU41524.1|1035971_1036379_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYU41525.1|1036375_1036930_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYU41526.1|1036916_1037306_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYU41527.1|1037280_1037844_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYU41528.1|1037847_1038993_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYU41529.1|1039004_1039445_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYU41530.1|1039448_1039901_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYU41531.1|1040078_1042031_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYU41532.1|1042030_1042681_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYU41533.1|1042684_1042987_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYU41534.1|1042989_1044021_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYU41535.1|1044017_1044353_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYU41536.1|1044547_1045279_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU41537.1|1045278_1045707_+	bacteriophage protein	NA	NA	NA	NA	NA
AYU41538.1|1045765_1046521_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYU41539.1|1046608_1046746_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYU41540.1|1046761_1047115_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYU41541.1|1047115_1048315_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYU41542.1|1048311_1048992_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYU41543.1|1048991_1050503_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYU41544.1|1050517_1051036_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYU41545.1|1051957_1052659_-	hypothetical protein	NA	NA	NA	NA	NA
AYU41546.1|1052971_1053250_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYU41547.1|1053675_1056288_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYU41548.1|1056495_1057506_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYU41549.1|1057668_1058214_+	hypothetical protein	NA	NA	NA	NA	NA
AYU41550.1|1058210_1059320_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYU41551.1|1059418_1061527_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYU41552.1|1061539_1063447_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061651:1061670	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYU41553.1|1063461_1064715_+	inner membrane protein	NA	NA	NA	NA	NA
AYU41554.1|1064719_1066360_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYU41555.1|1066356_1066920_+	lipoprotein	NA	NA	NA	NA	NA
AYU41556.1|1067173_1067341_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYU41557.1|1067440_1067959_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYU41558.1|1068027_1069788_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYU41559.1|1069973_1070426_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYU41560.1|1070497_1071550_-	outer membrane protein A	NA	NA	NA	NA	NA
AYU41561.1|1071904_1072414_-	cell division inhibitor	NA	NA	NA	NA	NA
AYU41562.1|1072630_1073236_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYU41563.1|1073222_1075376_-	inner membrane protein	NA	NA	NA	NA	NA
AYU41564.1|1075394_1075841_-	hypothetical protein	NA	NA	NA	NA	NA
AYU41565.1|1075964_1078019_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYU41566.1|1078054_1078513_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYU41567.1|1078607_1079270_-	hypothetical protein	NA	NA	NA	NA	NA
AYU41568.1|1079440_1079857_+	hypothetical protein	NA	NA	NA	NA	NA
AYU41569.1|1079901_1080219_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYU41570.1|1080276_1081488_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYU41571.1|1082619_1083078_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU41572.1|1083814_1084096_+	acylphosphatase	NA	NA	NA	NA	NA
AYU41573.1|1084092_1084422_-	sulfite reductase	NA	NA	NA	NA	NA
AYU41574.1|1084508_1085168_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYU41575.1|1085831_1086290_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029960	Salmonella enterica subsp. enterica serovar Typhi strain 343078_251131 chromosome, complete genome	4799747	1529108	1602650	4799747	tail,head,protease,tRNA,transposase,plate	Burkholderia_virus(41.03%)	82	NA	NA
AYU41974.1|1529108_1529567_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU41975.1|1530069_1530351_+	stress response protein	NA	NA	NA	NA	NA
AYU41976.1|1530619_1531441_+|protease	serine protease	protease	NA	NA	NA	NA
AYU41977.1|1531475_1531805_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYU41978.1|1531791_1532154_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYU41979.1|1532265_1532436_-	hypothetical protein	NA	NA	NA	NA	NA
AYU41980.1|1532570_1533605_+	hypothetical protein	NA	NA	NA	NA	NA
AYU41981.1|1533779_1535168_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYU41982.1|1535178_1536708_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYU41983.1|1537234_1538179_+	hypothetical protein	NA	NA	NA	NA	NA
