The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029909	Salmonella enterica subsp. enterica serovar Typhi strain 311189_222186 chromosome, complete genome	4842715	930441	937753	4842715	protease,integrase	Dickeya_phage(16.67%)	6	931692:931706	942871:942885
AYS37866.1|930441_931560_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYS37867.1|931556_933503_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931692:931706	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYS37868.1|933632_933854_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYS37869.1|934177_934498_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYS37870.1|934528_936805_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYS37871.1|937375_937753_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942871:942885	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029909	Salmonella enterica subsp. enterica serovar Typhi strain 311189_222186 chromosome, complete genome	4842715	1008683	1085996	4842715	transposase,tail,protease,terminase,integrase	Salmonella_phage(73.33%)	93	990762:990781	1061357:1061376
990762:990781	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS37921.1|1008683_1010024_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYS37922.1|1010020_1010269_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYS37923.1|1010309_1010555_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYS37924.1|1010554_1011436_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYS37925.1|1011432_1012497_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYS37926.1|1012574_1013255_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYS37927.1|1013251_1014037_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYS37928.1|1014042_1014339_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYS37929.1|1014429_1014630_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYS37930.1|1014918_1015323_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYS37931.1|1015654_1016029_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYS37932.1|1016113_1017097_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYS37933.1|1017099_1017849_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
AYS37934.1|1017859_1018207_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	89.6	9.1e-52
AYS37935.1|1018203_1018728_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYS37936.1|1018727_1019201_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYS37937.1|1019204_1019777_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYS37938.1|1019870_1020137_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYS37939.1|1020218_1020380_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS37940.1|1020812_1021310_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS37941.1|1021494_1021734_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYS37942.1|1021723_1022029_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYS37943.1|1022068_1022671_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYS37944.1|1022879_1023491_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYS37945.1|1023623_1024421_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYS37946.1|1024819_1024945_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS37947.1|1025080_1025530_-	lipoprotein	NA	NA	NA	NA	NA
AYS37948.1|1025746_1026136_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYS37949.1|1026122_1026404_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYS37950.1|1026403_1027018_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYS37951.1|1027237_1027492_+	hypothetical protein	NA	NA	NA	NA	NA
AYS37952.1|1027596_1027974_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYS37953.1|1028037_1028298_+	hypothetical protein	NA	NA	NA	NA	NA
AYS37954.1|1028387_1029140_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYS37955.1|1029105_1030509_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYS37956.1|1030508_1031978_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYS37957.1|1032069_1032600_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYS37958.1|1032614_1033847_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYS37959.1|1033851_1034349_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYS37960.1|1034360_1035302_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYS37961.1|1035343_1035712_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYS37962.1|1035677_1036085_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYS37963.1|1036081_1036636_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYS37964.1|1036622_1037012_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYS37965.1|1036986_1037550_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYS37966.1|1037553_1038699_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYS37967.1|1038710_1039151_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYS37968.1|1039154_1039607_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYS37969.1|1039784_1041737_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYS37970.1|1041736_1042387_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYS37971.1|1042390_1042693_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYS37972.1|1042695_1043727_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYS37973.1|1043723_1044059_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYS37974.1|1044253_1044985_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS37975.1|1044984_1045413_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS37976.1|1045471_1046227_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYS37977.1|1046314_1046452_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYS37978.1|1046467_1046821_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYS37979.1|1046821_1048021_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYS37980.1|1048017_1048698_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYS37981.1|1048697_1050209_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYS37982.1|1050223_1050742_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYS37983.1|1051663_1052365_-	hypothetical protein	NA	NA	NA	NA	NA
