The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029918	Salmonella enterica subsp. enterica serovar Typhi strain 311189_232103 chromosome, complete genome	4778368	930203	937515	4778368	integrase,protease	Dickeya_phage(16.67%)	6	931454:931468	942446:942460
AYS55391.1|930203_931322_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYS55392.1|931318_933265_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931454:931468	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYS55393.1|933394_933616_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYS55394.1|933939_934260_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYS55395.1|934290_936567_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYS55396.1|937137_937515_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942446:942460	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029918	Salmonella enterica subsp. enterica serovar Typhi strain 311189_232103 chromosome, complete genome	4778368	1008258	1085572	4778368	terminase,tail,transposase,integrase,protease	Salmonella_phage(73.33%)	93	990337:990356	1060932:1060951
990337:990356	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS55446.1|1008258_1009599_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYS55447.1|1009595_1009844_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYS55448.1|1009884_1010130_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYS55449.1|1010129_1011011_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYS55450.1|1011007_1012072_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYS55451.1|1012149_1012830_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYS55452.1|1012826_1013612_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYS55453.1|1013617_1013914_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYS55454.1|1014004_1014205_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYS55455.1|1014493_1014898_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYS55456.1|1015229_1015604_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYS55457.1|1015688_1016672_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYS55458.1|1016674_1017424_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
AYS55459.1|1017434_1017782_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	3.7e-53
AYS55460.1|1017778_1018303_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYS55461.1|1018302_1018776_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYS55462.1|1018779_1019352_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYS55463.1|1019445_1019712_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYS55464.1|1019793_1019955_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS55465.1|1020387_1020885_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS55466.1|1021069_1021309_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
AYS55467.1|1021298_1021604_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYS55468.1|1021643_1022246_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYS55469.1|1022454_1023066_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYS55470.1|1023198_1023996_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYS55471.1|1024394_1024520_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS55472.1|1024655_1025105_-	lipoprotein	NA	NA	NA	NA	NA
AYS55473.1|1025321_1025711_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYS55474.1|1025697_1025979_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYS55475.1|1025978_1026593_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYS55476.1|1026812_1027067_+	hypothetical protein	NA	NA	NA	NA	NA
AYS55477.1|1027171_1027549_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYS55478.1|1027612_1027873_+	hypothetical protein	NA	NA	NA	NA	NA
AYS55479.1|1027962_1028715_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYS55480.1|1028680_1030084_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYS55481.1|1030083_1031553_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYS55482.1|1031644_1032175_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYS55483.1|1032189_1033422_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYS55484.1|1033426_1033924_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYS55485.1|1033935_1034877_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYS55486.1|1034918_1035287_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYS55487.1|1035252_1035660_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYS55488.1|1035656_1036211_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYS55489.1|1036197_1036587_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYS55490.1|1036561_1037125_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYS55491.1|1037128_1038274_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYS55492.1|1038285_1038726_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.0	7.8e-56
