The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
CP029902	Salmonella enterica subsp. enterica serovar Typhi strain 311189_268103 chromosome, complete genome	4804086	930296	937608	4804086	integrase,protease	Dickeya_phage(16.67%)	6	931547:931561	942913:942927
AYS76920.1|930296_931415_+	hypothetical protein	NA	A0A140XAI1	Dickeya_phage	39.8	8.1e-09
AYS76921.1|931411_933358_+	macrolide transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
931547:931561	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
AYS76922.1|933487_933709_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
AYS76923.1|934032_934353_+|protease	ATP-dependent Clp protease adaptor protein	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
AYS76924.1|934383_936660_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
AYS76925.1|937230_937608_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942913:942927	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 2
CP029902	Salmonella enterica subsp. enterica serovar Typhi strain 311189_268103 chromosome, complete genome	4804086	1001973	1129488	4804086	terminase,integrase,transposase,protease,tail,tRNA	Salmonella_phage(62.75%)	154	1020561:1020596	1065182:1065217
AYS76972.1|1001973_1003374_-|tRNA	asparaginyl-tRNA synthetase	tRNA	A0A2K9V902	Bandra_megavirus	35.8	4.5e-81
AYS76973.1|1003574_1004036_-	transcriptional regulator	NA	NA	NA	NA	NA
AYS76974.1|1005814_1007248_+	ion:amino acid symporter	NA	NA	NA	NA	NA
AYS76975.1|1007328_1008531_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
AYS76976.1|1008725_1010066_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.8	7.9e-261
AYS76977.1|1010062_1010311_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
AYS76978.1|1010351_1010597_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYS76979.1|1010596_1011478_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	93.0	1.2e-153
AYS76980.1|1011474_1012539_-	bacteriophage protein	NA	T1SBJ4	Salmonella_phage	74.6	6.3e-152
AYS76981.1|1012616_1013297_-	exonuclease	NA	A0A0M3ULE0	Salmonella_phage	98.7	1.9e-130
AYS76982.1|1013293_1014079_-	bacteriophage recombination protein	NA	A0A0M4RD39	Salmonella_phage	99.6	9.7e-150
AYS76983.1|1014084_1014381_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	96.9	4.4e-47
AYS76984.1|1014471_1014672_-	prophage Kil protein	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
AYS76985.1|1014960_1015365_-	DNA-binding protein	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
AYS76986.1|1015696_1016071_+	DNA-binding protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
AYS76987.1|1016155_1017139_+	bacteriophage protein	NA	H6WRX7	Salmonella_phage	99.7	2.1e-162
AYS76988.1|1017141_1017891_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
AYS76989.1|1017901_1018249_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	89.6	9.1e-52
AYS76990.1|1018245_1018602_+	hypothetical protein	NA	T1SA95	Salmonella_phage	91.5	3.6e-59
AYS76991.1|1018601_1019105_+	hypothetical protein	NA	A0A0N7C1Y5	Escherichia_phage	71.3	9.9e-31
AYS76992.1|1019101_1019845_+	Eaa protein	NA	A0A1V0E5M5	Salmonella_phage	60.8	9.4e-46
AYS76993.1|1019943_1020210_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYS76994.1|1020365_1020599_+	XRE family transcriptional regulator	NA	K7PM44	Enterobacteria_phage	74.0	2.1e-28
1020561:1020596	attL	CAGGAAACGTGGGAAAGCGCTGACGACTGGTTTTAT	NA	NA	NA	NA
AYS76995.1|1020998_1021601_+	bacteriophage protein	NA	A0A0M4QX23	Salmonella_phage	98.5	2.8e-109
AYS76996.1|1021809_1022421_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	97.5	3.0e-90
AYS76997.1|1022553_1023351_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYS76998.1|1023749_1024097_+	hypothetical protein	NA	Q8SBE1	Shigella_phage	80.4	9.8e-46
AYS76999.1|1024099_1024714_+	endolysin	NA	Q8HA86	Salmonella_phage	95.1	7.6e-110
AYS77000.1|1024710_1025253_+	hypothetical protein	NA	NA	NA	NA	NA
AYS77001.1|1025307_1025859_+	hypothetical protein	NA	NA	NA	NA	NA
AYS77002.1|1025919_1026672_+	hypothetical protein	NA	A0A1I9KFG9	Aeromonas_phage	33.3	1.3e-15
AYS77003.1|1026673_1028005_+|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	60.0	6.4e-154
AYS77004.1|1028016_1029438_+	hypothetical protein	NA	A0A0U2S5X9	Escherichia_phage	37.5	1.2e-89
AYS77005.1|1029434_1030259_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	42.7	1.4e-53
AYS77006.1|1030271_1031891_+	NUDIX hydrolase	NA	NA	NA	NA	NA
AYS77007.1|1031906_1032767_+	hypothetical protein	NA	NA	NA	NA	NA
AYS77008.1|1032783_1033815_+	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	45.8	3.7e-72
AYS77009.1|1033882_1034365_+	hypothetical protein	NA	NA	NA	NA	NA
AYS77010.1|1034361_1034790_+	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	40.6	1.3e-23
AYS77011.1|1034786_1035221_+	hypothetical protein	NA	NA	NA	NA	NA
AYS77012.1|1035204_1036146_+	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	36.7	1.1e-51
AYS77013.1|1036151_1037546_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	38.1	7.1e-71
AYS77014.1|1037549_1037987_+	hypothetical protein	NA	NA	NA	NA	NA
AYS77015.1|1037986_1038574_+	hypothetical protein	NA	NA	NA	NA	NA
AYS77016.1|1038697_1040752_+	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	35.8	2.2e-20
AYS77017.1|1040751_1041468_+	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	36.5	1.3e-28
AYS77018.1|1041464_1041740_+	hypothetical protein	NA	NA	NA	NA	NA
AYS77019.1|1041739_1042783_+	hypothetical protein	NA	NA	NA	NA	NA
AYS77020.1|1042779_1043496_+	hypothetical protein	NA	NA	NA	NA	NA