AYU41984.1|1538360_1538750_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYU41985.1|1538721_1539174_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYU41986.1|1539368_1539599_-	hypothetical protein	NA	NA	NA	NA	NA
AYU41987.1|1539595_1540279_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYU41988.1|1540275_1540491_-	hypothetical protein	NA	NA	NA	NA	NA
AYU41989.1|1540483_1540867_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
AYU41990.1|1540863_1541166_-	hypothetical protein	NA	NA	NA	NA	NA
AYU41991.1|1541175_1541448_-	hypothetical protein	NA	NA	NA	NA	NA
AYU41992.1|1541736_1542267_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYU41993.1|1542294_1542564_-	hypothetical protein	NA	NA	NA	NA	NA
AYU41994.1|1542566_1543733_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYU41995.1|1543743_1545513_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYU41996.1|1545690_1546122_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
AYU41997.1|1546117_1546714_+	hypothetical protein	NA	NA	NA	NA	NA
AYU41998.1|1546957_1547308_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYU41999.1|1548022_1548673_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYU42000.1|1548669_1548996_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AYU42001.1|1548995_1549307_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYU42002.1|1549306_1549852_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYU42003.1|1549848_1551444_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYU42004.1|1551443_1552940_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYU42005.1|1552920_1553742_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYU42006.1|1553744_1554203_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYU42007.1|1554417_1555533_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYU42008.1|1555547_1556501_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYU42009.1|1556510_1556849_+	hypothetical protein	NA	NA	NA	NA	NA
AYU42010.1|1556850_1557297_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYU42011.1|1557296_1557761_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYU42012.1|1557757_1558012_+	hypothetical protein	NA	NA	NA	NA	NA
AYU42013.1|1558001_1559429_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYU42014.1|1559428_1559950_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYU42015.1|1559952_1560234_+	hypothetical protein	NA	NA	NA	NA	NA
AYU42016.1|1560331_1560667_+	hypothetical protein	NA	NA	NA	NA	NA
AYU42017.1|1560842_1563308_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYU42018.1|1563307_1564192_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYU42019.1|1564188_1564404_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYU42020.1|1564391_1565546_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYU42021.1|1565542_1566070_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYU42022.1|1566126_1566474_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYU42023.1|1566464_1567568_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYU42024.1|1567560_1568139_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYU42025.1|1568141_1569167_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYU42026.1|1569218_1569653_+|tail	phage tail protein	tail	A0A0F7LCR3	Escherichia_phage	45.4	3.8e-23
AYU42027.1|1569652_1570270_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYU42028.1|1570763_1571156_-	hypothetical protein	NA	Q9MCR6	Enterobacteria_phage	51.1	6.8e-19
AYU42029.1|1571752_1572325_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYU42030.1|1572605_1573988_+	amino acid permease	NA	NA	NA	NA	NA
AYU42031.1|1574049_1574385_-	hypothetical protein	NA	NA	NA	NA	NA
AYU42032.1|1574511_1575243_+	two-component response regulator	NA	NA	NA	NA	NA
AYU42033.1|1575723_1576875_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYU42034.1|1577027_1578734_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYU42035.1|1578841_1580146_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYU42036.1|1580221_1581151_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYU42037.1|1581147_1582551_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYU42038.1|1582718_1584365_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYU42039.1|1584564_1585740_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYU42040.1|1585842_1587351_+	hypothetical protein	NA	NA	NA	NA	NA
AYU42041.1|1588056_1589058_+	adenosine deaminase	NA	NA	NA	NA	NA
AYU42042.1|1589131_1590247_-	oxidoreductase	NA	NA	NA	NA	NA
AYU42043.1|1590349_1590505_+	hypothetical protein	NA	NA	NA	NA	NA
AYU42044.1|1590803_1591019_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYU42045.1|1591107_1591548_+	hypothetical protein	NA	NA	NA	NA	NA
AYU42046.1|1591624_1592206_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYU42047.1|1592205_1592784_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYU42048.1|1592776_1594798_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYU42049.1|1594798_1595857_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYU42050.1|1595860_1596481_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYU42051.1|1596483_1597176_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYU42052.1|1597175_1597811_+	endonuclease III	NA	NA	NA	NA	NA