AYS55493.1|1038729_1039182_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYS55494.1|1039359_1041312_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYS55495.1|1041311_1041962_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYS55496.1|1041965_1042268_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYS55497.1|1042270_1043302_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYS55498.1|1043298_1043634_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYS55499.1|1043828_1044560_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS55500.1|1044559_1044988_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS55501.1|1045046_1045802_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYS55502.1|1045889_1046027_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYS55503.1|1046042_1046396_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYS55504.1|1046396_1047596_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYS55505.1|1047592_1048273_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYS55506.1|1048272_1049784_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYS55507.1|1049798_1050317_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYS55508.1|1051238_1051940_-	hypothetical protein	NA	NA	NA	NA	NA
AYS55509.1|1052252_1052531_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYS55510.1|1052956_1055569_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYS55511.1|1055776_1056787_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYS55512.1|1056949_1057495_+	hypothetical protein	NA	NA	NA	NA	NA
AYS55513.1|1057491_1058601_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYS55514.1|1058699_1060808_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYS55515.1|1060820_1062728_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1060932:1060951	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
AYS55516.1|1062742_1063996_+	inner membrane protein	NA	NA	NA	NA	NA
AYS55517.1|1064000_1065641_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYS55518.1|1065637_1066201_+	lipoprotein	NA	NA	NA	NA	NA
AYS55519.1|1066454_1066622_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYS55520.1|1066721_1067240_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYS55521.1|1067308_1069069_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYS55522.1|1069254_1069707_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYS55523.1|1069778_1070831_-	outer membrane protein A	NA	NA	NA	NA	NA
AYS55524.1|1071186_1071696_-	cell division inhibitor	NA	NA	NA	NA	NA
AYS55525.1|1071912_1072518_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYS55526.1|1072504_1074658_-	inner membrane protein	NA	NA	NA	NA	NA
AYS55527.1|1074676_1075123_-	hypothetical protein	NA	NA	NA	NA	NA
AYS55528.1|1075246_1077301_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYS55529.1|1077336_1077795_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYS55530.1|1077889_1078552_-	hypothetical protein	NA	NA	NA	NA	NA
AYS55531.1|1078722_1079139_+	hypothetical protein	NA	NA	NA	NA	NA
AYS55532.1|1079183_1079501_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYS55533.1|1079558_1080770_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYS55534.1|1081901_1082360_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS55535.1|1083096_1083378_+	acylphosphatase	NA	NA	NA	NA	NA
AYS55536.1|1083374_1083704_-	sulfite reductase	NA	NA	NA	NA	NA
AYS55537.1|1083790_1084450_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYS55538.1|1085113_1085572_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029918	Salmonella enterica subsp. enterica serovar Typhi strain 311189_232103 chromosome, complete genome	4778368	1530494	1571140	4778368	tail,head,transposase,plate,protease	Burkholderia_virus(51.61%)	51	NA	NA
AYS55937.1|1530494_1530953_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS55938.1|1531455_1531737_+	stress response protein	NA	NA	NA	NA	NA
AYS55939.1|1532005_1532827_+|protease	serine protease	protease	NA	NA	NA	NA
AYS55940.1|1532861_1533191_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYS55941.1|1533177_1533540_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYS55942.1|1533651_1533822_-	hypothetical protein	NA	NA	NA	NA	NA
AYS55943.1|1533956_1534991_+	hypothetical protein	NA	NA	NA	NA	NA
AYS55944.1|1535165_1536554_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYS55945.1|1536564_1538094_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYS55946.1|1538620_1539565_+	hypothetical protein	NA	NA	NA	NA	NA
AYS55947.1|1539746_1540136_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYS55948.1|1540107_1540560_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYS55949.1|1540754_1540985_-	hypothetical protein	NA	NA	NA	NA	NA
AYS55950.1|1540981_1541665_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYS55951.1|1541661_1541877_-	hypothetical protein	NA	NA	NA	NA	NA
AYS55952.1|1541869_1542253_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
AYS55953.1|1542249_1542552_-	hypothetical protein	NA	NA	NA	NA	NA
AYS55954.1|1542561_1542834_-	hypothetical protein	NA	NA	NA	NA	NA
AYS55955.1|1543122_1543653_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYS55956.1|1543680_1543950_-	hypothetical protein	NA	NA	NA	NA	NA
AYS55957.1|1543952_1545119_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYS55958.1|1545129_1546899_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYS55959.1|1547076_1547508_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