AYS77021.1|1043492_1043825_+	hypothetical protein	NA	NA	NA	NA	NA
AYS77022.1|1043821_1045048_+	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	63.6	1.8e-147
AYS77023.1|1045031_1045658_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	72.1	6.6e-93
AYS77024.1|1045654_1047364_+|tail	tail protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	2.6e-91
AYS77025.1|1047360_1048185_+|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	96.7	4.4e-153
AYS77026.1|1048174_1048750_+|tail	phage tail protein	tail	A0A0M4RTP2	Salmonella_phage	86.3	1.7e-90
AYS77027.1|1048790_1049933_-	LPS 1,2-N-acetylglucosaminetransferase	NA	NA	NA	NA	NA
AYS77028.1|1049980_1050136_-	hypothetical protein	NA	NA	NA	NA	NA
AYS77029.1|1050185_1050455_-	hypothetical protein	NA	NA	NA	NA	NA
AYS77030.1|1051375_1052605_+|integrase	integrase	integrase	H6WRW7	Salmonella_phage	93.9	3.2e-232
AYS77031.1|1052582_1052867_-	hypothetical protein	NA	H6WRW8	Salmonella_phage	84.0	2.7e-41
AYS77032.1|1052907_1053153_-	bacteriophage protein	NA	S4TR31	Salmonella_phage	96.2	1.3e-36
AYS77033.1|1053152_1054049_-	DNA methylase	NA	A0A0M4R347	Salmonella_phage	94.7	3.0e-155
AYS77034.1|1054045_1054669_-	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	57.4	2.2e-56
AYS77035.1|1054665_1055409_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	69.4	9.7e-67
AYS77036.1|1055414_1055711_-	host-nuclease inhibitor protein	NA	A0A0M5M5Z9	Salmonella_phage	91.8	2.3e-43
AYS77037.1|1055792_1055999_-	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	100.0	1.9e-33
AYS77038.1|1055991_1056528_-	HNH endonuclease	NA	A0A0M3ULK5	Salmonella_phage	99.4	1.2e-95
AYS77039.1|1057059_1058058_-	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	32.1	1.5e-43
AYS77040.1|1058205_1058673_-	transcriptional regulator	NA	K7PHG0	Enterobacteria_phage	85.2	2.1e-67
AYS77041.1|1058686_1058914_+	Rha family transcriptional regulator	NA	K7PKS2	Enterobacteria_phage	95.9	1.5e-34
AYS77042.1|1058933_1059254_+	repressor	NA	A0A0M4RU01	Salmonella_phage	100.0	1.3e-52
AYS77043.1|1059548_1059764_-	hypothetical protein	NA	NA	NA	NA	NA
AYS77044.1|1059773_1060589_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	83.1	8.8e-37
AYS77045.1|1060591_1061341_+	DNA replication protein	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
AYS77046.1|1061351_1061699_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
AYS77047.1|1061695_1062220_+	bacteriophage protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
AYS77048.1|1062219_1062693_+	methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
AYS77049.1|1062696_1063269_+	bacteriophage protein	NA	S4TSR6	Salmonella_phage	68.0	1.3e-66
AYS77050.1|1063362_1063629_+	bacteriophage protein	NA	S4TNF2	Salmonella_phage	100.0	1.5e-46
AYS77051.1|1063710_1063872_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS77052.1|1064304_1064802_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS77053.1|1064986_1065226_+	damage-inducible protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
1065182:1065217	attR	CAGGAAACGTGGGAAAGCGCTGACGACTGGTTTTAT	NA	NA	NA	NA
AYS77054.1|1065215_1065521_+	bacteriophage protein	NA	H6WRY6	Salmonella_phage	100.0	9.8e-42
AYS77055.1|1065560_1066163_+	bacteriophage protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
AYS77056.1|1066371_1066983_+	bacteriophage lambda protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	2.5e-92
AYS77057.1|1067115_1067913_+	prophage antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	3.4e-150
AYS77058.1|1068311_1068437_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS77059.1|1068572_1069022_-	lipoprotein	NA	NA	NA	NA	NA
AYS77060.1|1069238_1069628_+	prophage membrane protein	NA	K7PHB9	Enterobacterial_phage	70.2	3.1e-40
AYS77061.1|1069614_1069896_+	prophage membrane protein	NA	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
AYS77062.1|1069895_1070510_+	bacteriophage protein	NA	Q8HA86	Salmonella_phage	93.1	3.2e-108
AYS77063.1|1070729_1070984_+	hypothetical protein	NA	NA	NA	NA	NA
AYS77064.1|1071088_1071466_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	68.5	4.9e-43
AYS77065.1|1071529_1071790_+	hypothetical protein	NA	NA	NA	NA	NA
AYS77066.1|1071879_1072632_+|terminase	prophage terminase small subunit	terminase	A0A0M3ULJ9	Salmonella_phage	56.5	3.4e-11
AYS77067.1|1072597_1074001_+	bacteriophage protein	NA	A0A077KAW0	Edwardsiella_phage	70.1	6.5e-189
AYS77068.1|1074000_1075470_+	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.7e-280
AYS77069.1|1075561_1076092_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.4	8.7e-86
AYS77070.1|1076106_1077339_+	hypothetical protein	NA	A0A0M4R5A6	Salmonella_phage	99.0	1.4e-227
AYS77071.1|1077343_1077841_+	bacteriophage protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
AYS77072.1|1077852_1078794_+	bacteriophage protein	NA	A0A0M3ULD3	Salmonella_phage	100.0	3.1e-179
AYS77073.1|1078835_1079204_+	bacteriophage protein	NA	A0A0M4RTX5	Salmonella_phage	100.0	8.7e-61
AYS77074.1|1079169_1079577_+	bacteriophage protein	NA	A0A0M5M3S2	Salmonella_phage	97.8	7.1e-72
AYS77075.1|1079573_1080128_+	bacteriophage protein	NA	A0A0M4S631	Salmonella_phage	100.0	4.8e-95
AYS77076.1|1080114_1080504_+	bacteriophage protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	6.0e-68
AYS77077.1|1080478_1081042_+	bacteriophage protein	NA	A0A0M4R331	Salmonella_phage	75.3	8.9e-81
AYS77078.1|1081045_1082191_+	bacteriophage protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.5	2.2e-163
AYS77079.1|1082202_1082643_+	bacteriophage protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	3.5e-56