AYU42053.1|1598411_1599917_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYU42054.1|1600021_1600627_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYU42055.1|1601375_1602650_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029960	Salmonella enterica subsp. enterica serovar Typhi strain 343078_251131 chromosome, complete genome	4799747	1783687	1788099	4799747		Escherichia_phage(50.0%)	6	NA	NA
AYU42239.1|1783687_1783927_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	87.3	5.5e-32
AYU42240.1|1784799_1785609_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYU42241.1|1785681_1786059_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYU42242.1|1786206_1786749_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYU42243.1|1786940_1787669_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYU42244.1|1787685_1788099_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029960	Salmonella enterica subsp. enterica serovar Typhi strain 343078_251131 chromosome, complete genome	4799747	1991953	1999187	4799747		Morganella_phage(33.33%)	7	NA	NA
AYU42435.1|1991953_1993384_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYU42436.1|1993457_1994153_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYU42437.1|1994232_1994544_-	hypothetical protein	NA	NA	NA	NA	NA
AYU42438.1|1995194_1996379_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYU42439.1|1996838_1997051_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYU42440.1|1997496_1998765_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYU42441.1|1998767_1999187_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029960	Salmonella enterica subsp. enterica serovar Typhi strain 343078_251131 chromosome, complete genome	4799747	2105487	2115994	4799747		Enterobacteria_phage(37.5%)	10	NA	NA
AYU42538.1|2105487_2106801_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYU42539.1|2106827_2107907_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYU42540.1|2107911_2108685_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYU42541.1|2108700_2109675_-	reductase RfbI	NA	NA	NA	NA	NA
AYU42542.1|2109680_2110232_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYU42543.1|2110232_2111111_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYU42544.1|2111158_2112058_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYU42545.1|2112057_2113143_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYU42546.1|2113519_2114413_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYU42547.1|2114590_2115994_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029960	Salmonella enterica subsp. enterica serovar Typhi strain 343078_251131 chromosome, complete genome	4799747	2191885	2201056	4799747	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYU42606.1|2191885_2193919_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYU42607.1|2194159_2194618_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYU42608.1|2194789_2195320_+	lipoprotein	NA	NA	NA	NA	NA
AYU42609.1|2195376_2195844_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	89.7	3.3e-73
AYU42610.1|2195890_2196610_-	two-component system response regulator	NA	NA	NA	NA	NA
AYU42611.1|2196606_2198292_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYU42612.1|2198514_2199246_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYU42613.1|2199305_2199413_+	hypothetical protein	NA	NA	NA	NA	NA
AYU42614.1|2199393_2200125_-	ABC transporter permease	NA	NA	NA	NA	NA
AYU42615.1|2200108_2201056_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029960	Salmonella enterica subsp. enterica serovar Typhi strain 343078_251131 chromosome, complete genome	4799747	2736501	2749893	4799747	tail	Salmonella_phage(70.0%)	11	NA	NA
AYU43044.1|2736501_2736720_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYU43045.1|2736810_2737911_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYU43046.1|2737907_2738393_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYU43047.1|2738389_2741467_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYU43048.1|2741459_2741579_-	hypothetical protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYU43049.1|2741593_2741896_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYU43050.1|2741950_2742466_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYU43051.1|2742475_2743648_-|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYU43052.1|2743790_2744363_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYU43053.1|2745040_2746156_+	glycosyltransferase	NA	NA	NA	NA	NA
AYU43054.1|2746236_2749893_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029960	Salmonella enterica subsp. enterica serovar Typhi strain 343078_251131 chromosome, complete genome	4799747	3066965	3110668	4799747	protease,tRNA,transposase,bacteriocin	Bacillus_virus(33.33%)	44	NA	NA