AYS37984.1|1052677_1052956_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYS37985.1|1053381_1055994_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYS37986.1|1056201_1057212_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYS37987.1|1057374_1057920_+	hypothetical protein	NA	NA	NA	NA	NA
AYS37988.1|1057916_1059026_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYS37989.1|1059124_1061233_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYS37990.1|1061245_1063153_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1061357:1061376	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS37991.1|1063167_1064421_+	inner membrane protein	NA	NA	NA	NA	NA
AYS37992.1|1064425_1066066_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYS37993.1|1066062_1066626_+	lipoprotein	NA	NA	NA	NA	NA
AYS37994.1|1066879_1067047_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYS37995.1|1067146_1067665_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYS37996.1|1067733_1069494_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYS37997.1|1069679_1070132_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYS37998.1|1070203_1071256_-	outer membrane protein A	NA	NA	NA	NA	NA
AYS37999.1|1071610_1072120_-	cell division inhibitor	NA	NA	NA	NA	NA
AYS38000.1|1072336_1072942_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYS38001.1|1072928_1075082_-	inner membrane protein	NA	NA	NA	NA	NA
AYS38002.1|1075100_1075547_-	hypothetical protein	NA	NA	NA	NA	NA
AYS38003.1|1075670_1077725_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYS38004.1|1077760_1078219_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYS38005.1|1078313_1078976_-	hypothetical protein	NA	NA	NA	NA	NA
AYS38006.1|1079146_1079563_+	hypothetical protein	NA	NA	NA	NA	NA
AYS38007.1|1079607_1079925_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYS38008.1|1079982_1081194_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYS38009.1|1082325_1082784_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS38010.1|1083520_1083802_+	acylphosphatase	NA	NA	NA	NA	NA
AYS38011.1|1083798_1084128_-	sulfite reductase	NA	NA	NA	NA	NA
AYS38012.1|1084214_1084874_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYS38013.1|1085537_1085996_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029909	Salmonella enterica subsp. enterica serovar Typhi strain 311189_222186 chromosome, complete genome	4842715	1530550	1571739	4842715	transposase,tail,protease,plate,head	Burkholderia_virus(50.0%)	52	NA	NA
AYS38417.1|1530550_1531009_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS38418.1|1531511_1531793_+	stress response protein	NA	NA	NA	NA	NA
AYS38419.1|1532061_1532883_+|protease	serine protease	protease	NA	NA	NA	NA
AYS38420.1|1532917_1533247_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYS38421.1|1533233_1533596_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYS38422.1|1533707_1533878_-	hypothetical protein	NA	NA	NA	NA	NA
AYS38423.1|1534012_1535047_+	hypothetical protein	NA	NA	NA	NA	NA
AYS38424.1|1535221_1536610_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYS38425.1|1536620_1538150_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYS38426.1|1538676_1539621_+	hypothetical protein	NA	NA	NA	NA	NA
AYS38427.1|1539802_1540192_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYS38428.1|1540163_1540616_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYS38429.1|1540810_1541041_-	hypothetical protein	NA	NA	NA	NA	NA
AYS38430.1|1541037_1541721_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYS38431.1|1541717_1541933_-	hypothetical protein	NA	NA	NA	NA	NA
AYS38432.1|1541925_1542309_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
AYS38433.1|1542305_1542608_-	hypothetical protein	NA	NA	NA	NA	NA
AYS38434.1|1542617_1542890_-	hypothetical protein	NA	NA	NA	NA	NA
AYS38435.1|1543178_1543709_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYS38436.1|1543736_1544006_-	hypothetical protein	NA	NA	NA	NA	NA
AYS38437.1|1544008_1545175_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYS38438.1|1545185_1546955_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYS38439.1|1547132_1547564_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
AYS38440.1|1547559_1548156_+	hypothetical protein	NA	NA	NA	NA	NA
AYS38441.1|1548399_1548750_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYS38442.1|1549464_1550115_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYS38443.1|1550111_1550438_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AYS38444.1|1550437_1550749_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYS38445.1|1550748_1551294_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYS38446.1|1551290_1552886_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYS38447.1|1552885_1554382_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYS38448.1|1554362_1555184_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYS38449.1|1555186_1555645_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYS38450.1|1555859_1556975_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYS38451.1|1556989_1557943_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYS38452.1|1557952_1558291_+	hypothetical protein	NA	NA	NA	NA	NA
AYS38453.1|1558292_1558739_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYS38454.1|1558738_1559203_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYS38455.1|1559199_1559454_+	hypothetical protein	NA	NA	NA	NA	NA