AYS77080.1|1082646_1083099_+	bacteriophage protein	NA	A0A0M4S6U8	Salmonella_phage	76.6	1.9e-57
AYS77081.1|1083276_1085229_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.0	1.8e-181
AYS77082.1|1085228_1085879_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	60.6	3.0e-56
AYS77083.1|1085882_1086185_+	bacteriophage protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.0	2.0e-26
AYS77084.1|1086187_1087219_+	bacteriophage protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	51.4	1.2e-96
AYS77085.1|1087215_1087551_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	52.2	1.1e-20
AYS77086.1|1087745_1088477_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS77087.1|1088476_1088905_+	bacteriophage protein	NA	NA	NA	NA	NA
AYS77088.1|1088963_1089719_+	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	85.3	4.1e-105
AYS77089.1|1089806_1089944_+	bacteriophage protein	NA	A0A0M4S639	Salmonella_phage	100.0	2.0e-18
AYS77090.1|1089959_1090313_+	bacteriophage protein	NA	A0A0M4R339	Salmonella_phage	98.3	3.2e-60
AYS77091.1|1090313_1091513_+	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	8.5e-214
AYS77092.1|1091509_1092190_+	bacteriophage protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	6.9e-128
AYS77093.1|1092189_1093701_+|tail	bacteriophage tail protein	tail	S4TP62	Salmonella_phage	59.4	1.5e-111
AYS77094.1|1093715_1094234_+|tail	tail fiber protein	tail	A0A1B0VCD0	Salmonella_phage	62.8	1.7e-46
AYS77095.1|1095155_1095857_-	hypothetical protein	NA	NA	NA	NA	NA
AYS77096.1|1096169_1096448_-	hypothetical protein	NA	S4TNM0	Salmonella_phage	92.3	2.4e-26
AYS77097.1|1096873_1099486_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	1.1e-19
AYS77098.1|1099693_1100704_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
AYS77099.1|1100866_1101412_+	hypothetical protein	NA	NA	NA	NA	NA
AYS77100.1|1101408_1102518_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
AYS77101.1|1102616_1104725_+	23S rRNA m(2)G2445 methyltransferase	NA	W6LLI2	Streptococcus_phage	29.6	5.1e-20
AYS77102.1|1104737_1106645_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
AYS77103.1|1106659_1107913_+	inner membrane protein	NA	NA	NA	NA	NA
AYS77104.1|1107917_1109558_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
AYS77105.1|1109554_1110118_+	lipoprotein	NA	NA	NA	NA	NA
AYS77106.1|1110371_1110539_+	ribosome modulation factor	NA	NA	NA	NA	NA
AYS77107.1|1110638_1111157_-	D-3-hydroxydecanoyl-(acyl carrier-protein) dehydratase	NA	NA	NA	NA	NA
AYS77108.1|1111225_1112986_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
AYS77109.1|1113171_1113624_+	Ter macrodomain organizer matS-binding protein	NA	NA	NA	NA	NA
AYS77110.1|1113695_1114748_-	outer membrane protein A	NA	NA	NA	NA	NA
AYS77111.1|1115102_1115612_-	cell division inhibitor	NA	NA	NA	NA	NA
AYS77112.1|1115828_1116434_+	competence-specific transcriptional regulator TfoX	NA	NA	NA	NA	NA
AYS77113.1|1116420_1118574_-	inner membrane protein	NA	NA	NA	NA	NA
AYS77114.1|1118592_1119039_-	hypothetical protein	NA	NA	NA	NA	NA
AYS77115.1|1119162_1121217_+	helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
AYS77116.1|1121252_1121711_-	methylglyoxal synthase	NA	NA	NA	NA	NA
AYS77117.1|1121805_1122468_-	hypothetical protein	NA	NA	NA	NA	NA
AYS77118.1|1122638_1123055_+	hypothetical protein	NA	NA	NA	NA	NA
AYS77119.1|1123099_1123417_-	heat shock protein HspQ	NA	NA	NA	NA	NA
AYS77120.1|1123474_1124686_-	23S rRNA m(5)C1962 methyltransferase	NA	NA	NA	NA	NA
AYS77121.1|1125817_1126276_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS77122.1|1127012_1127294_+	acylphosphatase	NA	NA	NA	NA	NA
AYS77123.1|1127290_1127620_-	sulfite reductase	NA	NA	NA	NA	NA
AYS77124.1|1127706_1128366_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
AYS77125.1|1129029_1129488_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 3
CP029902	Salmonella enterica subsp. enterica serovar Typhi strain 311189_268103 chromosome, complete genome	4804086	1573769	1647339	4804086	plate,head,tRNA,protease,tail,transposase	Burkholderia_virus(42.11%)	81	NA	NA
AYS77530.1|1573769_1574228_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS77531.1|1574730_1575012_+	stress response protein	NA	NA	NA	NA	NA
AYS77532.1|1575280_1576102_+|protease	serine protease	protease	NA	NA	NA	NA
AYS77533.1|1576136_1576466_-	multidrug efflux system protein MdtI	NA	NA	NA	NA	NA
AYS77534.1|1576452_1576815_-	multidrug efflux system protein MdtJ	NA	NA	NA	NA	NA
AYS77535.1|1576926_1577097_-	hypothetical protein	NA	NA	NA	NA	NA
AYS77536.1|1577231_1578266_+	hypothetical protein	NA	NA	NA	NA	NA
AYS77537.1|1578440_1579829_-	pyridine nucleotide transhydrogenase subunit beta	NA	NA	NA	NA	NA
AYS77538.1|1579839_1581369_-	pyridine nucleotide transhydrogenase subunit alpha	NA	NA	NA	NA	NA
AYS77539.1|1581895_1582840_+	hypothetical protein	NA	NA	NA	NA	NA
AYS77540.1|1583021_1583411_-	bacteriophage transcriptional regulator	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
AYS77541.1|1583382_1583835_-	hypothetical protein	NA	A4JWM5	Burkholderia_virus	46.6	1.2e-24
AYS77542.1|1584029_1584260_-	hypothetical protein	NA	NA	NA	NA	NA
AYS77543.1|1584256_1584940_-	hypothetical protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
AYS77544.1|1584936_1585152_-	hypothetical protein	NA	NA	NA	NA	NA
AYS77545.1|1585144_1585528_-	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	58.9	2.3e-27
AYS77546.1|1585524_1585827_-	hypothetical protein	NA	NA	NA	NA	NA
AYS77547.1|1585836_1586109_-	hypothetical protein	NA	NA	NA	NA	NA