AYU43343.1|3066965_3067424_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU43344.1|3067613_3068693_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYU43345.1|3068794_3069958_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYU43346.1|3069979_3071026_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYU43347.1|3071399_3071825_+	hypothetical protein	NA	NA	NA	NA	NA
AYU43348.1|3071850_3072429_+	hypothetical protein	NA	NA	NA	NA	NA
AYU43349.1|3072462_3073137_+	hypothetical protein	NA	NA	NA	NA	NA
AYU43350.1|3073118_3073802_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYU43351.1|3073795_3074452_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYU43352.1|3074556_3075015_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU43353.1|3075203_3077195_-	transketolase	NA	NA	NA	NA	NA
AYU43354.1|3077470_3078229_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYU43355.1|3078329_3079250_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYU43356.1|3079477_3081454_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYU43357.1|3081462_3081594_-	hypothetical protein	NA	NA	NA	NA	NA
AYU43358.1|3081888_3082188_-	membrane protein	NA	NA	NA	NA	NA
AYU43359.1|3082243_3083398_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYU43360.1|3083890_3085285_+	galactose-proton symport	NA	NA	NA	NA	NA
AYU43361.1|3085363_3085861_+	hypothetical protein	NA	NA	NA	NA	NA
AYU43362.1|3085956_3086664_+	endonuclease I	NA	NA	NA	NA	NA
AYU43363.1|3086740_3087472_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYU43364.1|3087491_3088439_+	glutathione synthetase	NA	NA	NA	NA	NA
AYU43365.1|3088654_3089218_+	hypothetical protein	NA	NA	NA	NA	NA
AYU43366.1|3089217_3089634_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYU43367.1|3089680_3090367_-	global regulatory protein	NA	NA	NA	NA	NA
AYU43368.1|3090496_3091477_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYU43369.1|3091494_3092199_+	hypothetical protein	NA	NA	NA	NA	NA
AYU43370.1|3092217_3092784_+	hypothetical protein	NA	NA	NA	NA	NA
AYU43371.1|3092780_3093071_+	hypothetical protein	NA	NA	NA	NA	NA
AYU43372.1|3093078_3093672_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYU43373.1|3093664_3094801_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYU43374.1|3094891_3095899_-	hypothetical protein	NA	NA	NA	NA	NA
AYU43375.1|3096031_3097078_-	L-asparaginase	NA	NA	NA	NA	NA
AYU43376.1|3097396_3097855_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYU43377.1|3097977_3098697_-	hypothetical protein	NA	NA	NA	NA	NA
AYU43378.1|3098746_3099073_-	hypothetical protein	NA	NA	NA	NA	NA
AYU43379.1|3099072_3099792_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYU43380.1|3099946_3100999_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYU43381.1|3101026_3101302_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYU43382.1|3101414_3102500_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYU43383.1|3102716_3103973_+	nucleoside permease	NA	NA	NA	NA	NA
AYU43384.1|3106583_3107291_+	hypothetical protein	NA	NA	NA	NA	NA
AYU43385.1|3109880_3110147_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYU43386.1|3110389_3110668_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029960	Salmonella enterica subsp. enterica serovar Typhi strain 343078_251131 chromosome, complete genome	4799747	3488602	3526660	4799747	integrase,terminase,tail,portal,transposase,capsid,plate	Salmonella_phage(82.05%)	46	3483566:3483580	3495732:3495746
3483566:3483580	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYU43715.1|3488602_3490249_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYU43716.1|3490388_3490487_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYU43717.1|3490742_3491072_+	hypothetical protein	NA	NA	NA	NA	NA
AYU43718.1|3491112_3492165_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYU43719.1|3492560_3493130_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYU43720.1|3493255_3493477_+	hypothetical protein	NA	NA	NA	NA	NA
AYU43721.1|3493509_3494019_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYU43722.1|3494193_3494418_+	hypothetical protein	NA	NA	NA	NA	NA
AYU43723.1|3494440_3494782_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYU43724.1|3494849_3495083_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYU43725.1|3495082_3495310_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYU43726.1|3495306_3496164_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3495732:3495746	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYU43727.1|3496160_3498575_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYU43728.1|3498728_3498917_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYU43729.1|3500884_3501799_+	hypothetical protein	NA	NA	NA	NA	NA
AYU43730.1|3501795_3502536_+	hypothetical protein	NA	NA	NA	NA	NA