AYS38456.1|1559443_1560871_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYS38457.1|1560870_1561392_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYS38458.1|1561394_1561676_+	hypothetical protein	NA	NA	NA	NA	NA
AYS38459.1|1561773_1562109_+	hypothetical protein	NA	NA	NA	NA	NA
AYS38460.1|1562284_1564750_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYS38461.1|1564749_1565634_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYS38462.1|1565630_1565846_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYS38463.1|1565833_1566988_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYS38464.1|1566984_1567512_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYS38465.1|1567568_1567916_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYS38466.1|1567906_1569010_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYS38467.1|1569002_1569581_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYS38468.1|1571121_1571739_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
>prophage 4
CP029909	Salmonella enterica subsp. enterica serovar Typhi strain 311189_222186 chromosome, complete genome	4842715	1691653	1755518	4842715	transposase,tail,capsid,tRNA,terminase,portal,plate	Enterobacteria_phage(75.0%)	74	NA	NA
AYS38582.1|1691653_1692403_-	vitamin B12 ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	4.6e-08
AYS38583.1|1692402_1692954_-	glutathione peroxidase	NA	NA	NA	NA	NA
AYS38584.1|1693045_1694026_-	vitamin B12 ABC transporter permease	NA	NA	NA	NA	NA
AYS38585.1|1694233_1694563_-	hypothetical protein	NA	NA	NA	NA	NA
AYS38586.1|1694670_1695033_-	hypothetical protein	NA	NA	NA	NA	NA
AYS38587.1|1695035_1696163_-	Integrase	NA	A0A0M4RTQ0	Salmonella_phage	51.4	7.0e-85
AYS38588.1|1696465_1696744_+	DNA-binding protein	NA	NA	NA	NA	NA
AYS38589.1|1696758_1697097_+	hypothetical protein	NA	A0A0A7NV42	Enterobacteria_phage	82.8	1.1e-46
AYS38590.1|1697107_1697386_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	77.2	4.5e-33
AYS38591.1|1697397_1697640_+	hypothetical protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
AYS38592.1|1697636_1697750_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	94.6	3.6e-10
AYS38593.1|1697837_1698041_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	82.1	3.3e-25
AYS38594.1|1698037_1698256_+	hypothetical protein	NA	NA	NA	NA	NA
AYS38595.1|1698364_1698754_+	hypothetical protein	NA	NA	NA	NA	NA
AYS38596.1|1698750_1701591_+	Phage replication protein	NA	A0A0A7NQ77	Enterobacteria_phage	88.6	0.0e+00
AYS38597.1|1701667_1702627_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	1.3e-177
AYS38598.1|1702631_1702946_+	Plasmid stability protein	NA	A0A0A7NPT5	Enterobacteria_phage	51.4	9.2e-19
AYS38599.1|1703029_1703872_-	hypothetical protein	NA	NA	NA	NA	NA
AYS38600.1|1703911_1704409_-	hypothetical protein	NA	NA	NA	NA	NA
AYS38601.1|1705057_1706104_-|portal	Presumed portal vertex protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
AYS38602.1|1706103_1707855_-|terminase	Phage terminase ATPase subunit	terminase	A0A0A7NV54	Enterobacteria_phage	98.3	0.0e+00
AYS38603.1|1708009_1708846_+|capsid	Phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	80.2	7.2e-119
AYS38604.1|1708869_1709922_+|capsid	Phage major capsid protein	capsid	A0A0A7NQ82	Enterobacteria_phage	99.7	1.5e-198
AYS38605.1|1709967_1710768_+|terminase	Phage terminase endonuclease subunit	terminase	A0A0A7NPX9	Enterobacteria_phage	98.1	7.8e-139
AYS38606.1|1710869_1711364_+	Head completion/stabilization protein	NA	A0A0A7NPU2	Enterobacteria_phage	98.8	3.0e-88
AYS38607.1|1711363_1711564_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
AYS38608.1|1711566_1711890_+	hypothetical protein	NA	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
AYS38609.1|1711886_1712279_+	peptidase M15	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
AYS38610.1|1712275_1712683_+	hypothetical protein	NA	A0A0A7NPY2	Enterobacteria_phage	97.0	6.5e-65
AYS38611.1|1712820_1713288_+|tail	tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
AYS38612.1|1713271_1713916_+|tail	Phage tail completion protein	tail	A0A0A7NV60	Enterobacteria_phage	99.5	3.1e-114
AYS38613.1|1713912_1714494_+|plate	Baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	99.0	8.6e-103
AYS38614.1|1714490_1714841_+|plate	Phage baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
AYS38615.1|1714844_1715741_+|plate	Baseplate assembly protein J	plate	A0A0A7NPY5	Enterobacteria_phage	99.0	1.2e-156
AYS38616.1|1715733_1716264_+|tail	Phage tail fiber	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	2.1e-92
AYS38617.1|1716266_1718369_+|tail	phage tail protein	tail	Q1MVL8	Enterobacteria_phage	59.6	3.2e-200
AYS38618.1|1718371_1718905_+|tail	Phage tail fiber	tail	C9DGR0	Escherichia_phage	98.9	3.2e-96
AYS38619.1|1718933_1719461_-|tail	Phage tail fiber	tail	A0A0C4UR05	Shigella_phage	94.9	8.9e-91
AYS38620.1|1719462_1720428_-	hypothetical protein	NA	A0A0C4UQV0	Shigella_phage	94.1	8.4e-180
AYS38621.1|1720550_1721138_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	97.9	2.3e-103
AYS38622.1|1721173_1721662_-|tail	tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
AYS38623.1|1721674_1724482_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	98.1	0.0e+00
AYS38624.1|1724632_1725007_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
AYS38625.1|1725062_1725575_-|tail	tail protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
AYS38626.1|1725574_1726759_-|tail	tail protein	tail	A0A0A7NV69	Enterobacteria_phage	98.2	3.4e-223
AYS38627.1|1726916_1728020_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.8	1.1e-194
AYS38628.1|1728184_1728820_-	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
AYS38629.1|1728816_1729929_-	molybdenum cofactor biosynthesis protein A	NA	NA	NA	NA	NA