AYS77548.1|1586397_1586928_-	bacteriophage host-nuclease inhibitor protein	NA	L7P7T1	Pseudomonas_phage	66.1	3.4e-58
AYS77549.1|1586955_1587225_-	hypothetical protein	NA	NA	NA	NA	NA
AYS77550.1|1587227_1588394_-	ExeA protein	NA	A4JWN1	Burkholderia_virus	59.7	3.3e-122
AYS77551.1|1588404_1590174_-	hypothetical protein	NA	Q6QIE0	Burkholderia_phage	68.5	2.8e-229
AYS77552.1|1590351_1590783_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	57.3	4.5e-32
AYS77553.1|1590778_1591375_+	hypothetical protein	NA	NA	NA	NA	NA
AYS77554.1|1591618_1591969_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.0	4.5e-22
AYS77555.1|1592683_1593334_+	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	32.9	8.1e-09
AYS77556.1|1593330_1593657_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
AYS77557.1|1593656_1593968_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
AYS77558.1|1593967_1594513_+	hypothetical protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
AYS77559.1|1594509_1596105_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.6	9.3e-184
AYS77560.1|1596104_1597601_+	hypothetical protein	NA	A4JWJ5	Burkholderia_virus	59.6	8.0e-169
AYS77561.1|1597581_1598403_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.2	5.3e-98
AYS77562.1|1598405_1598864_+	bacteriophage protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
AYS77563.1|1599078_1600194_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.1	7.9e-97
AYS77564.1|1600208_1601162_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	5.2e-65
AYS77565.1|1601171_1601510_+	hypothetical protein	NA	NA	NA	NA	NA
AYS77566.1|1601511_1601958_+	hypothetical protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
AYS77567.1|1601957_1602422_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
AYS77568.1|1602418_1602673_+	hypothetical protein	NA	NA	NA	NA	NA
AYS77569.1|1602662_1604090_+|tail	bacteriophage tail sheath protein	tail	A4JWK5	Burkholderia_virus	77.4	3.7e-216
AYS77570.1|1604089_1604611_+|tail	tail core protein	tail	A4JWK6	Burkholderia_virus	68.2	8.0e-68
AYS77571.1|1604613_1604895_+	hypothetical protein	NA	NA	NA	NA	NA
AYS77572.1|1604992_1605328_+	hypothetical protein	NA	NA	NA	NA	NA
AYS77573.1|1605503_1607969_+	bacteriophage protein	NA	A4JWL0	Burkholderia_virus	42.6	2.2e-168
AYS77574.1|1607968_1608853_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	7.5e-50
AYS77575.1|1608849_1609065_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
AYS77576.1|1609052_1610207_+	bacteriophage regulatory protein	NA	Q6QIA2	Burkholderia_phage	47.1	4.7e-84
AYS77577.1|1610203_1610731_+|plate	bacteriophage baseplate protein	plate	Q6QIA1	Burkholderia_phage	46.5	1.5e-21
AYS77578.1|1610787_1611135_+|plate	bacteriophage baseplate protein	plate	Q6QIA0	Burkholderia_phage	60.6	8.6e-34
AYS77579.1|1611125_1612229_+|plate	bacteriophage baseplate assembly protein	plate	Q6QI99	Burkholderia_phage	54.3	5.4e-106
AYS77580.1|1612221_1612800_+|tail	bacteriophage tail fiber protein	tail	A4JWL7	Burkholderia_virus	65.8	6.4e-66
AYS77581.1|1612802_1613828_+|tail	bacteriophage tail fiber protein	tail	M1TAS6	Escherichia_phage	53.3	1.6e-64
AYS77582.1|1614341_1614959_+|tail	bacteriophage tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	59.9	5.8e-65
AYS77583.1|1615452_1615845_-	hypothetical protein	NA	Q9MCR6	Enterobacteria_phage	51.9	1.2e-18
AYS77584.1|1616441_1617014_+	DNA-invertase	NA	A0A0A7NPV4	Enterobacteria_phage	84.7	8.8e-84
AYS77585.1|1617294_1618677_+	amino acid permease	NA	NA	NA	NA	NA
AYS77586.1|1618738_1619074_-	hypothetical protein	NA	NA	NA	NA	NA
AYS77587.1|1619200_1619932_+	two-component response regulator	NA	NA	NA	NA	NA
AYS77588.1|1620412_1621564_+	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	59.1	3.2e-117
AYS77589.1|1621716_1623423_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
AYS77590.1|1623530_1624835_+	two component sensor kinase	NA	W8CYF6	Bacillus_phage	22.7	5.7e-14
AYS77591.1|1624910_1625840_+	DNA sequence-specific contrahelicase	NA	NA	NA	NA	NA
AYS77592.1|1625836_1627240_-	fumarate hydratase class II	NA	NA	NA	NA	NA
AYS77593.1|1627407_1629054_-	Fumarate hydratase class I	NA	NA	NA	NA	NA
AYS77594.1|1629253_1630429_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
AYS77595.1|1630531_1632040_+	hypothetical protein	NA	NA	NA	NA	NA
AYS77596.1|1632745_1633747_+	adenosine deaminase	NA	NA	NA	NA	NA
AYS77597.1|1633820_1634936_-	oxidoreductase	NA	NA	NA	NA	NA
AYS77598.1|1635038_1635194_+	hypothetical protein	NA	NA	NA	NA	NA
AYS77599.1|1635492_1635708_+	oriC-binding nucleoid-associated protein	NA	NA	NA	NA	NA
AYS77600.1|1635796_1636237_+	hypothetical protein	NA	NA	NA	NA	NA
AYS77601.1|1636313_1636895_+	Na(+)-translocating NADH-quinone reductase subunit E	NA	NA	NA	NA	NA
AYS77602.1|1636894_1637473_+	ferredoxin-like protein	NA	NA	NA	NA	NA
AYS77603.1|1637465_1639487_+	NADH reducing dehydrogenase	NA	NA	NA	NA	NA
AYS77604.1|1639487_1640546_+	electron transport complex protein RnfD	NA	NA	NA	NA	NA
AYS77605.1|1640549_1641170_+	electron transport complex protein RnfG	NA	NA	NA	NA	NA
AYS77606.1|1641172_1641865_+	electron transport complex protein RsxE	NA	NA	NA	NA	NA
AYS77607.1|1641864_1642500_+	endonuclease III	NA	NA	NA	NA	NA
AYS77608.1|1643100_1644606_+	proton/oligopeptide symporter	NA	NA	NA	NA	NA
AYS77609.1|1644710_1645316_+	glutathione S-transferase	NA	NA	NA	NA	NA
AYS77610.1|1646064_1647339_-|tRNA	tyrosyl-tRNA synthetase	tRNA	K4F5T3	Cronobacter_phage	42.1	1.6e-85
>prophage 4
CP029902	Salmonella enterica subsp. enterica serovar Typhi strain 311189_268103 chromosome, complete genome	4804086	1828377	1832789	4804086		Escherichia_phage(50.0%)	6	NA	NA