AYU43731.1|3502570_3503608_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYU43732.1|3503607_3505374_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYU43733.1|3505516_3506350_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYU43734.1|3506366_3507425_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYU43735.1|3507428_3508079_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYU43736.1|3508111_3508639_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYU43737.1|3508638_3508842_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYU43738.1|3508845_3509061_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYU43739.1|3509080_3509554_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYU43740.1|3509555_3509933_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYU43741.1|3509929_3510358_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYU43742.1|3510453_3510885_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYU43743.1|3510877_3511324_+|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYU43744.1|3511392_3511971_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYU43745.1|3511967_3512327_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYU43746.1|3512313_3513222_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYU43747.1|3513214_3513820_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYU43748.1|3513816_3515331_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYU43749.1|3515330_3515924_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYU43750.1|3515895_3516336_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYU43751.1|3516758_3517331_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYU43752.1|3517473_3518646_+|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYU43753.1|3518655_3519171_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYU43754.1|3519225_3519528_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYU43755.1|3519542_3519662_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYU43756.1|3519654_3522732_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
AYU43757.1|3522728_3523214_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYU43758.1|3523210_3524311_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYU43759.1|3524401_3524620_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYU43760.1|3526201_3526660_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029960	Salmonella enterica subsp. enterica serovar Typhi strain 343078_251131 chromosome, complete genome	4799747	4459775	4533939	4799747	integrase,terminase,tail,portal,capsid,plate	Salmonella_phage(82.98%)	76	4521276:4521292	4534098:4534114
AYU44551.1|4459775_4461725_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYU44552.1|4461796_4462705_+	hypothetical protein	NA	NA	NA	NA	NA
AYU44553.1|4462778_4463678_+	hypothetical protein	NA	NA	NA	NA	NA
AYU44554.1|4463719_4464079_+	hypothetical protein	NA	NA	NA	NA	NA
AYU44555.1|4464178_4464448_-	hypothetical protein	NA	NA	NA	NA	NA
AYU44556.1|4464579_4465854_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYU44557.1|4466073_4466451_+	hypothetical protein	NA	NA	NA	NA	NA
AYU44558.1|4466537_4466756_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYU44559.1|4466823_4467924_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYU44560.1|4467920_4468406_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYU44561.1|4468405_4471186_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYU44562.1|4471178_4471298_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYU44563.1|4471312_4471615_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYU44564.1|4471669_4472185_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYU44565.1|4472194_4473367_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYU44566.1|4473901_4474624_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYU44567.1|4474821_4475229_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYU44568.1|4475235_4476855_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYU44569.1|4476851_4477457_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYU44570.1|4477449_4478358_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYU44571.1|4478344_4478704_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYU44572.1|4478700_4479279_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYU44573.1|4479347_4479794_-|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYU44574.1|4479786_4480218_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	2.5e-75
AYU44575.1|4480313_4480739_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYU44576.1|4480738_4481116_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYU44577.1|4481120_4481591_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYU44578.1|4481610_4481826_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYU44579.1|4481829_4482033_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYU44580.1|4482032_4482497_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYU44581.1|4482590_4483241_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYU44582.1|4483244_4484309_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYU44583.1|4484325_4485159_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYU44584.1|4485301_4487068_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYU44585.1|4487064_4488111_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYU44586.1|4488159_4488855_-	hypothetical protein	NA	NA	NA	NA	NA