AYS38630.1|1729921_1731310_-	Chondro-6-sulfatase	NA	S5VT21	Leptospira_phage	27.4	1.3e-48
AYS38631.1|1731309_1731582_-	His-Xaa-Ser system protein HsxD	NA	NA	NA	NA	NA
AYS38632.1|1731834_1732095_+	hypothetical protein	NA	NA	NA	NA	NA
AYS38633.1|1732285_1732426_+	hok/gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
AYS38634.1|1732834_1733134_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
AYS38635.1|1733138_1735526_-|tRNA	phenylalanyl-tRNA synthetase subunit beta	tRNA	NA	NA	NA	NA
AYS38636.1|1735541_1736525_-|tRNA	phenylalanyl-tRNA synthetase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
AYS38637.1|1736826_1737183_-	50S ribosomal subunit protein L20	NA	NA	NA	NA	NA
AYS38638.1|1737233_1737431_-	50S ribosomal subunit protein L35	NA	NA	NA	NA	NA
AYS38639.1|1737526_1738069_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.7	6.3e-15
AYS38640.1|1738072_1740001_-|tRNA	threonyl-tRNA synthetase	tRNA	A0A2K9L297	Tupanvirus	37.6	1.6e-129
AYS38641.1|1740583_1740712_+	hypothetical protein	NA	NA	NA	NA	NA
AYS38642.1|1740892_1742116_+	O-antigen polymerase	NA	NA	NA	NA	NA
AYS38643.1|1743669_1743984_-	hypothetical protein	NA	NA	NA	NA	NA
AYS38644.1|1744126_1745086_+	outer membrane protein	NA	NA	NA	NA	NA
AYS38645.1|1745134_1745893_-	outer membrane protein	NA	NA	NA	NA	NA
AYS38646.1|1746181_1747114_+	6-phosphofructokinase isozyme	NA	NA	NA	NA	NA
AYS38647.1|1747210_1747501_+	hypothetical protein	NA	NA	NA	NA	NA
AYS38648.1|1747607_1748468_+	hypothetical protein	NA	NA	NA	NA	NA
AYS38649.1|1748510_1749047_-	hypothetical protein	NA	NA	NA	NA	NA
AYS38650.1|1749195_1749864_+	hydrolase	NA	NA	NA	NA	NA
AYS38651.1|1750001_1750601_+	hypothetical protein	NA	NA	NA	NA	NA
AYS38652.1|1750737_1752129_+	sodium:dicarboxylate symporter	NA	NA	NA	NA	NA
AYS38653.1|1752231_1752474_-	cell division activator CedA	NA	NA	NA	NA	NA
AYS38654.1|1752690_1754943_+	catalase HPII	NA	A0A2K9L0T1	Tupanvirus	50.0	1.3e-143
AYS38655.1|1755059_1755518_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 5
CP029909	Salmonella enterica subsp. enterica serovar Typhi strain 311189_222186 chromosome, complete genome	4842715	1823791	1828203	4842715		Escherichia_phage(50.0%)	6	NA	NA
AYS38726.1|1823791_1824031_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
AYS38727.1|1824903_1825713_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYS38728.1|1825785_1826163_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYS38729.1|1826310_1826853_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYS38730.1|1827044_1827773_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYS38731.1|1827789_1828203_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 6
CP029909	Salmonella enterica subsp. enterica serovar Typhi strain 311189_222186 chromosome, complete genome	4842715	2032075	2039309	4842715		Morganella_phage(33.33%)	7	NA	NA
AYS38921.1|2032075_2033506_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYS38922.1|2033579_2034275_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYS38923.1|2034354_2034666_-	hypothetical protein	NA	NA	NA	NA	NA
AYS38924.1|2035316_2036501_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYS38925.1|2036960_2037173_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYS38926.1|2037618_2038887_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYS38927.1|2038889_2039309_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 7
CP029909	Salmonella enterica subsp. enterica serovar Typhi strain 311189_222186 chromosome, complete genome	4842715	2123051	2133558	4842715		Enterobacteria_phage(37.5%)	10	NA	NA
AYS39004.1|2123051_2124365_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYS39005.1|2124391_2125471_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYS39006.1|2125475_2126249_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYS39007.1|2126264_2127239_-	reductase RfbI	NA	NA	NA	NA	NA
AYS39008.1|2127244_2127796_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYS39009.1|2127796_2128675_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYS39010.1|2128722_2129622_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYS39011.1|2129621_2130707_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYS39012.1|2131083_2131977_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYS39013.1|2132154_2133558_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 8
CP029909	Salmonella enterica subsp. enterica serovar Typhi strain 311189_222186 chromosome, complete genome	4842715	2209450	2218621	4842715	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYS39071.1|2209450_2211484_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYS39072.1|2211724_2212183_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYS39073.1|2212354_2212885_+	lipoprotein	NA	NA	NA	NA	NA
AYS39074.1|2212941_2213409_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYS39075.1|2213455_2214175_-	two-component system response regulator	NA	NA	NA	NA	NA
AYS39076.1|2214171_2215857_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYS39077.1|2216079_2216811_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYS39078.1|2216870_2216978_+	hypothetical protein	NA	NA	NA	NA	NA
AYS39079.1|2216958_2217690_-	ABC transporter permease	NA	NA	NA	NA	NA
AYS39080.1|2217673_2218621_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 9
CP029909	Salmonella enterica subsp. enterica serovar Typhi strain 311189_222186 chromosome, complete genome	4842715	2684037	2693145	4842715	tail	Escherichia_phage(50.0%)	9	NA	NA
AYS39460.1|2684037_2685837_-	GTP-binding protein LepA	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
AYS39461.1|2686511_2686781_+	hypothetical protein	NA	NA	NA	NA	NA
AYS39462.1|2686830_2686986_+	hypothetical protein	NA	NA	NA	NA	NA