AYS77792.1|1828377_1828617_+	virulence protein	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
AYS77793.1|1829489_1830299_+	toxin-like protein	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
AYS77794.1|1830371_1830749_+	hypothetical protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
AYS77795.1|1830896_1831439_-	hypothetical protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
AYS77796.1|1831630_1832359_-	pertussis toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	53.3	4.9e-63
AYS77797.1|1832375_1832789_-	pertussis-like toxin subunit	NA	A0A0U2KD34	Escherichia_phage	38.6	1.4e-19
>prophage 5
CP029902	Salmonella enterica subsp. enterica serovar Typhi strain 311189_268103 chromosome, complete genome	4804086	2036662	2043896	4804086		Morganella_phage(33.33%)	7	NA	NA
AYS77987.1|2036662_2038093_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
AYS77988.1|2038166_2038862_-	hypothetical protein	NA	S4W232	Pandoravirus	27.5	2.1e-07
AYS77989.1|2038941_2039253_-	hypothetical protein	NA	NA	NA	NA	NA
AYS77990.1|2039903_2041088_+	outer membrane protein S1	NA	Q1MVN1	Enterobacteria_phage	56.4	1.4e-107
AYS77991.1|2041547_2041760_-	cold shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	1.5e-20
AYS77992.1|2042205_2043474_-	DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	91.2	3.3e-224
AYS77993.1|2043476_2043896_-	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
CP029902	Salmonella enterica subsp. enterica serovar Typhi strain 311189_268103 chromosome, complete genome	4804086	2127638	2138145	4804086		Enterobacteria_phage(37.5%)	10	NA	NA
AYS78070.1|2127638_2128952_-	dehydratase RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
AYS78071.1|2128978_2130058_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	1.3e-16
AYS78072.1|2130062_2130836_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
AYS78073.1|2130851_2131826_-	reductase RfbI	NA	NA	NA	NA	NA
AYS78074.1|2131831_2132383_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.6	7.7e-53
AYS78075.1|2132383_2133262_-	TDP-glucose pyrophosphorylase	NA	I7I009	Enterobacteria_phage	64.8	2.3e-107
AYS78076.1|2133309_2134209_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
AYS78077.1|2134208_2135294_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
AYS78078.1|2135670_2136564_-	UTP-glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
AYS78079.1|2136741_2138145_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	1.1e-21
>prophage 7
CP029902	Salmonella enterica subsp. enterica serovar Typhi strain 311189_268103 chromosome, complete genome	4804086	2214037	2223208	4804086	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
AYS78137.1|2214037_2216071_+|tRNA	methionyl-tRNA synthetase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
AYS78138.1|2216311_2216770_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
AYS78139.1|2216941_2217472_+	lipoprotein	NA	NA	NA	NA	NA
AYS78140.1|2217528_2217996_-	hypothetical protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
AYS78141.1|2218042_2218762_-	two-component system response regulator	NA	NA	NA	NA	NA
AYS78142.1|2218758_2220444_-	two-component system sensor kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.1e-278
AYS78143.1|2220666_2221398_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
AYS78144.1|2221457_2221565_+	hypothetical protein	NA	NA	NA	NA	NA
AYS78145.1|2221545_2222277_-	ABC transporter permease	NA	NA	NA	NA	NA
AYS78146.1|2222260_2223208_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
CP029902	Salmonella enterica subsp. enterica serovar Typhi strain 311189_268103 chromosome, complete genome	4804086	2758748	2772140	4804086	tail	Salmonella_phage(70.0%)	11	NA	NA
AYS78575.1|2758748_2758967_-	hypothetical protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
AYS78576.1|2759057_2760158_-	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS78577.1|2760154_2760640_-|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS78578.1|2760636_2763714_-|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
AYS78579.1|2763706_2763826_-	hypothetical protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS78580.1|2763840_2764143_-|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS78581.1|2764197_2764713_-|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS78582.1|2764722_2765895_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS78583.1|2766037_2766610_-	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS78584.1|2767287_2768403_+	glycosyltransferase	NA	NA	NA	NA	NA
AYS78585.1|2768483_2772140_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	28.6	1.0e-44
>prophage 9
CP029902	Salmonella enterica subsp. enterica serovar Typhi strain 311189_268103 chromosome, complete genome	4804086	3089412	3133115	4804086	transposase,bacteriocin,protease,tRNA	Bacillus_virus(33.33%)	44	NA	NA
AYS78873.1|3089412_3089871_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS78874.1|3090060_3091140_-	fructose 1,6-bisphosphate aldolase	NA	NA	NA	NA	NA
AYS78875.1|3091241_3092405_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
AYS78876.1|3092426_3093473_-	D-erythrose 4-phosphate dehydrogenase	NA	NA	NA	NA	NA
AYS78877.1|3093846_3094272_+	hypothetical protein	NA	NA	NA	NA	NA
AYS78878.1|3094297_3094876_+	hypothetical protein	NA	NA	NA	NA	NA
AYS78879.1|3094909_3095584_+	hypothetical protein	NA	NA	NA	NA	NA
AYS78880.1|3095565_3096249_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