AYS55960.1|1547503_1548100_+	hypothetical protein	NA	NA	NA	NA	NA
AYS55961.1|1548343_1548694_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYS55962.1|1549408_1550059_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYS55963.1|1550055_1550382_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AYS55964.1|1550381_1550693_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYS55965.1|1550692_1551238_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYS55966.1|1551234_1552830_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYS55967.1|1552829_1554326_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYS55968.1|1554306_1555128_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYS55969.1|1555130_1555589_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYS55970.1|1555803_1556919_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYS55971.1|1556933_1557887_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYS55972.1|1557896_1558235_+	hypothetical protein	NA	NA	NA	NA	NA
AYS55973.1|1558236_1558683_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYS55974.1|1558682_1559147_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYS55975.1|1559143_1559398_+	hypothetical protein	NA	NA	NA	NA	NA
AYS55976.1|1559387_1560815_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYS55977.1|1560814_1561336_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYS55978.1|1561338_1561620_+	hypothetical protein	NA	NA	NA	NA	NA
AYS55979.1|1561717_1562053_+	hypothetical protein	NA	NA	NA	NA	NA
AYS55980.1|1562228_1564694_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYS55981.1|1564693_1565578_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYS55982.1|1565777_1566932_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYS55983.1|1566928_1567456_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYS55984.1|1567512_1567860_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYS55985.1|1567850_1568954_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYS55986.1|1568946_1569525_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYS55987.1|1570522_1571140_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
>prophage 4
CP029918	Salmonella enterica subsp. enterica serovar Typhi strain 311189_232103 chromosome, complete genome	4778368	1784593	1789005	4778368		Escherichia_phage(50.0%)	6	NA	NA
AYS56197.1|1784593_1784833_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
AYS56198.1|1785705_1786515_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYS56199.1|1786587_1786965_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYS56200.1|1787112_1787655_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYS56201.1|1787846_1788575_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYS56202.1|1788591_1789005_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029918	Salmonella enterica subsp. enterica serovar Typhi strain 311189_232103 chromosome, complete genome	4778368	1992892	2000126	4778368		Morganella_phage(33.33%)	7	NA	NA
AYS56392.1|1992892_1994323_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYS56393.1|1994396_1995092_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYS56394.1|1995171_1995483_-	hypothetical protein	NA	NA	NA	NA	NA
AYS56395.1|1996133_1997318_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYS56396.1|1997777_1997990_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYS56397.1|1998435_1999704_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYS56398.1|1999706_2000126_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029918	Salmonella enterica subsp. enterica serovar Typhi strain 311189_232103 chromosome, complete genome	4778368	2083868	2094375	4778368		Enterobacteria_phage(37.5%)	10	NA	NA
AYS56475.1|2083868_2085182_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYS56476.1|2085208_2086288_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYS56477.1|2086292_2087066_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYS56478.1|2087081_2088056_-	reductase RfbI	NA	NA	NA	NA	NA
AYS56479.1|2088061_2088613_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYS56480.1|2088613_2089492_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYS56481.1|2089539_2090439_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYS56482.1|2090438_2091524_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYS56483.1|2091900_2092794_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYS56484.1|2092971_2094375_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029918	Salmonella enterica subsp. enterica serovar Typhi strain 311189_232103 chromosome, complete genome	4778368	2170267	2179438	4778368	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYS56543.1|2170267_2172301_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYS56544.1|2172541_2173000_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYS56545.1|2173171_2173702_+	lipoprotein	NA	NA	NA	NA	NA
AYS56546.1|2173758_2174226_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYS56547.1|2174272_2174992_-	two-component system response regulator	NA	NA	NA	NA	NA
AYS56548.1|2174988_2176674_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYS56549.1|2176896_2177628_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYS56550.1|2177687_2177795_+	hypothetical protein	NA	NA	NA	NA	NA