AYS39463.1|2687033_2688176_+	LPS 1,2-N-acetylglucosaminetransferase	NA	NA	NA	NA	NA
AYS39464.1|2688216_2688792_-|tail	phage tail protein	tail	A0A0M4RTP2	Salmonella_phage	86.3	1.7e-90
AYS39465.1|2688781_2689606_-|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	96.7	4.4e-153
AYS39466.1|2689602_2691312_-|tail	tail protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	2.6e-91
AYS39467.1|2691308_2691935_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	72.1	6.6e-93
AYS39468.1|2691918_2693145_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	63.6	1.8e-147
>prophage 10
CP029909	Salmonella enterica subsp. enterica serovar Typhi strain 311189_222186 chromosome, complete genome	4842715	2706707	2810931	4842715	tail,tRNA,terminase,integrase	Salmonella_phage(49.02%)	92	2710069:2710086	2734686:2734703
AYS39485.1|2706707_2707532_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	42.7	1.4e-53
AYS39486.1|2707528_2708950_-	hypothetical protein	NA	A0A0U2S5X9	Escherichia_phage	37.5	1.2e-89
AYS39487.1|2708961_2710293_-|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	60.0	6.4e-154
2710069:2710086	attL	ATACTGACGATATTCAGC	NA	NA	NA	NA
AYS39488.1|2710294_2711047_-	hypothetical protein	NA	A0A1I9KFG9	Aeromonas_phage	33.3	1.3e-15
AYS39489.1|2711107_2711659_-	hypothetical protein	NA	NA	NA	NA	NA
AYS39490.1|2711713_2712256_-	hypothetical protein	NA	NA	NA	NA	NA
AYS39491.1|2712252_2712867_-	endolysin	NA	Q8HA86	Salmonella_phage	95.6	6.9e-111
AYS39492.1|2712869_2713217_-	hypothetical protein	NA	Q8SBE1	Shigella_phage	80.4	9.8e-46
AYS39493.1|2713615_2714413_-	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYS39494.1|2714545_2715157_-	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	97.5	3.0e-90
AYS39495.1|2715365_2715968_-	bacteriophage protein	NA	A0A0M4QX23	Salmonella_phage	98.5	2.8e-109
AYS39496.1|2716367_2716601_-	XRE family transcriptional regulator	NA	K7PM44	Enterobacteria_phage	74.0	2.1e-28
AYS39497.1|2716756_2717023_-	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYS39498.1|2717121_2717865_-	Eaa protein	NA	A0A1V0E5M5	Salmonella_phage	60.8	9.4e-46
AYS39499.1|2717861_2718365_-	hypothetical protein	NA	A0A0N7C1Y5	Escherichia_phage	71.3	9.9e-31
AYS39500.1|2718364_2718721_-	hypothetical protein	NA	T1SA95	Salmonella_phage	91.5	3.6e-59
AYS39501.1|2718717_2719065_-	DNA-binding protein	NA	H6WRX9	Salmonella_phage	89.6	9.1e-52
AYS39502.1|2719075_2719825_-	DNA replication protein	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
AYS39503.1|2719827_2720643_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	83.1	8.8e-37
AYS39504.1|2720652_2720868_+	hypothetical protein	NA	NA	NA	NA	NA
AYS39505.1|2721162_2721483_-	repressor	NA	A0A0M4RU01	Salmonella_phage	100.0	1.3e-52
AYS39506.1|2721502_2721730_-	Rha family transcriptional regulator	NA	K7PKS2	Enterobacteria_phage	95.9	1.5e-34
AYS39507.1|2721743_2722211_+	transcriptional regulator	NA	K7PHG0	Enterobacteria_phage	85.2	2.1e-67
AYS39508.1|2722358_2723357_+	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	32.1	1.5e-43
AYS39509.1|2723888_2724425_+	HNH endonuclease	NA	A0A0M3ULK5	Salmonella_phage	99.4	1.2e-95
AYS39510.1|2724417_2724624_+	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	100.0	1.9e-33
AYS39511.1|2724705_2725002_+	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	91.8	2.3e-43
AYS39512.1|2725007_2725751_+	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	69.4	9.7e-67
AYS39513.1|2725747_2726371_+	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	57.4	2.2e-56
AYS39514.1|2726367_2727264_+	DNA methylase	NA	A0A0M4R347	Salmonella_phage	94.7	3.0e-155
AYS39515.1|2727263_2727509_+	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYS39516.1|2727549_2727834_+	hypothetical protein	NA	H6WRW8	Salmonella_phage	84.0	2.7e-41
AYS39517.1|2727811_2729041_-|integrase	integrase	integrase	H6WRW7	Salmonella_phage	93.9	3.2e-232
AYS39518.1|2729545_2730025_-	sigma-E factor regulatory protein RseC	NA	NA	NA	NA	NA
AYS39519.1|2730021_2730978_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
AYS39520.1|2730977_2731628_-	sigma-E factor negative regulatory protein	NA	NA	NA	NA	NA
AYS39521.1|2731659_2732235_-	RNA polymerase sigma-E factor	NA	NA	NA	NA	NA
AYS39522.1|2732659_2734282_+	L-aspartate oxidase	NA	NA	NA	NA	NA
AYS39523.1|2734266_2735004_-	O-methyltransferase	NA	NA	NA	NA	NA
2734686:2734703	attR	GCTGAATATCGTCAGTAT	NA	NA	NA	NA
AYS39524.1|2735133_2736468_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
AYS39525.1|2737485_2738073_+	cysteine/O-acetylserine exporter	NA	NA	NA	NA	NA
AYS39526.1|2738134_2738518_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
AYS39527.1|2738836_2739526_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
AYS39528.1|2739641_2740679_-	RNA methyltransferase	NA	NA	NA	NA	NA
AYS39529.1|2740882_2741302_+	thioredoxin 2	NA	A0A0K2FIM3	Achromobacter_phage	40.6	2.6e-16
AYS39530.1|2741374_2742055_+	hypothetical protein	NA	NA	NA	NA	NA
AYS39531.1|2742108_2744769_+	acyl-CoA synthetase	NA	NA	NA	NA	NA
AYS39532.1|2744883_2746239_+	CDP-diacylglycerol-serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
AYS39533.1|2746283_2746607_+	hypothetical protein	NA	NA	NA	NA	NA
AYS39534.1|2746603_2747905_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	29.9	2.2e-42
AYS39535.1|2748008_2748464_-	hypothetical protein	NA	E3SMI8	Prochlorococcus_phage	49.3	1.9e-33
AYS39536.1|2754624_2757198_-	protein disaggregation chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.6	9.0e-128
AYS39537.1|2757327_2758059_-	hypothetical protein	NA	NA	NA	NA	NA
AYS39538.1|2758055_2759036_-	ftsH suppressor protein SfhB	NA	NA	NA	NA	NA
AYS39539.1|2759167_2759905_+	lipoprotein	NA	NA	NA	NA	NA
AYS39540.1|2760176_2760515_+	sigma(54) modulation protein	NA	NA	NA	NA	NA
AYS39541.1|2760618_2760666_+	phe leader peptide	NA	NA	NA	NA	NA