AYS78881.1|3096242_3096899_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.6	1.6e-09
AYS78882.1|3097003_3097462_-|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS78883.1|3097650_3099642_-	transketolase	NA	NA	NA	NA	NA
AYS78884.1|3099917_3100676_+|protease	metalloprotease	protease	NA	NA	NA	NA
AYS78885.1|3100776_3101697_-	agmatine ureohydrolase	NA	NA	NA	NA	NA
AYS78886.1|3101924_3103901_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
AYS78887.1|3103909_3104041_-	hypothetical protein	NA	NA	NA	NA	NA
AYS78888.1|3104335_3104635_-	membrane protein	NA	NA	NA	NA	NA
AYS78889.1|3104690_3105845_+	S-adenosylmethionine synthetase	NA	A0A2H4PQS6	Staphylococcus_phage	63.9	1.5e-130
AYS78890.1|3106337_3107732_+	galactose-proton symport	NA	NA	NA	NA	NA
AYS78891.1|3107810_3108308_+	hypothetical protein	NA	NA	NA	NA	NA
AYS78892.1|3108403_3109111_+	endonuclease I	NA	NA	NA	NA	NA
AYS78893.1|3109187_3109919_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
AYS78894.1|3109938_3110886_+	glutathione synthetase	NA	NA	NA	NA	NA
AYS78895.1|3111101_3111665_+	hypothetical protein	NA	NA	NA	NA	NA
AYS78896.1|3111664_3112081_+	Holliday junction resolvase	NA	NA	NA	NA	NA
AYS78897.1|3112127_3112814_-	global regulatory protein	NA	NA	NA	NA	NA
AYS78898.1|3112943_3113924_-	type II secretion system ATP-binding protein	NA	NA	NA	NA	NA
AYS78899.1|3113941_3114646_+	hypothetical protein	NA	NA	NA	NA	NA
AYS78900.1|3114664_3115231_+	hypothetical protein	NA	NA	NA	NA	NA
AYS78901.1|3115227_3115518_+	hypothetical protein	NA	NA	NA	NA	NA
AYS78902.1|3115525_3116119_+	dITP/XTP pyrophosphatase	NA	NA	NA	NA	NA
AYS78903.1|3116111_3117248_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
AYS78904.1|3117338_3118346_-	hypothetical protein	NA	NA	NA	NA	NA
AYS78905.1|3118478_3119525_-	L-asparaginase	NA	NA	NA	NA	NA
AYS78906.1|3119843_3120302_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
AYS78907.1|3120424_3121144_-	hypothetical protein	NA	NA	NA	NA	NA
AYS78908.1|3121193_3121520_-	hypothetical protein	NA	NA	NA	NA	NA
AYS78909.1|3121519_3122239_-|tRNA	tRNA m(7)G46 methyltransferase	tRNA	NA	NA	NA	NA
AYS78910.1|3122393_3123446_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
AYS78911.1|3123473_3123749_+	oxidative damage protection protein	NA	NA	NA	NA	NA
AYS78912.1|3123861_3124947_+	membrane-bound lytic murein transglycosylase C	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
AYS78913.1|3125163_3126420_+	nucleoside permease	NA	NA	NA	NA	NA
AYS78914.1|3129030_3129738_+	hypothetical protein	NA	NA	NA	NA	NA
AYS78915.1|3132327_3132594_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
AYS78916.1|3132836_3133115_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 10
CP029902	Salmonella enterica subsp. enterica serovar Typhi strain 311189_268103 chromosome, complete genome	4804086	3510302	3548360	4804086	plate,terminase,integrase,tail,transposase,capsid,portal	Salmonella_phage(82.05%)	46	3505266:3505280	3517432:3517446
3505266:3505280	attL	CGAATTTCTTTTTCA	NA	NA	NA	NA
AYS79245.1|3510302_3511949_-	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	9.0e-65
AYS79246.1|3512088_3512187_-	ilvGMEDA operon attenuator peptide	NA	NA	NA	NA	NA
AYS79247.1|3512442_3512772_+	hypothetical protein	NA	NA	NA	NA	NA
AYS79248.1|3512812_3513865_-|integrase	bacteriophage integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
AYS79249.1|3514260_3514830_-	repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	43.4	2.5e-38
AYS79250.1|3514955_3515177_+	hypothetical protein	NA	NA	NA	NA	NA
AYS79251.1|3515209_3515719_+	regulatory protein cII	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
AYS79252.1|3515893_3516118_+	hypothetical protein	NA	NA	NA	NA	NA
AYS79253.1|3516140_3516482_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
AYS79254.1|3516549_3516783_+	hypothetical protein	NA	E5G6L6	Salmonella_phage	94.8	2.0e-31
AYS79255.1|3516782_3517010_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
AYS79256.1|3517006_3517864_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	3.5e-161
3517432:3517446	attR	TGAAAAAGAAATTCG	NA	NA	NA	NA
AYS79257.1|3517860_3520275_+	endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
AYS79258.1|3520428_3520617_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
AYS79259.1|3522584_3523499_+	hypothetical protein	NA	NA	NA	NA	NA
AYS79260.1|3523495_3524236_+	hypothetical protein	NA	NA	NA	NA	NA
AYS79261.1|3524270_3525308_-|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	89.5	1.3e-173
AYS79262.1|3525307_3527074_-|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
AYS79263.1|3527216_3528050_+|capsid	capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.5e-121
AYS79264.1|3528066_3529125_+|capsid	major capsid protein	capsid	E5G6M6	Salmonella_phage	93.1	1.4e-180
AYS79265.1|3529128_3529779_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
AYS79266.1|3529811_3530339_+|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	89.0	2.1e-76
AYS79267.1|3530338_3530542_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
AYS79268.1|3530545_3530761_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
AYS79269.1|3530780_3531254_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
AYS79270.1|3531255_3531633_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
AYS79271.1|3531629_3532058_+	regulatory protein	NA	E5G6N2	Salmonella_phage	77.3	2.2e-47
AYS79272.1|3532153_3532585_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	95.1	1.5e-72
AYS79273.1|3532577_3533024_+|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