AYU44587.1|4488874_4489939_-	hypothetical protein	NA	NA	NA	NA	NA
AYU44588.1|4489935_4491000_-	hypothetical protein	NA	NA	NA	NA	NA
AYU44589.1|4491924_4492254_-	hypothetical protein	NA	A0A1S6L028	Salmonella_phage	90.8	6.2e-50
AYU44590.1|4492250_4494320_-	bacteriophage replication protein A	NA	A0A1S6L028	Salmonella_phage	95.9	0.0e+00
AYU44591.1|4494310_4495171_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYU44592.1|4495167_4495752_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYU44593.1|4495748_4495976_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYU44594.1|4495975_4496209_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYU44595.1|4496276_4496618_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYU44596.1|4496581_4496782_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYU44597.1|4496789_4497299_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYU44598.1|4497331_4497574_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYU44599.1|4497690_4498323_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYU44600.1|4498326_4499352_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYU44601.1|4499458_4499812_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYU44602.1|4500428_4500716_+	hypothetical protein	NA	NA	NA	NA	NA
AYU44603.1|4500726_4501617_+	methyltransferase	NA	NA	NA	NA	NA
AYU44604.1|4501616_4502363_+	hypothetical protein	NA	NA	NA	NA	NA
AYU44605.1|4502664_4504635_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYU44606.1|4504654_4505959_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYU44607.1|4505981_4506677_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYU44608.1|4506702_4507497_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYU44609.1|4507506_4508574_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYU44610.1|4508618_4510355_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYU44611.1|4510354_4512850_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYU44612.1|4512873_4513920_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYU44613.1|4513922_4515200_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYU44614.1|4515444_4515984_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYU44615.1|4516837_4518349_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYU44616.1|4518332_4519922_+	hypothetical protein	NA	NA	NA	NA	NA
AYU44617.1|4520085_4521099_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4521276:4521292	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYU44618.1|4521525_4521819_+	hypothetical protein	NA	NA	NA	NA	NA
AYU44619.1|4521815_4522304_+	hypothetical protein	NA	NA	NA	NA	NA
AYU44620.1|4522483_4522936_-	hypothetical protein	NA	NA	NA	NA	NA
AYU44621.1|4528158_4528620_+	hypothetical protein	NA	NA	NA	NA	NA
AYU44622.1|4528616_4528838_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYU44623.1|4529694_4530477_+	hypothetical protein	NA	NA	NA	NA	NA
AYU44624.1|4531103_4531328_-	hypothetical protein	NA	NA	NA	NA	NA
AYU44625.1|4531457_4532369_-	hypothetical protein	NA	NA	NA	NA	NA
AYU44626.1|4532679_4533939_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4534098:4534114	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 12
CP029960	Salmonella enterica subsp. enterica serovar Typhi strain 343078_251131 chromosome, complete genome	4799747	4675915	4686174	4799747	capsid	Enterobacteria_phage(77.78%)	13	NA	NA
AYU44763.1|4675915_4676992_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYU44764.1|4676988_4678062_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYU44765.1|4678036_4679200_-	hypothetical protein	NA	NA	NA	NA	NA
AYU44766.1|4679475_4680042_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYU44767.1|4680057_4680297_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYU44768.1|4680300_4681161_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYU44769.1|4681583_4681907_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYU44770.1|4681890_4682391_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
AYU44771.1|4682387_4682615_+	hypothetical protein	NA	NA	NA	NA	NA
AYU44772.1|4682611_4682932_+	P4 phage protein	NA	NA	NA	NA	NA
AYU44773.1|4682946_4683621_+	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	75.1	1.4e-85
AYU44774.1|4683617_4685279_+	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	90.2	1.9e-296
AYU44775.1|4686015_4686174_+	recombinase	NA	Q7M297	Enterobacteria_phage	57.4	3.9e-10
>prophage 1
CP029961	Salmonella enterica subsp. enterica serovar Typhi strain 343078_251131 plasmid pHCM2, complete sequence	106705	1583	15990	106705		Salmonella_phage(89.47%)	19	NA	NA
AYU44867.1|1583_2096_+	hypothetical protein	NA	A0A249Y265	Salmonella_phage	53.9	3.0e-43
AYU44868.1|2210_2534_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	97.2	2.7e-50