AYS39542.1|2760765_2761926_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AYS39543.1|2761886_2762795_-	hypothetical protein	NA	NA	NA	NA	NA
AYS39544.1|2762852_2763974_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
AYS39545.1|2763983_2765054_-	phospho-2-dehydro-3-deoxyheptonate aldolase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
AYS39546.1|2765493_2766012_+	hypothetical protein	NA	NA	NA	NA	NA
AYS39547.1|2766004_2767225_+	hypothetical protein	NA	A0A2K8I9Y5	Pseudomonas_phage	37.0	1.7e-07
AYS39548.1|2767381_2767729_-	50S ribosomal subunit protein L19	NA	NA	NA	NA	NA
AYS39549.1|2767769_2768537_-|tRNA	tRNA(guanine-N1)methyltransferase	tRNA	NA	NA	NA	NA
AYS39550.1|2768581_2769130_-	16S rRNA processing protein	NA	NA	NA	NA	NA
AYS39551.1|2769148_2769397_-	30S ribosomal subunit protein S16	NA	NA	NA	NA	NA
AYS39552.1|2769740_2771102_-	signal recognition particle protein	NA	NA	NA	NA	NA
AYS39553.1|2771267_2772059_+	hypothetical protein	NA	NA	NA	NA	NA
AYS39554.1|2772123_2773365_+	hypothetical protein	NA	NA	NA	NA	NA
AYS39555.1|2774124_2774715_-	heat shock protein GrpE	NA	NA	NA	NA	NA
AYS39556.1|2774838_2775717_+	inorganic polyphosphate/ATP-NAD kinase	NA	NA	NA	NA	NA
AYS39557.1|2775802_2777464_+	DNA repair protein	NA	NA	NA	NA	NA
AYS39558.1|2777612_2777951_+	small protein A	NA	NA	NA	NA	NA
AYS39559.1|2778116_2778392_-	hypothetical protein	NA	NA	NA	NA	NA
AYS39560.1|2778396_2778873_-	hypothetical protein	NA	NA	NA	NA	NA
AYS39561.1|2779022_2779505_+	SsrA (tmRNA)-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
AYS39562.1|2780124_2790999_+	large repetitive protein	NA	NA	NA	NA	NA
AYS39563.1|2791062_2792472_+	type I secretion system protein	NA	NA	NA	NA	NA
AYS39564.1|2792468_2794625_+	type I secretion system ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
AYS39565.1|2794656_2795820_+	type I secretion system protein	NA	NA	NA	NA	NA
AYS39566.1|2797539_2797758_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYS39567.1|2797848_2798949_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS39568.1|2798945_2799431_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS39569.1|2799427_2802505_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
AYS39570.1|2802497_2802617_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS39571.1|2802631_2802934_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS39572.1|2802988_2803504_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS39573.1|2803513_2804686_-|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS39574.1|2804828_2805401_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS39575.1|2806078_2807194_+	glycosyltransferase	NA	NA	NA	NA	NA
AYS39576.1|2807274_2810931_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 11
CP029909	Salmonella enterica subsp. enterica serovar Typhi strain 311189_222186 chromosome, complete genome	4842715	3128206	3171909	4842715	protease,tRNA,transposase,bacteriocin	Bacillus_virus(33.33%)	44	NA	NA
AYS39863.1|3128206_3128665_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS39864.1|3128854_3129934_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYS39865.1|3130035_3131199_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYS39866.1|3131220_3132267_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYS39867.1|3132640_3133066_+	hypothetical protein	NA	NA	NA	NA	NA
AYS39868.1|3133091_3133670_+	hypothetical protein	NA	NA	NA	NA	NA
AYS39869.1|3133703_3134378_+	hypothetical protein	NA	NA	NA	NA	NA
AYS39870.1|3134359_3135043_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYS39871.1|3135036_3135693_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYS39872.1|3135797_3136256_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS39873.1|3136444_3138436_-	transketolase	NA	NA	NA	NA	NA
AYS39874.1|3138711_3139470_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYS39875.1|3139570_3140491_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYS39876.1|3140718_3142695_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYS39877.1|3142703_3142835_-	hypothetical protein	NA	NA	NA	NA	NA
AYS39878.1|3143129_3143429_-	membrane protein	NA	NA	NA	NA	NA
AYS39879.1|3143484_3144639_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYS39880.1|3145131_3146526_+	galactose-proton symport	NA	NA	NA	NA	NA
AYS39881.1|3146604_3147102_+	hypothetical protein	NA	NA	NA	NA	NA
AYS39882.1|3147197_3147905_+	endonuclease I	NA	NA	NA	NA	NA
AYS39883.1|3147981_3148713_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYS39884.1|3148732_3149680_+	glutathione synthetase	NA	NA	NA	NA	NA
AYS39885.1|3149895_3150459_+	hypothetical protein	NA	NA	NA	NA	NA
AYS39886.1|3150458_3150875_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYS39887.1|3150921_3151608_-	global regulatory protein	NA	NA	NA	NA	NA
AYS39888.1|3151737_3152718_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYS39889.1|3152735_3153440_+	hypothetical protein	NA	NA	NA	NA	NA
AYS39890.1|3153458_3154025_+	hypothetical protein	NA	NA	NA	NA	NA
AYS39891.1|3154021_3154312_+	hypothetical protein	NA	NA	NA	NA	NA
AYS39892.1|3154319_3154913_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYS39893.1|3154905_3156042_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYS39894.1|3156132_3157140_-	hypothetical protein	NA	NA	NA	NA	NA
AYS39895.1|3157272_3158319_-	L-asparaginase	NA	NA	NA	NA	NA
AYS39896.1|3158637_3159096_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS39897.1|3159218_3159938_-	hypothetical protein	NA	NA	NA	NA	NA
AYS39898.1|3159987_3160314_-	hypothetical protein	NA	NA	NA	NA	NA
AYS39899.1|3160313_3161033_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYS39900.1|3161187_3162240_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYS39901.1|3162267_3162543_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYS39902.1|3162655_3163741_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYS39903.1|3163957_3165214_+	nucleoside permease	NA	NA	NA	NA	NA