AYS79274.1|3533092_3533671_+|plate	phage baseplate assembly protein	plate	A0A1S6KZX7	Salmonella_phage	86.5	5.5e-94
AYS79275.1|3533667_3534027_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	6.1e-51
AYS79276.1|3534013_3534922_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	1.3e-142
AYS79277.1|3534914_3535520_+|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS79278.1|3535516_3537031_+|tail	variable tail fiber protein	tail	M1TAS6	Escherichia_phage	73.2	6.8e-200
AYS79279.1|3537030_3537624_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	64.3	9.2e-60
AYS79280.1|3537595_3538036_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	68.0	3.1e-52
AYS79281.1|3538458_3539031_+	DNA-invertase	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
AYS79282.1|3539173_3540346_+|tail	bacteriophage major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	3.5e-204
AYS79283.1|3540355_3540871_+|tail	major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
AYS79284.1|3540925_3541228_+|tail	phage tail protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
AYS79285.1|3541242_3541362_+	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	87.2	2.8e-13
AYS79286.1|3541354_3544432_+|tail	bacteriophage tail protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
AYS79287.1|3544428_3544914_+|tail	bacteriophage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	2.4e-66
AYS79288.1|3544910_3546011_+	hypothetical protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	1.0e-176
AYS79289.1|3546101_3546320_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
AYS79290.1|3547901_3548360_+|transposase	insertion sequence element IS200 transposase	transposase	NA	NA	NA	NA
>prophage 11
CP029902	Salmonella enterica subsp. enterica serovar Typhi strain 311189_268103 chromosome, complete genome	4804086	4463705	4537975	4804086	plate,terminase,integrase,tail,capsid,portal	Salmonella_phage(82.61%)	75	4525219:4525235	4538134:4538150
AYS80061.1|4463705_4465655_+	hypothetical protein	NA	A0A2K9V411	Faecalibacterium_phage	38.3	5.9e-31
AYS80062.1|4465726_4466635_+	hypothetical protein	NA	NA	NA	NA	NA
AYS80063.1|4466708_4467608_+	hypothetical protein	NA	NA	NA	NA	NA
AYS80064.1|4467649_4468009_+	hypothetical protein	NA	NA	NA	NA	NA
AYS80065.1|4468108_4468378_-	hypothetical protein	NA	NA	NA	NA	NA
AYS80066.1|4468509_4469784_-	UV protection protein	NA	F1C5A5	Cronobacter_phage	62.0	7.5e-152
AYS80067.1|4470003_4470381_+	hypothetical protein	NA	NA	NA	NA	NA
AYS80068.1|4470467_4470686_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	75.0	4.9e-27
AYS80069.1|4470753_4471854_-	hypothetical protein	NA	E5G6Q3	Salmonella_phage	92.1	7.9e-190
AYS80070.1|4471850_4472336_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.2	9.4e-71
AYS80071.1|4472335_4475116_-	hypothetical protein	NA	A0A2H4JGB2	uncultured_Caudovirales_phage	41.1	3.5e-125
AYS80072.1|4475108_4475228_-	bacteriophage protein	NA	E5G6Q0	Salmonella_phage	94.9	1.2e-14
AYS80073.1|4475242_4475545_-|tail	phage tail protein	tail	E5G6P9	Salmonella_phage	93.9	3.3e-42
AYS80074.1|4475599_4476115_-|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
AYS80075.1|4476124_4477297_-|tail	major tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	9.8e-223
AYS80076.1|4477831_4478554_+	invasion-associated secreted protein	NA	NA	NA	NA	NA
AYS80077.1|4478751_4479159_-|tail	phage tail fiber protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
AYS80078.1|4479165_4480785_-|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	90.9	2.7e-154
AYS80079.1|4480781_4481387_-|tail	phage tail protein	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
AYS80080.1|4481379_4482288_-|plate	phage baseplate assembly protein	plate	E5G6N8	Salmonella_phage	97.0	5.2e-155
AYS80081.1|4482274_4482634_-|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
AYS80082.1|4482630_4483209_-|plate	phage baseplate assembly protein	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
AYS80083.1|4483277_4483724_-|tail	phage tail completion protein	tail	A0A1S6L001	Salmonella_phage	90.4	2.2e-66
AYS80084.1|4483716_4484148_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
AYS80085.1|4484243_4484669_-	regulatory protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	2.5e-67
AYS80086.1|4484668_4485046_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	99.2	1.5e-60
AYS80087.1|4485050_4485521_-	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	97.4	1.0e-85
AYS80088.1|4485540_4485756_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	98.6	3.8e-32
AYS80089.1|4485759_4485963_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
AYS80090.1|4485962_4486427_-|capsid	capsid completion protein	capsid	A0A1S6KZW8	Salmonella_phage	98.1	2.4e-84
AYS80091.1|4486520_4487171_-|terminase	phage terminase	terminase	E5G6M7	Salmonella_phage	99.5	2.4e-114
AYS80092.1|4487174_4488239_-|capsid	major capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	98.3	1.3e-194
AYS80093.1|4488255_4489089_-|capsid	capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	87.4	6.1e-126
AYS80094.1|4489231_4490998_+|terminase	terminase subunit	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
AYS80095.1|4490994_4492041_+|capsid,portal	capsid portal protein	capsid,portal	A0A1S6KZW5	Salmonella_phage	86.6	2.1e-176
AYS80096.1|4492089_4492785_-	hypothetical protein	NA	NA	NA	NA	NA
AYS80097.1|4492804_4493869_-	hypothetical protein	NA	NA	NA	NA	NA
AYS80098.1|4493865_4494930_-	hypothetical protein	NA	NA	NA	NA	NA