AYS56551.1|2177775_2178507_-	ABC transporter permease	NA	NA	NA	NA	NA
AYS56552.1|2178490_2179438_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029918	Salmonella enterica subsp. enterica serovar Typhi strain 311189_232103 chromosome, complete genome	4778368	2714970	2728362	4778368	tail	Salmonella_phage(70.0%)	11	NA	NA
AYS56980.1|2714970_2715189_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYS56981.1|2715279_2716380_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS56982.1|2716376_2716862_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS56983.1|2716858_2719936_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
AYS56984.1|2719928_2720048_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS56985.1|2720062_2720365_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS56986.1|2720419_2720935_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS56987.1|2720944_2722117_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS56988.1|2722259_2722832_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS56989.1|2723509_2724625_+	glycosyltransferase	NA	NA	NA	NA	NA
AYS56990.1|2724705_2728362_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029918	Salmonella enterica subsp. enterica serovar Typhi strain 311189_232103 chromosome, complete genome	4778368	3046698	3090400	4778368	bacteriocin,tRNA,transposase,protease	Bacillus_virus(33.33%)	44	NA	NA
AYS57281.1|3046698_3047157_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS57282.1|3047346_3048426_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYS57283.1|3048527_3049691_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYS57284.1|3049712_3050759_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYS57285.1|3051132_3051558_+	hypothetical protein	NA	NA	NA	NA	NA
AYS57286.1|3051583_3052162_+	hypothetical protein	NA	NA	NA	NA	NA
AYS57287.1|3052195_3052870_+	hypothetical protein	NA	NA	NA	NA	NA
AYS57288.1|3052851_3053535_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYS57289.1|3053528_3054185_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYS57290.1|3054289_3054748_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS57291.1|3054936_3056928_-	transketolase	NA	NA	NA	NA	NA
AYS57292.1|3057203_3057962_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYS57293.1|3058062_3058983_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYS57294.1|3059210_3061187_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYS57295.1|3061195_3061327_-	hypothetical protein	NA	NA	NA	NA	NA
AYS57296.1|3061621_3061921_-	membrane protein	NA	NA	NA	NA	NA
AYS57297.1|3061976_3063131_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYS57298.1|3063623_3065018_+	galactose-proton symport	NA	NA	NA	NA	NA
AYS57299.1|3065096_3065594_+	hypothetical protein	NA	NA	NA	NA	NA
AYS57300.1|3065689_3066397_+	endonuclease I	NA	NA	NA	NA	NA
AYS57301.1|3066473_3067205_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYS57302.1|3067224_3068172_+	glutathione synthetase	NA	NA	NA	NA	NA
AYS57303.1|3068387_3068951_+	hypothetical protein	NA	NA	NA	NA	NA
AYS57304.1|3068950_3069367_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYS57305.1|3069413_3070100_-	global regulatory protein	NA	NA	NA	NA	NA
AYS57306.1|3070229_3071210_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYS57307.1|3071227_3071932_+	hypothetical protein	NA	NA	NA	NA	NA
AYS57308.1|3071950_3072517_+	hypothetical protein	NA	NA	NA	NA	NA
AYS57309.1|3072513_3072804_+	hypothetical protein	NA	NA	NA	NA	NA
AYS57310.1|3072811_3073405_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYS57311.1|3073397_3074534_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYS57312.1|3074624_3075632_-	hypothetical protein	NA	NA	NA	NA	NA
AYS57313.1|3075764_3076811_-	L-asparaginase	NA	NA	NA	NA	NA
AYS57314.1|3077129_3077588_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS57315.1|3077710_3078430_-	hypothetical protein	NA	NA	NA	NA	NA
AYS57316.1|3078479_3078806_-	hypothetical protein	NA	NA	NA	NA	NA
AYS57317.1|3078805_3079525_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYS57318.1|3079679_3080732_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYS57319.1|3080759_3081035_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYS57320.1|3081147_3082233_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYS57321.1|3082449_3083706_+	nucleoside permease	NA	NA	NA	NA	NA
AYS57322.1|3086316_3087024_+	hypothetical protein	NA	NA	NA	NA	NA
AYS57323.1|3089612_3089879_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYS57324.1|3090121_3090400_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029918	Salmonella enterica subsp. enterica serovar Typhi strain 311189_232103 chromosome, complete genome	4778368	3468100	3506158	4778368	terminase,tail,transposase,integrase,plate,capsid,portal	Salmonella_phage(82.05%)	45	3463064:3463078	3475230:3475244
3463064:3463078	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYS57654.1|3468100_3469747_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYS57655.1|3469886_3469985_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYS57656.1|3470240_3470570_+	hypothetical protein	NA	NA	NA	NA	NA