AYS39904.1|3167824_3168532_+	hypothetical protein	NA	NA	NA	NA	NA
AYS39905.1|3171121_3171388_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYS39906.1|3171630_3171909_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 12
CP029909	Salmonella enterica subsp. enterica serovar Typhi strain 311189_222186 chromosome, complete genome	4842715	3549200	3587258	4842715	transposase,tail,capsid,terminase,portal,integrase,plate	Salmonella_phage(82.05%)	46	3544164:3544178	3556330:3556344
3544164:3544178	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYS40235.1|3549200_3550847_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYS40236.1|3550986_3551085_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYS40237.1|3551340_3551670_+	hypothetical protein	NA	NA	NA	NA	NA
AYS40238.1|3551710_3552763_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYS40239.1|3553158_3553728_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYS40240.1|3553853_3554075_+	hypothetical protein	NA	NA	NA	NA	NA
AYS40241.1|3554107_3554617_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYS40242.1|3554791_3555016_+	hypothetical protein	NA	NA	NA	NA	NA
AYS40243.1|3555038_3555380_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYS40244.1|3555447_3555681_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYS40245.1|3555680_3555908_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYS40246.1|3555904_3556762_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3556330:3556344	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYS40247.1|3556758_3559173_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYS40248.1|3559326_3559515_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYS40249.1|3561482_3562397_+	hypothetical protein	NA	NA	NA	NA	NA
AYS40250.1|3562393_3563134_+	hypothetical protein	NA	NA	NA	NA	NA
AYS40251.1|3563168_3564206_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYS40252.1|3564205_3565972_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYS40253.1|3566114_3566948_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYS40254.1|3566964_3568023_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYS40255.1|3568026_3568677_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYS40256.1|3568709_3569237_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYS40257.1|3569236_3569440_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYS40258.1|3569443_3569659_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYS40259.1|3569678_3570152_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYS40260.1|3570153_3570531_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYS40261.1|3570527_3570956_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYS40262.1|3571051_3571483_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYS40263.1|3571475_3571922_+|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYS40264.1|3571990_3572569_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYS40265.1|3572565_3572925_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYS40266.1|3572911_3573820_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYS40267.1|3573812_3574418_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS40268.1|3574414_3575929_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYS40269.1|3575928_3576522_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYS40270.1|3576493_3576934_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYS40271.1|3577356_3577929_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS40272.1|3578071_3579244_+|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS40273.1|3579253_3579769_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS40274.1|3579823_3580126_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS40275.1|3580140_3580260_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS40276.1|3580252_3583330_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
AYS40277.1|3583326_3583812_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS40278.1|3583808_3584909_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS40279.1|3584999_3585218_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYS40280.1|3586799_3587258_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 13
CP029909	Salmonella enterica subsp. enterica serovar Typhi strain 311189_222186 chromosome, complete genome	4842715	4502453	4576723	4842715	tail,capsid,portal,terminase,integrase,plate	Salmonella_phage(82.61%)	75	4563967:4563983	4576882:4576898
AYS41051.1|4502453_4504403_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYS41052.1|4504474_4505383_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41053.1|4505456_4506356_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41054.1|4506397_4506757_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41055.1|4506856_4507126_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41056.1|4507257_4508532_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYS41057.1|4508751_4509129_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41058.1|4509215_4509434_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYS41059.1|4509501_4510602_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYS41060.1|4510598_4511084_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYS41061.1|4511083_4513864_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYS41062.1|4513856_4513976_-	hypothetical protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYS41063.1|4513990_4514293_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYS41064.1|4514347_4514863_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYS41065.1|4514872_4516045_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYS41066.1|4516579_4517302_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYS41067.1|4517499_4517907_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYS41068.1|4517913_4519533_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYS41069.1|4519529_4520135_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS41070.1|4520127_4521036_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	96.7	4.4e-154