AYS80099.1|4495854_4498263_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	95.1	0.0e+00
AYS80100.1|4498253_4499114_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.8	3.4e-132
AYS80101.1|4499110_4499695_-	exonuclease	NA	A0A1S6L012	Salmonella_phage	73.7	1.1e-76
AYS80102.1|4499691_4499919_-	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	94.7	1.0e-35
AYS80103.1|4499918_4500152_-	hypothetical protein	NA	A0A1S6L021	Salmonella_phage	84.4	9.8e-26
AYS80104.1|4500219_4500561_-	hypothetical protein	NA	A0A1S6L019	Salmonella_phage	99.1	4.6e-56
AYS80105.1|4500524_4500725_-	hypothetical protein	NA	A0A1S6L005	Salmonella_phage	97.0	4.6e-32
AYS80106.1|4500732_4501242_-	phage regulatory protein	NA	A0A1S6L008	Salmonella_phage	94.1	1.3e-83
AYS80107.1|4501274_4501517_-	phage regulatory protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
AYS80108.1|4501633_4502266_+	phage repressor protein cI	NA	A0A1S6KZZ7	Salmonella_phage	58.6	1.4e-66
AYS80109.1|4502269_4503295_+|integrase	phage integrase	integrase	A0A1S6L016	Salmonella_phage	98.2	2.7e-200
AYS80110.1|4503401_4503755_-	protein samA'	NA	I6S1S3	Salmonella_phage	59.3	6.7e-10
AYS80111.1|4504371_4504659_+	hypothetical protein	NA	NA	NA	NA	NA
AYS80112.1|4504669_4505560_+	methyltransferase	NA	NA	NA	NA	NA
AYS80113.1|4505559_4506306_+	hypothetical protein	NA	NA	NA	NA	NA
AYS80114.1|4506607_4508578_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS80115.1|4508597_4509902_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS80116.1|4509924_4510620_-	Vi polysaccharide exporter ATP-binding protein	NA	NA	NA	NA	NA
AYS80117.1|4510645_4511440_-	Vi polysaccharide exporter inner-membrane protein	NA	NA	NA	NA	NA
AYS80118.1|4511449_4512517_-	Vi polysaccharide exporter protein	NA	NA	NA	NA	NA
AYS80119.1|4512561_4514298_-	Vi polysaccharide biosynthesis protein TviE	NA	NA	NA	NA	NA
AYS80120.1|4514297_4516793_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS80121.1|4516816_4517863_-	Vi polysaccharide biosynthesis epimerase	NA	A0A2K9L0I7	Tupanvirus	45.0	1.4e-74
AYS80122.1|4517865_4519143_-	Vi polysaccharide biosynthesis UDP-glucose/GDP-mannose dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	26.7	1.6e-21
AYS80123.1|4519387_4519927_-	Vi polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
AYS80124.1|4520780_4522292_+	DNA helicase	NA	A0A126DN25	Acinetobacter_phage	29.0	2.0e-42
AYS80125.1|4522275_4523865_+	hypothetical protein	NA	NA	NA	NA	NA
AYS80126.1|4524028_4525042_+|integrase	phage integrase	integrase	NA	NA	NA	NA
4525219:4525235	attL	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
AYS80127.1|4525468_4525762_+	hypothetical protein	NA	NA	NA	NA	NA
AYS80128.1|4525758_4526247_+	hypothetical protein	NA	NA	NA	NA	NA
AYS80129.1|4526426_4526879_-	hypothetical protein	NA	NA	NA	NA	NA
AYS80130.1|4532101_4532563_+	hypothetical protein	NA	NA	NA	NA	NA
AYS80131.1|4532559_4532781_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.3	4.6e-17
AYS80132.1|4533637_4534420_+	hypothetical protein	NA	NA	NA	NA	NA
AYS80133.1|4535046_4535271_-	hypothetical protein	NA	NA	NA	NA	NA
AYS80134.1|4535400_4536405_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
AYS80135.1|4536715_4537975_-|integrase	bacteriophage integrase	integrase	B7SYF8	Stenotrophomonas_phage	41.7	3.2e-78
4538134:4538150	attR	GTGGTGCCCGGACTCGG	NA	NA	NA	NA
>prophage 12
CP029902	Salmonella enterica subsp. enterica serovar Typhi strain 311189_268103 chromosome, complete genome	4804086	4680228	4686704	4804086	capsid	Enterobacteria_phage(66.67%)	8	NA	NA
AYS80272.1|4680228_4681305_-	protein kinase	NA	A0A2H4UU60	Bodo_saltans_virus	28.2	7.8e-17
AYS80273.1|4681301_4682375_-	protein kinase	NA	G9BWE0	Planktothrix_phage	44.7	6.5e-56
AYS80274.1|4682349_4683513_-	hypothetical protein	NA	NA	NA	NA	NA
AYS80275.1|4683788_4684355_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	1.8e-60
AYS80276.1|4684370_4684610_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	60.5	3.7e-20
AYS80277.1|4684613_4685474_-|capsid	phage capsid protein	capsid	NA	NA	NA	NA
AYS80278.1|4685896_4686220_+	phage DNA binding protein	NA	Q7M299	Enterobacteria_phage	70.0	3.6e-26
AYS80279.1|4686203_4686704_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	70.4	9.8e-31
>prophage 1
CP029903	Salmonella enterica subsp. enterica serovar Typhi strain 311189_268103 plasmid pk88, complete sequence	88544	5598	19084	88544	transposase	Enterobacteria_phage(36.36%)	13	NA	NA
AYS80378.1|5598_8148_-|transposase	transposase	transposase	Q1MVP5	Enterobacteria_phage	100.0	0.0e+00
AYS80379.1|8407_8740_+	hypothetical protein	NA	NA	NA	NA	NA
AYS80380.1|8786_9662_-	Beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
AYS80381.1|9917_11180_-|transposase	transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
AYS80382.1|11361_11673_-	hypothetical protein	NA	Q1MVP5	Enterobacteria_phage	99.0	7.2e-56
AYS80383.1|11743_12301_+	TnpR	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
AYS80384.1|12483_13344_+	beta-lactamase	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
AYS80385.1|13911_14541_-	Type II plasmid partioning protein	NA	E5FFJ3	Burkholderia_phage	31.1	2.0e-17
AYS80386.1|14741_16013_-	protein ImpB	NA	F1C5A5	Cronobacter_phage	60.4	2.2e-143
AYS80387.1|16012_16450_-	Protein ImpA	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
AYS80388.1|16446_16695_-	Protein ImpC	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
AYS80389.1|17044_18016_+	hypothetical protein	NA	NA	NA	NA	NA
AYS80390.1|18400_19084_+	hypothetical protein	NA	A0A2I7RE86	Vibrio_phage	37.9	5.1e-30