AYS57657.1|3470610_3471663_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYS57658.1|3472058_3472628_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYS57659.1|3473007_3473517_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYS57660.1|3473691_3473916_+	hypothetical protein	NA	NA	NA	NA	NA
AYS57661.1|3473938_3474280_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYS57662.1|3474347_3474581_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYS57663.1|3474580_3474808_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYS57664.1|3474804_3475662_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3475230:3475244	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYS57665.1|3475658_3478073_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYS57666.1|3478226_3478415_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYS57667.1|3480382_3481297_+	hypothetical protein	NA	NA	NA	NA	NA
AYS57668.1|3481293_3482034_+	hypothetical protein	NA	NA	NA	NA	NA
AYS57669.1|3482068_3483106_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYS57670.1|3483105_3484872_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYS57671.1|3485014_3485848_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYS57672.1|3485864_3486923_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYS57673.1|3486926_3487577_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYS57674.1|3487609_3488137_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYS57675.1|3488136_3488340_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYS57676.1|3488343_3488559_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYS57677.1|3488578_3489052_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYS57678.1|3489053_3489431_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYS57679.1|3489427_3489856_+	regulatory protein	NA	E5G6N2	Salmonella_phage	76.6	5.4e-46
AYS57680.1|3489951_3490383_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYS57681.1|3490375_3490822_+|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYS57682.1|3490890_3491469_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYS57683.1|3491465_3491825_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYS57684.1|3491811_3492720_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYS57685.1|3492712_3493318_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS57686.1|3493314_3494829_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYS57687.1|3494828_3495422_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYS57688.1|3495393_3495834_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYS57689.1|3496256_3496829_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS57690.1|3496971_3498144_+|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS57691.1|3498153_3498669_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS57692.1|3498723_3499026_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS57693.1|3499040_3499160_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS57694.1|3499152_3502230_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
AYS57695.1|3502226_3502712_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS57696.1|3502708_3503809_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS57697.1|3503899_3504118_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYS57698.1|3505699_3506158_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029918	Salmonella enterica subsp. enterica serovar Typhi strain 311189_232103 chromosome, complete genome	4778368	4438062	4512239	4778368	terminase,tail,integrase,plate,capsid,portal	Salmonella_phage(82.61%)	75	4499576:4499592	4512398:4512414
AYS58476.1|4438062_4440012_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYS58477.1|4440083_4440992_+	hypothetical protein	NA	NA	NA	NA	NA
AYS58478.1|4441065_4441965_+	hypothetical protein	NA	NA	NA	NA	NA
AYS58479.1|4442006_4442366_+	hypothetical protein	NA	NA	NA	NA	NA
AYS58480.1|4442465_4442735_-	hypothetical protein	NA	NA	NA	NA	NA
AYS58481.1|4442866_4444141_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYS58482.1|4444360_4444738_+	hypothetical protein	NA	NA	NA	NA	NA
AYS58483.1|4444824_4445043_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYS58484.1|4445110_4446211_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYS58485.1|4446207_4446693_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYS58486.1|4446692_4449473_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYS58487.1|4449465_4449585_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYS58488.1|4449599_4449902_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYS58489.1|4449956_4450472_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYS58490.1|4450481_4451654_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYS58491.1|4452188_4452911_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYS58492.1|4453108_4453516_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYS58493.1|4453522_4455142_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYS58494.1|4455138_4455744_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS58495.1|4455736_4456645_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYS58496.1|4456631_4456991_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYS58497.1|4456987_4457566_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYS58498.1|4457634_4458081_-|tail	phage tail protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYS58499.1|4458073_4458505_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