AYU44869.1|2520_3240_+	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	95.7	1.5e-125
AYU44870.1|3308_3653_+	hypothetical protein	NA	J9Q7G2	Salmonella_phage	83.6	5.9e-27
AYU44871.1|3703_4255_-	hypothetical protein	NA	A0A2H4J5U3	uncultured_Caudovirales_phage	39.8	7.8e-29
AYU44872.1|4585_5251_+	hypothetical protein	NA	J9Q7R7	Salmonella_phage	95.0	8.0e-113
AYU44873.1|5250_5610_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	2.3e-45
AYU44874.1|5658_6414_+	hypothetical protein	NA	J9Q7Y9	Salmonella_phage	43.0	3.2e-57
AYU44875.1|6483_7539_-	hypothetical protein	NA	A0A2I7RNF6	Vibrio_phage	42.6	5.1e-61
AYU44876.1|7816_8542_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	98.3	2.4e-139
AYU44877.1|8602_9943_+	putative DNA helicase	NA	J9Q7G4	Salmonella_phage	99.6	3.8e-247
AYU44878.1|10005_11217_+	hypothetical protein	NA	J9Q720	Salmonella_phage	96.5	6.6e-214
AYU44879.1|11218_12271_-	hypothetical protein	NA	J9Q6F5	Salmonella_phage	56.7	1.9e-92
AYU44880.1|12454_13249_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.2	4.9e-141
AYU44881.1|13549_13807_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	92.9	4.9e-34
AYU44882.1|13841_15164_+	DNA ligase	NA	J9Q7G5	Salmonella_phage	98.4	5.8e-256
AYU44883.1|15329_15536_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.5	8.1e-32
AYU44884.1|15535_15688_+	hypothetical protein	NA	J9Q7Z1	Salmonella_phage	96.0	7.6e-19
AYU44885.1|15684_15990_+	hypothetical protein	NA	J9Q7S1	Salmonella_phage	98.0	9.2e-48
>prophage 2
CP029961	Salmonella enterica subsp. enterica serovar Typhi strain 343078_251131 plasmid pHCM2, complete sequence	106705	24480	106166	106705	tail	Salmonella_phage(97.8%)	94	NA	NA
AYU44898.1|24480_26838_+	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	90.7	0.0e+00
AYU44899.1|26934_28170_+	porphyrin biosynthesis protein	NA	J9Q733	Salmonella_phage	99.5	1.8e-238
AYU44900.1|28350_31869_+	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.1	0.0e+00
AYU44901.1|31865_32309_+	hypothetical protein	NA	J9Q7S4	Salmonella_phage	97.9	3.0e-71
AYU44902.1|32402_32993_-	hypothetical protein	NA	NA	NA	NA	NA
AYU44903.1|33238_33670_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	100.0	4.0e-73
AYU44904.1|33789_34818_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.8	1.1e-164
AYU44905.1|34878_35823_+	exonuclease	NA	J9Q7S6	Salmonella_phage	99.4	6.8e-182
AYU44906.1|35822_36089_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
AYU44907.1|36091_37168_+	putative recombinase	NA	J9Q736	Salmonella_phage	99.7	5.5e-204
AYU44908.1|37463_38306_+	putative lipoprotein	NA	J9Q7Z4	Salmonella_phage	97.1	2.3e-125
AYU44909.1|38468_38840_+	hypothetical protein	NA	J9Q7S7	Salmonella_phage	98.4	3.0e-69
AYU44910.1|38823_39234_+	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.1	1.4e-75
AYU44911.1|39302_39578_+	hypothetical protein	NA	J9Q738	Salmonella_phage	96.7	5.9e-46
AYU44912.1|39618_39924_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	90.8	4.9e-33
AYU44913.1|39923_40127_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	4.0e-31
AYU44914.1|40655_41711_-	putative replication protein A	NA	J9Q7H0	Salmonella_phage	98.0	1.5e-185
AYU44915.1|42455_43100_+	hypothetical protein	NA	J9Q739	Salmonella_phage	98.1	2.4e-122
AYU44916.1|43174_43669_+	hypothetical protein	NA	J9Q6J3	Salmonella_phage	97.6	2.3e-88
AYU44917.1|43700_44006_-	hypothetical protein	NA	J9Q7Z6	Salmonella_phage	97.0	2.0e-50
AYU44918.1|44432_45518_+	exonuclease	NA	J9Q7S9	Salmonella_phage	98.9	2.7e-206
AYU44919.1|45514_45751_+	hypothetical protein	NA	J9Q7H1	Salmonella_phage	98.4	1.1e-29
AYU44920.1|45747_47664_+	exonuclease	NA	J9Q741	Salmonella_phage	98.6	0.0e+00
AYU44921.1|47653_48400_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	98.0	4.4e-136
AYU44922.1|48412_48982_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	99.5	1.7e-103
AYU44923.1|49059_51375_+	ribonucleotide-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	99.7	0.0e+00
AYU44924.1|51482_52625_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	99.5	2.4e-218
AYU44925.1|52707_53637_+	hypothetical protein	NA	J9Q742	Salmonella_phage	99.0	3.8e-161
AYU44926.1|53752_54868_+	putative thymidylate synthase	NA	J9Q6J6	Salmonella_phage	98.1	7.6e-217
AYU44927.1|54869_55283_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	97.8	4.7e-71
AYU44928.1|55279_55756_+	hypothetical protein	NA	J9Q7T1	Salmonella_phage	100.0	1.4e-90
AYU44929.1|55755_56400_+	hypothetical protein	NA	J9Q7H4	Salmonella_phage	100.0	5.2e-117
AYU44930.1|56463_56883_+	hypothetical protein	NA	J9Q743	Salmonella_phage	98.6	2.9e-68
AYU44931.1|56892_57450_+	hypothetical protein	NA	J9Q6J8	Salmonella_phage	99.5	7.0e-102
AYU44932.1|57494_58421_+	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	85.4	4.1e-107
AYU44933.1|58606_59200_+	hypothetical protein	NA	J9Q7T2	Salmonella_phage	99.5	4.6e-112
AYU44934.1|59402_59633_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	100.0	2.1e-36
AYU44935.1|60218_60827_+	putative ribonuclease H	NA	J9Q745	Salmonella_phage	99.5	2.2e-117