AYS41071.1|4521022_4521382_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYS41072.1|4521378_4521957_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYS41073.1|4522025_4522472_-|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYS41074.1|4522464_4522896_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
AYS41075.1|4522991_4523417_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYS41076.1|4523416_4523794_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYS41077.1|4523798_4524269_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYS41078.1|4524288_4524504_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYS41079.1|4524507_4524711_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYS41080.1|4524710_4525175_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYS41081.1|4525268_4525919_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYS41082.1|4525922_4526987_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYS41083.1|4527003_4527837_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYS41084.1|4527979_4529746_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYS41085.1|4529742_4530789_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYS41086.1|4530837_4531533_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41087.1|4531552_4532617_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41088.1|4532613_4533678_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41089.1|4534602_4537011_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	95.1	0.0e+00
AYS41090.1|4537001_4537862_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYS41091.1|4537858_4538443_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYS41092.1|4538439_4538667_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYS41093.1|4538666_4538900_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYS41094.1|4538967_4539309_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYS41095.1|4539272_4539473_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYS41096.1|4539480_4539990_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYS41097.1|4540022_4540265_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYS41098.1|4540381_4541014_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYS41099.1|4541017_4542043_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYS41100.1|4542149_4542503_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYS41101.1|4543119_4543407_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41102.1|4543417_4544308_+	methyltransferase	NA	NA	NA	NA	NA
AYS41103.1|4544307_4545054_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41104.1|4545355_4547326_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS41105.1|4547345_4548650_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS41106.1|4548672_4549368_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYS41107.1|4549393_4550188_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS41108.1|4550197_4551265_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS41109.1|4551309_4553046_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYS41110.1|4553045_4555541_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS41111.1|4555564_4556611_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYS41112.1|4556613_4557891_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYS41113.1|4558135_4558675_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS41114.1|4559528_4561040_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYS41115.1|4561023_4562613_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41116.1|4562776_4563790_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4563967:4563983	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYS41117.1|4564216_4564510_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41118.1|4564506_4564995_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41119.1|4565174_4565627_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41120.1|4570849_4571311_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41121.1|4571307_4571529_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYS41122.1|4572385_4573168_+	hypothetical protein	NA	NA	NA	NA	NA
AYS41123.1|4573794_4574019_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41124.1|4574148_4575153_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
AYS41125.1|4575463_4576723_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4576882:4576898	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 14
CP029909	Salmonella enterica subsp. enterica serovar Typhi strain 311189_222186 chromosome, complete genome	4842715	4718976	4725452	4842715	capsid	Enterobacteria_phage(66.67%)	8	NA	NA
AYS41262.1|4718976_4720053_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYS41263.1|4720049_4721123_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYS41264.1|4721097_4722261_-	hypothetical protein	NA	NA	NA	NA	NA
AYS41265.1|4722536_4723103_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYS41266.1|4723118_4723358_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYS41267.1|4723361_4724222_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYS41268.1|4724644_4724968_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYS41269.1|4724951_4725452_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