AYS58500.1|4458600_4459026_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYS58501.1|4459025_4459403_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYS58502.1|4459407_4459878_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYS58503.1|4459897_4460113_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYS58504.1|4460116_4460320_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYS58505.1|4460319_4460784_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYS58506.1|4460877_4461528_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYS58507.1|4461531_4462596_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYS58508.1|4462612_4463446_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYS58509.1|4463588_4465355_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYS58510.1|4465351_4466398_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYS58511.1|4466446_4467142_-	hypothetical protein	NA	NA	NA	NA	NA
AYS58512.1|4467161_4468226_-	hypothetical protein	NA	NA	NA	NA	NA
AYS58513.1|4468222_4469287_-	hypothetical protein	NA	NA	NA	NA	NA
AYS58514.1|4470211_4472620_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	95.1	0.0e+00
AYS58515.1|4472610_4473471_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYS58516.1|4473467_4474052_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYS58517.1|4474048_4474276_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYS58518.1|4474275_4474509_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYS58519.1|4474576_4474918_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYS58520.1|4474881_4475082_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYS58521.1|4475089_4475599_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYS58522.1|4475631_4475874_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYS58523.1|4475990_4476623_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYS58524.1|4476626_4477652_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYS58525.1|4477758_4478112_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYS58526.1|4478728_4479016_+	hypothetical protein	NA	NA	NA	NA	NA
AYS58527.1|4479026_4479917_+	methyltransferase	NA	NA	NA	NA	NA
AYS58528.1|4479916_4480663_+	hypothetical protein	NA	NA	NA	NA	NA
AYS58529.1|4480964_4482935_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS58530.1|4482954_4484259_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS58531.1|4484281_4484977_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYS58532.1|4485002_4485797_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS58533.1|4485806_4486874_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS58534.1|4486918_4488655_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYS58535.1|4488654_4491150_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS58536.1|4491173_4492220_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYS58537.1|4492222_4493500_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.3e-21
AYS58538.1|4493744_4494284_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS58539.1|4495137_4496649_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYS58540.1|4496632_4498222_+	hypothetical protein	NA	NA	NA	NA	NA
AYS58541.1|4498385_4499399_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4499576:4499592	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYS58542.1|4499825_4500119_+	hypothetical protein	NA	NA	NA	NA	NA
AYS58543.1|4500115_4500604_+	hypothetical protein	NA	NA	NA	NA	NA
AYS58544.1|4500783_4501236_-	hypothetical protein	NA	NA	NA	NA	NA
AYS58545.1|4506458_4506920_+	hypothetical protein	NA	NA	NA	NA	NA
AYS58546.1|4506916_4507138_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYS58547.1|4507994_4508777_+	hypothetical protein	NA	NA	NA	NA	NA
AYS58548.1|4509403_4509628_-	hypothetical protein	NA	NA	NA	NA	NA
AYS58549.1|4509757_4510669_-	hypothetical protein	NA	NA	NA	NA	NA
AYS58550.1|4510979_4512239_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4512398:4512414	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 12
CP029918	Salmonella enterica subsp. enterica serovar Typhi strain 311189_232103 chromosome, complete genome	4778368	4654492	4660975	4778368	capsid	Enterobacteria_phage(66.67%)	8	NA	NA
AYS58687.1|4654492_4655569_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYS58688.1|4655565_4656639_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYS58689.1|4656613_4657777_-	hypothetical protein	NA	NA	NA	NA	NA
AYS58690.1|4658052_4658619_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYS58691.1|4658634_4658874_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYS58692.1|4658877_4659738_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYS58693.1|4660160_4660427_+	hypothetical protein	NA	Q7M299	Enterobacteria_phage	70.5	5.8e-30
AYS58694.1|4660474_4660975_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