AYU44936.1|60969_61464_+	hypothetical protein	NA	J9Q6J9	Salmonella_phage	96.3	1.9e-79
AYU44937.1|61473_61662_+	hypothetical protein	NA	J9Q800	Salmonella_phage	100.0	1.2e-26
AYU44938.1|61770_62613_+	hypothetical protein	NA	J9Q7T3	Salmonella_phage	71.1	2.1e-70
AYU44939.1|62721_63294_+	hypothetical protein	NA	J9Q7H6	Salmonella_phage	98.9	8.2e-98
AYU44940.1|63417_65121_+	putative DNA modification methylase	NA	J9Q747	Salmonella_phage	98.9	0.0e+00
AYU44941.1|65179_65869_+	hypothetical protein	NA	J9Q6K2	Salmonella_phage	98.3	6.1e-124
AYU44942.1|65865_66039_+	hypothetical protein	NA	J9Q801	Salmonella_phage	98.2	9.5e-26
AYU44943.1|66149_66521_+	hypothetical protein	NA	J9Q7T4	Salmonella_phage	100.0	3.2e-63
AYU44944.1|66612_67254_+	hypothetical protein	NA	J9Q7H7	Salmonella_phage	100.0	9.7e-116
AYU44945.1|67250_67793_+	hypothetical protein	NA	J9Q748	Salmonella_phage	93.1	2.6e-93
AYU44946.1|67804_68113_+	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	56.9	3.0e-14
AYU44947.1|68109_68397_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	58.8	9.9e-28
AYU44948.1|68457_68661_-	hypothetical protein	NA	J9Q802	Salmonella_phage	95.5	1.5e-30
AYU44949.1|68834_69116_+	hypothetical protein	NA	J9Q7T5	Salmonella_phage	71.6	3.2e-31
AYU44950.1|69200_69518_+	hypothetical protein	NA	J9Q750	Salmonella_phage	80.0	8.1e-47
AYU44951.1|69527_70718_+	hypothetical protein	NA	J9Q803	Salmonella_phage	54.6	5.4e-120
AYU44952.1|72154_72400_-	hypothetical protein	NA	J9Q751	Salmonella_phage	92.5	5.8e-37
AYU44953.1|72542_72758_+	hypothetical protein	NA	J9Q6K7	Salmonella_phage	95.8	4.5e-33
AYU44954.1|72768_72987_+	hypothetical protein	NA	J9Q804	Salmonella_phage	98.6	6.4e-35
AYU44955.1|73081_73396_+	hypothetical protein	NA	NA	NA	NA	NA
AYU44956.1|73472_73784_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	92.2	1.1e-45
AYU44957.1|73912_74305_+	hypothetical protein	NA	J9Q7I1	Salmonella_phage	65.4	1.7e-41
AYU44958.1|74425_74713_+	hypothetical protein	NA	J9Q753	Salmonella_phage	94.6	1.5e-47
AYU44959.1|74918_75401_+	hypothetical protein	NA	J9Q805	Salmonella_phage	96.9	5.5e-87
AYU44960.1|76032_76260_-	hypothetical protein	NA	NA	NA	NA	NA
AYU44961.1|76344_76995_-	hypothetical protein	NA	J9Q754	Salmonella_phage	100.0	1.4e-114
AYU44962.1|77629_78157_-	putative transcriptional regulator	NA	J9Q6L0	Salmonella_phage	96.6	4.1e-80
AYU44963.1|78161_78584_-	putative lipoprotein	NA	J9Q806	Salmonella_phage	85.7	8.2e-63
AYU44964.1|78643_78922_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	98.9	3.4e-41
AYU44965.1|78924_80484_-	putative helicase	NA	J9Q7I4	Salmonella_phage	99.4	5.7e-295
AYU44966.1|80566_81247_+	hypothetical protein	NA	J9Q756	Salmonella_phage	99.6	7.4e-122
AYU44967.1|81246_81915_+	hypothetical protein	NA	J9Q6L1	Salmonella_phage	99.5	1.1e-114
AYU44968.1|81911_82550_+	putative ABC transporter ATP-binding protein	NA	J9Q807	Salmonella_phage	99.1	5.5e-111
AYU44969.1|82542_82797_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	98.8	4.1e-41
AYU44970.1|82793_83693_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.3	4.0e-168
AYU44971.1|83702_83969_+	hypothetical protein	NA	J9Q757	Salmonella_phage	100.0	1.3e-42
AYU44972.1|84164_84806_+	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	99.5	1.8e-109
AYU44973.1|84808_86065_+	hypothetical protein	NA	J9Q7Y2	Salmonella_phage	99.8	5.3e-251
AYU44974.1|86098_87673_+	hypothetical protein	NA	J9Q7R1	Salmonella_phage	99.0	3.2e-301
AYU44975.1|87695_88592_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	96.6	5.7e-146
AYU44976.1|88618_89494_+	hypothetical protein	NA	J9Q710	Salmonella_phage	100.0	3.8e-163
AYU44977.1|89568_90492_+	hypothetical protein	NA	J9Q6D6	Salmonella_phage	100.0	3.3e-157
AYU44978.1|90535_90970_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	100.0	2.1e-74
AYU44979.1|90969_91803_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	100.0	2.6e-153
AYU44980.1|91900_92245_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	100.0	1.9e-57
AYU44981.1|92235_92709_+	hypothetical protein	NA	J9Q711	Salmonella_phage	100.0	2.3e-82
AYU44982.1|92710_93094_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	100.0	1.7e-67
AYU44983.1|93168_93915_+	hypothetical protein	NA	J9Q7Y4	Salmonella_phage	96.8	7.8e-125
AYU44984.1|93974_94292_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
AYU44985.1|94372_94642_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	8.4e-37
AYU44986.1|94649_99233_+	hypothetical protein	NA	J9Q712	Salmonella_phage	92.9	0.0e+00
AYU44987.1|99274_99610_+	hypothetical protein	NA	J9Q6E1	Salmonella_phage	97.3	5.7e-59
AYU44988.1|99666_100398_+|tail	putative phage tail protein	tail	J9Q7Y5	Salmonella_phage	99.1	3.3e-136
AYU44989.1|100390_101188_+	hypothetical protein	NA	J9Q7R4	Salmonella_phage	95.8	1.2e-155
AYU44990.1|101175_101763_+|tail	putative phage tail protein	tail	J9Q7F8	Salmonella_phage	92.3	1.1e-102
AYU44991.1|101777_106166_+|tail	putative phage tail protein	tail	J9Q713	Salmonella_phage	86.7	0.0e+00
